A catalase mutant and use thereof
By directing the evolution of catalase and introducing specific amino acid mutations, the catalytic activity of the enzyme was improved, solving the problem of insufficient activity of existing catalases and achieving highly efficient catalytic effects for industrial applications.
Patent Information
- Application Number
- CN202410527085.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-29
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2044-04-29
AI Technical Summary
The existing catalase has insufficient enzyme activity to meet the actual needs of industrial production.
By directing the evolution of the amino acid sequence of wild-type catalase and introducing specific mutations such as A132G, T149L, M158L, and M349V, catalase mutants with high enzyme activity were obtained, and catalysts were prepared using an E. coli expression system.
It improves the catalytic activity of catalase, achieving shorter reaction time, less enzyme dosage, and higher substrate conversion rate, and is suitable for industrial production where temperature and pH conditions are easily controlled.
Smart Images

Figure CN118480521B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a catalase mutant, in particular to a catalase mutant with high enzyme activity and its application in catalyzing hydrogen peroxide decomposition, and belongs to the field of genetic engineering and enzyme engineering. BACKGROUND
[0002] Catalase is widely present in aerobic organisms and is distributed in animals, bacteria, fungi and archaea. Catalase decomposes H2O2 produced by reactive oxygen species (ROS) into oxygen and water through dismutation, helping cells resist oxidative stress. In addition, catalase has some other physiological functions. It can act as a protective agent for hemoglobin and other thiol-containing proteins. It is mainly combined with mitochondria and peroxisomes in cells and is coupled with a series of aerobic dehydrogenases such as D-amino acid oxidase to decompose toxins produced by cell metabolism. Catalase is composed of four subunits, each of which has a hemoglobin group as the main component of the protein.
[0003] Catalase has a wide range of applications in industrial production, environmental management, biosensors and other fields. In industrial production, catalase is often used to remove H2O2 after pasteurization of milk and on textiles and for food packaging. In environmental management, catalase can remove H2O2 in bleaching agents to reduce environmental pollution. In the field of biosensors, catalase can also be co-immobilized with other enzymes to detect H2O2 while monitoring other analytes, such as glucose oxidase-coupled biosensors, D-glutamine oxidase-coupled gamma-aminobutyric acid biosensors, etc.
[0004] Enzyme activity, also known as enzyme activity, refers to the ability of an enzyme to catalyze a chemical reaction. The size of the enzyme activity refers to the amount of substrate reduction or product increase per unit volume per unit time under certain conditions. In actual production and application, the higher the enzyme activity, the shorter the reaction time, the less the amount of enzyme used, and the higher the substrate conversion rate. Therefore, catalase with high enzyme activity has great significance for practical application. However, the known catalase has the problem of insufficient activity and cannot meet the actual needs of industrial production. SUMMARY
[0005] The purpose of the present application is to provide a catalase mutant. By directed evolution of the amino acids in the active site of wild-type catalase, a catalase mutant with high enzyme activity is obtained.
[0006] Technical solution: In a first aspect, the application provides a catalase mutant with high enzyme activity, which is obtained by mutating at least one of A132G, T149L, M158L and M349V from the amino acid sequence shown in SEQ ID NO. 1.
[0007] In a second aspect, the application provides a gene of catalase, which encodes the catalase mutant of the first aspect. The gene is obtained by base mutation from the nucleotide sequence shown in SEQ ID NO. 2.
[0008] In a third aspect, the application provides an expression vector comprising the nucleotide sequence of the second aspect. The expression vector is a pET system expression vector.
[0009] In a fourth aspect, the application provides a recombinant bacterium, which is Escherichia coli comprising the expression vector of the third aspect.
[0010] In a fifth aspect, the application provides a method for constructing a recombinant bacterium, comprising the following steps: (1) constructing an expression vector: connecting the gene of the second aspect with a digested plasmid to obtain a recombinant expression vector; (2) constructing a recombinant bacterium: transferring the constructed recombinant expression vector into an Escherichia coli competent cell, culturing and screening to obtain a recombinant bacterium.
[0011] In a sixth aspect, the application provides a catalyst comprising the enzyme mutant of the first aspect.
[0012] In a seventh aspect, the application provides an application of the catalase mutant in catalyzing decomposition of hydrogen peroxide. The reaction conditions include a reaction temperature of 25℃ and a pH of 5-9.
[0013] Advantages: Compared with the prior art, the application has the following remarkable advantages:
[0014] 1. The application provides a catalase mutant with high enzyme activity.
[0015] 2. The application provides a catalyst comprising the catalase mutant with high enzyme activity, which is easy to realize in terms of temperature conditions and pH conditions of catalytic reaction, and has the basis for industrial production and application.
