Taq DNA polymerase mutants and their applications

Abstract

The present invention discloses a Taq DNA polymerase mutant, which has mutations at one or more of the 116th, 439th and 468th amino acids relative to the wild-type Taq DNA polymerase, wherein the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO: 1. Compared with the wild-type Taq DNA polymerase, the enzyme activity of the Taq DNA polymerase mutant of the present invention is higher than that of the wild-type, and the tolerance of the single-site mutant and the multi-site mutant to corn leaf supernatant, mouse serum and / or heparin sodium is improved, and can be used for direct and rapid amplification of samples.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a Taq DNA polymerase mutant and an application thereof. Background Art

[0002] Taq DNA polymerase, as the first thermostable DNA polymerase discovered, was successfully extracted by Saiki et al. from a bacterium living in hot springs, Thermus aquaticus. Due to its excellent thermostability, this enzyme can withstand the high temperature during the polymerase chain reaction (PCR) process, and there is no need to re-add new enzyme in each round of PCR cycle, which makes PCR technology get rid of the dilemma of needing to replenish enzymes in each cycle, greatly improving the efficiency and convenience of PCR reactions, promoting its rapid development and entering a new stage. Taq DNA polymerase has therefore become an indispensable key component in PCR technology and is widely used in DNA sequence determination and in vitro amplification of specific fragments. PCR-based detection technology has been widely used in many fields, such as disease diagnosis, species identification, environmental monitoring, etc. PCR technology has shown its unique advantages, especially in the diagnosis of genetic diseases, microbial and viral infections, blood type and blood bank detection, as well as environmental testing and human DNA identification in forensics.

[0003] However, natural Taq DNA polymerase has low enzymatic activity, weak stability, poor tolerance, and is easily restricted by inhibitors in the amplification template. For example, hemoglobin in blood samples may cause inactivation or inhibition of Taq DNA polymerase; sodium heparin in animal samples will bind to the active site of Taq DNA polymerase, thereby inhibiting PCR; and the abundant sugars and phenolic compounds in plant samples will also inhibit the activity of Taq DNA polymerase. Therefore, in order to solve this problem, it is usually necessary to purify DNA from the sample to be tested through various procedures and DNA extraction kits before PCR detection to remove possible inhibitors. Although this step helps to improve the efficiency and accuracy of PCR, it makes the entire nucleic acid analysis process more steps, more costly, requires a large amount of samples, and is prone to cross-contamination. More importantly, these purification steps may not completely remove all inhibitors, or cause partial loss of target DNA during the extraction process.

[0004] Although PCR technology is widely used and effective in the detection of blood, plant and soil samples, how to optimize the sample pre-treatment procedures, reduce time and cost expenditures, and ensure detection accuracy is still a key issue that needs to be solved urgently. Therefore, there is an urgent need to develop a Taq DNA polymerase mutant with high enzyme activity and resistance to inhibitor interference, and to establish a new direct rapid PCR method with this enzyme to meet the needs of efficient molecular identification. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention discloses a Taq DNA polymerase mutant and its application in nucleotide polymerization, nucleic acid amplification or nucleic acid sequencing.

[0006] One aspect of the present disclosure provides a Taq DNA polymerase mutant, which has a mutation at one or more of amino acids 116, 439 and 468 relative to a wild-type Taq DNA polymerase, wherein the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO: 1.

[0007] In some embodiments, the Taq DNA polymerase mutant comprises one or more mutations of Y116F, A439R and A468R.

[0008] In some embodiments, the Taq DNA polymerase mutant comprises the mutation of Y116F and A439R. In some embodiments, the Taq DNA polymerase mutant comprises the mutation of Y116F and A468R. In some embodiments, the Taq DNA polymerase mutant comprises the mutation of A439R and A468R. In some embodiments, the Taq DNA polymerase mutant comprises the mutation of Y116F, A439R and A468R.

[0009] In the present disclosure, the mutant amino acid site "Y116F" indicates that the tyrosine (Y) at the 116th amino acid of the Taq DNA polymerase whose amino acid sequence is shown in SEQ ID NO:1 is mutated to phenylalanine (F); the mutant amino acid site "A439R" indicates that the alanine (A) at the 439th amino acid of the Taq DNA polymerase whose amino acid sequence is shown in SEQ ID NO:1 is mutated to arginine (R); the mutant amino acid site "A468R" indicates that the alanine (A) at the 468th amino acid of the Taq DNA polymerase whose amino acid sequence is shown in SEQ ID NO:1 is mutated to arginine (R).