[0016] 3. The application provides a gene encoding the catalase mutant, an expression vector comprising the gene encoding the catalase mutant, and a recombinant bacterium comprising the expression vector; and provides a preparation and application method of the catalase mutant. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 Figure 1 is a diagram showing the relative enzyme activity of wild-type catalase and enzyme mutants in catalyzing hydrogen peroxide.
[0018] Figure 2 Effect plot of absorbance values over time for different dilutions of crude enzyme liquor catalysing hydrogen peroxide.
[0019] Figure 3 Effect plot of absorbance change values over 1 min for hydrogen peroxide at different pH. DETAILED DESCRIPTION
[0020] The features and exemplary embodiments of the various aspects of the present application will be described below in detail. The specific embodiments of the present application listed are only as examples of the present application, and the present application is not limited to the specific embodiments described below.
[0021] Any equivalent modifications and substitutions of the embodiments described below are also within the scope of the present application for those skilled in the art. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present application should be encompassed within the scope of the present application. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. All reagents or instruments not mentioned by the manufacturers are conventional products available on the market. In order to better illustrate the present application, numerous specific details are given in the following detailed description of the embodiments. Those skilled in the art should understand that the present application can be implemented without some specific details. In some embodiments, methods, means, apparatuses and steps well known to those skilled in the art are not described in detail in order to highlight the main idea of the present application.
[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. As used in the description herein, the units used are international standard units, and the numerical values and numerical ranges appearing in the present application should be understood to include systematic errors inevitable in industrial production, unless otherwise specified.
[0023] In all discussions herein, the standard one-letter code for amino acids is used. Standard substitution notation is also used, i.e. A132G means that alanine (A) at position 132 at the N-terminus is replaced by glycine (G). A132G / T149L means that alanine (A) at position 132 at the N-terminus is replaced by glycine (G) and that threonine (T) at position 149 at the N-terminus is replaced by leucine (L).
[0024] The term "wild type" refers to a gene or gene product isolated from a naturally occurring source. A wild type gene is the most commonly observed gene in a population and is thus arbitrarily designed the "normal" or "wild type" form of the gene. In contrast, the term "modified," "mutant," or "variant" refers to a gene or gene product that displays a modification (e.g., substitution, truncation, or insertion) of the sequence, post-translational modification, and / or functional properties (e.g., altered properties) as compared to a wild type gene or gene product. Note that naturally occurring mutants can be isolated; these mutants are identified by the fact that they have altered properties as compared to a wild type gene or gene product. Methods for introducing or substituting naturally, non-naturally occurring amino acids are well known in the art.
[0025] Wild type catalase
[0026] Catalase is an enzyme that catalyzes the decomposition of hydrogen peroxide into oxygen and water. The present application utilizes the sequence and structural information of catalase disclosed in protein databases such as PDB, NCBI, etc. to screen some potential enzyme genes according to the principles of similarity of retrieved protein structures, conserved site analysis, and host source diversity. The catalase gene CAT catalase (Gene ID: 105106806) derived from Camelus dromedarius is finally selected as the research object, and the catalase expressed by the catalase gene has a nucleotide sequence as shown in SEQ ID NO. 2 and an amino acid sequence of the catalase expressed by the catalase gene as shown in SEQ ID NO. 1. The obtained enzyme gene is subjected to functional expression by an expression system of Escherichia coli, and a crude enzyme solution is obtained for pre-experiment, and the enzyme mutant with the highest activity is obtained.
[0027] Catalase mutant
[0028] By amplifying the wild type catalase gene and changing the base pairs at specific positions of the gene by rational design to realize the directed evolution of the enzyme, a catalase mutant with significantly improved enzyme activity is finally obtained.
[0029] Embodiment
[0030] Embodiment 1 Sequence of catalase mutant
[0031] On the basis of the amino acid sequence SEQ ID NO. 1 of wild-type catalase (WT), any one mutation or random combination of A132G, T149L, M158L, M349V is selected. The mutant constructed is preferably any one of A132G, T149L, M158L, M349V, A132G / T149L, A132G / M158L, T149L / M349V, M158L / M349V, A132G / M158L / M349V.
[0032] Example 2 Experimental condition preliminary screening
[0033] 1. Culture expression of template catalase
[0034] The wild-type gene of catalase is synthesized by a company and constructed on a pET22b vector, and the vector is transformed into an E. coli DH5a strain. The recombinant bacteria E. coli DH5a are inoculated in a culture medium in a 5 mL test tube and cultured at 37°C and 220 rpm for 12 h. After the culture is completed, the bacteria are centrifuged at 4000 rpm for 10 min and the cells are collected. A high-purity plasmid extraction kit is used to extract the plasmid from the E. coli DH5a, and the obtained plasmid is transferred into an expression host of E. coli BL21 (DE3) and inoculated in a culture medium in a 5 mL test tube and cultured at 37°C and 220 rpm for 12 h. A 1% inoculation amount is transferred into 100 ml of a TB culture medium containing resistance, and the OD 600 is about 0.6, and 0.5 mM of IPTG is added at a final concentration, and induction is performed at 18°C for about 14 h.
[0035] 2. Obtaining of catalase crude enzyme solution
[0036] The 100 ml of bacteria solution is centrifuged at 23°C and 4000 rpm for 10 min, and after the centrifugation is completed, the supernatant is poured off, resuspended with a buffer solution, and the OD 600 is measured in a UV spectrophotometer. According to the experimental requirements, it is diluted to different OD values in a 48-well plate, and the cells are broken by ultrasonic in an ice bath (work for 3 s, interval for 6 s, and work time for 5 min). After the breaking is completed, the solution is centrifuged at 4000 rpm / min for 10 min, and the supernatant is collected as the crude enzyme solution.
[0037] 3. Reaction condition screening
[0038] The crude enzyme solution obtained from the broken cells with different ODs was used as a catalyst for the experimental reaction. The reaction system was: 70 μL of the crude enzyme solution with different gradients of OD (OD = 3, OD = 2, OD = 1, OD = 0.3, OD = 0.1), 800 μL of 200 mM potassium phosphate buffer (pH = 7.5), and 130 μL of 0.1 M H2O2 solution. The absorbance at 240 nm was measured in a 1 mL quartz cuvette, and the reading was taken every 1 min for a total of 3 min. The change in absorbance was obtained, and the OD of the reaction was determined to be between 0.1 and 0.3. The results are shown in Table 3. Figure 2 .
[0039] Example 3 Construction of expression vector of catalase mutant
[0040] 1. Obtain the target mutant gene by whole plasmid PCR
[0041] The target mutant gene was obtained by whole plasmid PCR. The template gene fragment for whole plasmid PCR was obtained by using the high-purity plasmid extraction kit. The required primers were designed for M349V, and other mutants were designed according to this principle and subjected to single-point iteration.
[0042] M349V upstream primer: CCCGGATAAAGTGCTGCAAGGCC
[0043] M349V downstream primer: GGCGGCCTTGCAGCACTTTATCCGGG
[0044] The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2 (32 cycles).
[0045] Table 1 PCR reaction system
[0046] Components Volume 10x Buffer for KOD-Plus- 2.5 μL 2 mM dNTP 2.5 μL 25 mM MgSO4 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75 μL 10 pmol / μL Reverse Primer 0.75 μL DNA template < 100 ng KOD-Plus- 1 μL ddH2O up to 25 μL
[0047] Table 2 PCR reaction conditions
[0048] Reaction temperature Time 95 ℃ 3 min 95 ℃ 20 s 57℃ 10 s 70 ℃ 4 min 12 ℃ 10 min
[0049] After the PCR amplification, the amplification product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplification product was a single band with a size of about 6000 bp. The amplification product was purified and recovered by using a DNA recovery and purification kit.
[0050] Construction of recombinant E. coli BL21 (DE3) / pET22b-catalase mutant
[0051] The purified gene fragment was digested with Dpn I to remove the template and then recombined with a recombination enzyme. The recombination product was transformed into E. coli DH5a competent cells, spread on the surface of LB solid medium containing 100 μg / mL ampicillin, incubated at 37°C for 12 h, and then inoculated into LB liquid culture. The positive transformants were identified by PCR and the correctness of the mutation site was verified by sequencing. After verification, a part was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80°C for future use. The other part was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20°C refrigerator.
[0052] The successfully sequenced recombinant expression plasmid pET22b was transformed into E. coli BL21 (DE3) as an expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-catalase.
[0053] Example 4: Culture of catalase mutants and preparation of pure enzyme solution
[0054] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-catalase was spread on a plate containing 100 μg / mL ampicillin, and a single colony was inoculated into 5 mL of LB medium containing the antibiotic at a 1% inoculum. The culture was incubated at 37°C and 200 rpm / min overnight. A 1% inoculum was transferred to 500 mL of LB medium containing the antibiotic, and the culture was incubated at 37°C and 200 rpm / min to an OD 600 When the OD reached about 0.6, IPTG was added at a final concentration of 0.5 mM, and the culture was induced at 18°C for about 14 h.
[0055] After centrifugation, the bacterial cells were resuspended in buffer and sonicated in an ice bath (2 s on, 5 s off, 30 min). The cells were centrifuged at 12,000 rpm / min for 20 min at 4°C. The supernatant was collected and filtered through a 0.22 μm water filter. The filtrate was used as a sample and further purified by nickel column chromatography to obtain a pure enzyme solution. According to the amino acid sequence of catalase, the molar absorption coefficient ε of the protein was calculated. The absorbance of the purified protein was measured by A280 method, and the concentration of the protein was calculated.