[0010] In some embodiments, the Taq DNA polymerase mutant has an amino acid sequence shown in one or more of SEQ ID NOs: 3-9, or an amino acid sequence in which one or more amino acids are added, deleted, replaced or modified.

[0011] Another aspect of the present disclosure provides a nucleic acid molecule encoding the Taq DNA polymerase mutant of the present disclosure.

[0012] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in one or more of SEQ ID NOs: 10-16, or a sequence complementary to the nucleotide sequence as shown in one or more of SEQ ID NOs: 10-16, or a sequence having 65%, 70%, 75%, 80%, 85%, 90%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5, 99.8% or more homology to the nucleotide sequence as shown in one or more of SEQ ID NOs: 10-16.

[0013] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F single-site mutant Taq DNA polymerase, which has an amino acid sequence shown in SEQ ID NO:3, or is encoded by a nucleotide sequence shown in SEQ ID NO:10.

[0014] In some specific embodiments, the Taq DNA polymerase mutant is an A439R single-site mutant Taq DNA polymerase having an amino acid sequence shown in SEQ ID NO:4, or encoded by a nucleotide sequence shown in SEQ ID NO:11.

[0015] In some specific embodiments, the Taq DNA polymerase mutant is an A468R single-site mutant Taq DNA polymerase, which has an amino acid sequence shown in SEQ ID NO:5, or is encoded by a nucleotide sequence shown in SEQ ID NO:12.

[0016] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F-A439R double-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:6, or is encoded by the nucleotide sequence shown in SEQ ID NO:13.

[0017] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F-A468R double-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:7, or is encoded by the nucleotide sequence shown in SEQ ID NO:14.

[0018] In some specific embodiments, the Taq DNA polymerase mutant is a Y468R-A439R double-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:8, or is encoded by the nucleotide sequence shown in SEQ ID NO:15.

[0019] In some specific embodiments, the Taq DNA polymerase mutant is a Y116F-A439R-A468R triple-site mutant Taq DNA polymerase, which has the amino acid sequence shown in SEQ ID NO:9, or is encoded by the nucleotide sequence shown in SEQ ID NO:16.

[0020] Another aspect of the present disclosure provides a recombinant expression vector containing the nucleic acid molecule of the present disclosure.

[0021] In some embodiments, the recombinant expression vector can be selected from a viral or bacterial vector, such as, but not limited to, an African swine fever virus vector, a lentiviral vector, an avian pox virus vector, a canine measles virus vector, a herpes virus vector, a varicella virus vector, an adenovirus vector, an adeno-associated virus vector, and the like.

[0022] Another aspect of the present disclosure provides a host cell, wherein the host cell contains the Taq DNA polymerase mutant, the nucleic acid molecule, or the recombinant expression vector described in the present disclosure.

[0023] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell.

[0024] In some embodiments, the prokaryotic cell can be selected from Escherichia coli or Bacillus subtilis, such as Escherichia coli BL21, T7E, C41, Arctic, etc. In some specific embodiments, the host cell is Escherichia coli BL21 (DE3) strain.

[0025] In some embodiments, the eukaryotic cell can be selected from yeast cells, insect cells, plant cells, animal cells, etc., such as yeast cells, CHO cells, 293 cells, Vero cells or NSO cells, etc.

[0026] Another aspect of the present disclosure provides a composition comprising (i) the Taq DNA polymerase mutant described in the present disclosure, and (ii) one or more reagents selected from the following: a buffer, a primer, a probe, a dye, a detection agent, a target nucleic acid and a cell lysis agent.

[0027] In some embodiments, the composition is provided in the form of a kit.

[0028] Another aspect of the present disclosure provides a method for preparing the Taq DNA polymerase mutant of the present disclosure, wherein the method comprises the following steps:

[0029] Cultivating the host cells described in the present disclosure; and

[0030] Optionally, the Taq DNA polymerase mutant is isolated from the host cell or from the growth medium or supernatant.

[0031] Another aspect of the present disclosure provides the use of the Taq DNA polymerase mutant, the nucleic acid molecule, the recombinant expression vector, the host cell or the composition described in the present disclosure in nucleotide polymerization, nucleic acid amplification or nucleic acid sequencing.