[0056] Example 5: Catalysis of hydrogen peroxide decomposition by catalase and its mutants
[0057] The pure enzyme solution obtained in Example 4 was used as a catalyst.
[0058] The reaction system was OD=0.3 of crude enzyme solution, 0.1 M H2O2 solution, and the reaction buffer solution was 200 mM potassium phosphate buffer (pH=7.5). The change of absorbance at 240 nm within 1 min was measured in a 1 mL quartz cuvette. The results are shown in Table 3.
[0059] Table 3 Change of absorbance at 240 nm of catalase and its mutants in catalyzing hydrogen peroxide decomposition
[0060] Catalyst Conditions Protein / cell conc. Abs (λ = 240 nm) WT Whole cells OD = 0.3 0.04 A132G Whole cells OD = 0.3 0.05 M349V Whole cells OD = 0.3 0.06 T149L / A132G Whole / cells OD = 0.3 0.06 M158L / A132G Whole / cells OD = 0.3 0.06 T149L / M349V Whole / cells OD = 0.3 0.06 M158L / M349V Whole / cells OD = 0.3 0.08 A132G / M158L / M349V Whole / cells OD = 0.3 0.11
[0061] Example 6 pH condition optimization of catalase and its mutants in catalyzing hydrogen peroxide decomposition
[0062] The pure enzyme solution obtained in Example 4 was used as the catalyst.
[0063] The reaction system was OD=0.3 of crude enzyme solution, 0.1 M H2O2 solution, and the reaction buffer was buffer with different pH, which were 50 mM NaH2PO4-citric acid buffer with pH=5, 50 mM NaH2PO4-citric acid buffer with pH=6, 50 mM Na2HPO4 buffer with pH=6.5, 50 mM Na2HPO4 buffer with pH=7, 50 mM KH2PO4-K2HPO4 buffer with pH=7.5, 50 mM KH2PO4-K2HPO4 buffer with pH=8, and 50 mM Tris-HCl buffer with pH=9. The change of absorbance at 240 nm within 1 min was recorded in a 1 mL quartz cuvette. The results showed that the optimal pH of catalase was 7.5, and the results are shown in Figure 3 .
[0064] Example 7 Determination of kinetic constants of catalase and its mutants
[0065] The kinetic parameters of catalase and its mutants were determined with different concentrations of hydrogen peroxide as the substrate. The experiment was carried out at pH=7.5 and enzyme concentration of 0.01 μM, and the reaction time was 1 min. The first-order reaction rate was the ordinate, and the substrate concentration was the abscissa. The values of Vmax and Km were obtained by non-linear fitting, and then Kcat was calculated. The results are shown in Table 4.
[0066] Table 4 Kinetic parameters of wild-type catalase and its mutants
[0067] Type Km (mM) Kcat(min -1 )]> Kcat / Km (mM -1 • min -1 ))]]> WT 423.16 921000 2176.48 A132G / M158L / M349V 110.33 520000 4713.13
Claims
1. A catalase mutant, characterized in that, The mutation is A132G+M158L+M349V, and the mutation site is counted from the 2nd position of the sequence.
2. A gene for catalase, characterized in that, The gene encodes the catalase mutant of claim 1.
3. The gene of claim 2, wherein, The nucleotide sequence is shown in SEQ ID NO.
2.
4. An expression vector, characterized by, The expression vector comprises the nucleotide sequence of claim 3.
5. The expression vector of claim 4, wherein, The expression vector is a pET system expression vector.
6. A recombinant bacterium, characterized in that, The recombinant bacteria are Escherichia coli comprising the expression vector of claim 4.
7. A method for constructing a recombinant bacterium, characterized by, The method comprises the following steps: (1) Constructing an expression vector: connecting the gene of claim 2 with the enzyme-digested plasmid to obtain a recombinant expression vector; (2) Constructing recombinant bacteria: transferring the constructed recombinant expression vector into an Escherichia coli competent cell, culturing and screening to obtain recombinant bacteria.
8. A catalyst characterized by, The catalase mutant of claim 1.
9. Use of the catalase mutant of claim 1 in catalyzing the decomposition of hydrogen peroxide.
10. Use according to claim 9, characterised in that, The temperature for catalyzing the decomposition of hydrogen peroxide is 25℃, and the pH is 5-9.
Citation Information
Patent Citations
Catalase mutant with improved enzyme activity and heat stability
CN103451163A
Catalase mutant and application thereof
CN114752576A