[0032] Yet another aspect of the present disclosure provides a method for producing a DNA molecule, comprising the step of using the Taq DNA polymerase mutant described in the present disclosure.

[0033] In some embodiments, the Taq DNA polymerase mutant is used to incubate with template DNA and primers.

[0034] In some embodiments, the method is performed by polymerase chain reaction or isothermal nucleic acid amplification reaction.

[0035] Compared with the wild-type Taq DNA polymerase, the Taq DNA polymerase mutant disclosed in the present invention has higher enzyme activity than the wild-type, and the single-site mutant and multi-site mutant have improved tolerance to corn leaf supernatant, mouse serum and / or heparin sodium, and can be used for direct and rapid amplification of samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Shown are the results of PCR amplification of wild-type and various mutant Taq DNA polymerases according to some embodiments of the present disclosure.

[0037] Figure 2 Shown are the results of PCR amplification of wild-type Taq DNA polymerase in the presence of three inhibitors according to some embodiments of the present disclosure.

[0038] Figure 3 The PCR amplification results of wild-type and mutant Taq DNA polymerases in the presence of three inhibitors according to some embodiments of the present disclosure are shown.

[0039] Figure 4 The results of direct rapid fluorescent PCR amplification using wild-type and mutant Taq DNA polymerases according to some embodiments of the present disclosure are shown. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0041] definition

[0042] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0043] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0044] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0045] The term "substitution" as used herein for amino acids refers to the replacement of at least one amino acid residue in an amino acid sequence by another different "replacement" amino acid residue. The term "insertion" as used herein for amino acids refers to the incorporation of at least one additional amino acid into an amino acid sequence. Although inserts typically consist of the insertion of 1 or 2 amino acid residues, larger "peptide inserts" can also be prepared, for example, inserting about 3 to 5 or even up to about 10, 15 or 20 amino acid residues. As disclosed above, the inserted residues can be naturally occurring or non-naturally occurring. The term "deletion" as used herein for amino acids refers to the removal of at least one amino acid residue from an amino acid sequence.

[0046] Mutants disclosed herein or fragments thereof may comprise conservative amino acid substitutions at one or more amino acid residues, such as at essential or non-essential amino acid residues. "Conservative amino acid substitutions" are amino acid residues replaced by amino acid residues with similar side chains. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, in this article, the essential or non-essential amino acid residues in the mutant are preferably replaced with another amino acid residue from the same side chain family.

[0047] "Percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by the sequences within the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Since a gap is not a nucleotide or amino acid, gaps present in the target sequence are not counted. Likewise, since target sequence nucleotides or amino acids are counted and nucleotides or amino acids from the reference sequence are not counted, gaps present in the reference sequence are not counted.

[0048] The sequence identity percentage can be calculated by the following process: determine the number of positions where the same amino acid residue or nucleic acid base occurs in both sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the sequence identity percentage. The determination of the sequence identity percentage between the comparison of the sequence and the two sequences can be completed using software that is easy to use and download online. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the U.S. Government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used for comparing nucleic acid sequences, and BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0049] Examples are provided below to help understand the present disclosure. However, it should be understood that these examples are only used to illustrate the present disclosure and do not constitute any limitation. The actual protection scope of the present disclosure is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present disclosure.

[0050] The present invention obtains a mutant Taq DNA polymerase by a method comprising the following steps:

[0051] (1) construct wild-type and mutant expression vectors of Taq DNA polymerase; (2) prepare wild-type and mutant Taq DNA polymerase; (3) perform enzymatic performance test on wild-type and mutant Taq DNA polymerase; (4) perform inhibitor tolerance test on wild-type and mutant Taq DNA polymerase. The test results show that compared with the wild-type Taq DNA polymerase, the mutant Taq DNA polymerase of the present invention has higher enzyme activity than the wild-type, and the single-site mutant and multi-site mutant have improved tolerance to corn leaf supernatant, mouse serum, and heparin sodium, and can be used for direct and rapid amplification of samples.

[0052] Example

[0053] Example 1 Construction of Taq DNA polymerase expression vector

[0054] The amino acid sequence of the wild-type Taq DNA polymerase of Thermus aquaticus is shown in SEQ ID NO: 1. The gene sequence (SEQ ID NO: 2) was synthesized by Sangon Biotechnology Co., Ltd. and inserted into the pET30a vector by a T5 exonuclease-mediated vector construction method. The recombinant plasmid was named pET30a-Taq.

[0055] The single-site mutant Taq DNA polymerase is a mutant obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 to any one of the amino acid single-site mutations Y116F, A439R, and A468R, the amino acid sequences are shown in SEQ ID NO: 3-5, respectively, and the gene sequences are shown in 10-12. Based on the single-site mutation, multi-site mutants Y116F-A439R, Y116F-A468R, Y468R-A439R, and Y116F-A439R-A468R were also obtained, the amino acid sequences are shown in SEQ ID NO: 6-9, respectively, and the gene sequences are shown in 13-16. The single-site mutant "Y116F" means that the tyrosine (Y) at the 116th amino acid of the Taq DNA polymerase with the amino acid sequence shown in SEQ ID NO: 1 is mutated to phenylalanine (F); the multi-site mutant Y116F-A439R means that the tyrosine (Y) at the 116th amino acid of the Taq DNA polymerase with the amino acid sequence shown in SEQ ID NO: 1 is mutated to phenylalanine (F), and the alanine (A) at the 439th amino acid is mutated to arginine (R). The expressions of the remaining single-site mutations or multi-site mutations are similar.

[0056] Example 2 Preparation of wild-type Taq DNA polymerase and its mutants

[0057] The wild-type and mutant recombinant plasmids of Taq DNA polymerase obtained in Example 1 were transformed into Escherichia coli BL21 (DE3) plyss competent cells, and the transformants were selected and inoculated into LB liquid culture medium containing 50 mg / mL kanamycin, and cultured at 37°C, 220 rpm. When the OD600 of the culture solution reached 0.6-0.8, IPTG with a final concentration of 1 mM was added, and the culture was induced at 18°C, 220 rpm for 16-18 hours. Subsequently, the cells were collected by centrifugation at 6000 rpm for 10 minutes, and the culture solution was washed away with buffer A (40 mM Tris-HCl pH8.0, 200 mM KCl, 0.1 mM EDTA), and the cells were resuspended in buffer A. The cells were disrupted by ultrasonic cell disruptor, then centrifuged at 18000 rpm for 10 min, the supernatant was collected, incubated in a 75°C water bath for 30 min, mixed every 5 min, centrifuged at 10000 rpm for 10 min, the supernatant was collected, the same volume of glycerol was added, and stored at -20°C. The wild type Taq DNA polymerase and its mutants were prepared.

[0058] Example 3 Determination of the enzymatic properties of Taq DNA polymerase and its mutants

[0059] Using pET30a-Taq plasmid as template, PCR was performed using the wild-type and mutant Taq DNA polymerases prepared in Example 2 to determine the enzyme activities of the wild-type and mutant Taq DNA polymerases. The reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0060] Table 1 Taq enzyme activity detection reaction system

[0061]

[0062]

[0063] Table 2 Taq enzyme activity detection reaction conditions

[0064]

[0065] The reaction buffer composition is: 200mM Tris-HCl, 100mM (NH4)2SO4, 100mM KCl, 20mM MgSO4, 10mM BSA, 0.1% Triton X-100 (pH 8.8, 25°C)

[0066] Primer-F: atgcgtggtatgctgccgctg (SEQ ID NO: 17)

[0067] Primer-R: ggtctttcgccagcagaccac (SEQ ID NO: 18)

[0068] The PCR products were detected by agarose gel electrophoresis. Figure 1 The results show that compared with the wild-type TaqDNA polymerase, the yield of single-site mutants and multi-site mutants is greatly improved, indicating that the enzyme activity of the mutants is higher than that of the wild type and can achieve rapid PCR amplification.

[0069] Example 4 Inhibitor tolerance test of Taq DNA polymerase and its mutants

[0070] Using pET30a-Taq plasmid as a template, wild-type Taq DNA polymerase was used for PCR. Different concentrations of corn leaf supernatant, mouse serum, and heparin sodium were added to the PCR system as inhibitors for PCR. The reaction system is shown in Table 3. PCR amplification was performed under the reaction conditions in Table 2, and the reaction products were detected by agarose gel electrophoresis.

[0071] The preparation method of corn leaf supernatant is as follows: 1 cm 2 Place fresh corn leaves in a 1.5 mL centrifuge tube, add 500 μL of 1 M KOH solution, use a grinding rod to grind the leaves into a green solution, and take the supernatant for later use.

[0072] Mouse serum: C57BL / 6 mice were purchased from Hubei Provincial Center for Disease Control and Prevention. Blood was collected, left to stand at room temperature for 1 h, centrifuged at 4°C for 10 min, the supernatant removed, quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator before use.

[0073] Heparin sodium: purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number S23144, the stock solution is 150U / mg, diluted with water to the use concentration.

[0074] Table 3 Taq enzyme inhibitor tolerance reaction system

[0075] pET30a-Taq (1 ng / μL) 1μL Primer-F (10 μM) 0.5μL Primer-R (10 μM) 0.5μL Buffer 1μL Taq enzyme (200ng) 1μL Corn leaf supernatant, mouse serum, heparin sodium 2 / 3 / 4μL <![CDATA[ddH2O]]> Make up to 20 μL

[0076] According to the agarose gel electrophoresis results ( Figure 2 ) It can be seen that the presence of 20% corn leaf supernatant in the PCR amplification system will significantly inhibit the activity of the wild-type Taq enzyme, and 15% mouse serum and 12.5 μg / mL heparin sodium will completely inhibit the activity of the wild-type Taq enzyme.

[0077] Using pET30a-Taq plasmid as a template, PCR was performed using wild-type and several mutant Taq DNA polymerases. 35% corn leaf supernatant, 20% mouse serum, and 10 μg / mL heparin sodium were added to the PCR system as inhibitors for PCR. The reaction system is shown in Table 3. PCR amplification was performed under the reaction conditions in Table 2, and the reaction products were detected by agarose gel electrophoresis.

[0078] According to the agarose gel electrophoresis results ( Figure 3 ) It can be seen that after adding 35% corn leaf supernatant, 10μg / mL heparin sodium, and 20% mouse serum, the wild-type Taq DNA polymerase is completely unable to amplify, the multi-site mutant Taq DNA polymerase can effectively amplify, and the single-site mutant enzyme amplification is interfered to a certain extent but can still perform PCR amplification. The results show that the tolerance of single-site mutation and multi-site mutation Taq DNA polymerase to corn leaf supernatant, mouse serum, and heparin sodium is improved.

[0079] Example 5 Rapid identification of transgenic plants using Taq DNA polymerase mutants

[0080] In this example, corn leaves were used as a model analyte to study the tolerance and amplification efficiency of mutant Taq DNA polymerase to crude plant leaf extracts in real-time fluorescence PCR amplification.

[0081] Sample pretreatment: Select 1cm 2 Fresh corn leaves were placed in a 1.5 mL centrifuge tube, 500 μL of 1 M KOH solution was added, and the leaves were crushed to a green solution using a grinding rod, and the supernatant was taken for later use. In this embodiment, the transgenic corn MON87427 transformant-specific method and the corn internal standard gene method were selected for double PCR amplification. The wild-type enzyme was selected as a control. The PCR system configuration (20 μL) is shown in Table 4, and the reaction conditions are shown in Table 5.

[0082] Table 4 Detection system for genetically modified crops

[0083] Leaf supernatant 4μL F1 / R1 / P1 2 / 2 / 1μL F2 / R2 / P2 1 / 1 / 0.5μL Buffer 2.5μL Taq enzyme (200ng) 1μL <![CDATA[ddH2O]]> 10μL

[0084] Table 5 Rapid PCR reaction conditions

[0085]

[0086] Among them, in the specific method of the transgenic corn MON87427 transformant:

[0087] Forward primer F1: ACGGAAACGGTCGGGTCAAATG (SEQ ID NO: 19);

[0088] Reverse primer R1: CCATGTAGATTTCCCGGTTTTCTC (SEQ ID NO: 20);

[0089] Probe P1: HEX-TCGGGACAATATGGAGAAAAAGAAAGAG (SEQ ID NO: 21);

[0090] In the method of maize internal standard gene zSSIIb:

[0091] Forward primer F2: CGGTGGATGCTAAGGCTGATG (SEQ ID NO: 22);

[0092] Reverse primer R2: AAAGGGCCAGGTTCATTATCCTC (SEQ ID NO: 23);

[0093] Probe P2: ROX-TAAGGAGCACTCGCCGCCGCATCTG (SEQ ID NO: 24).

[0094] According to the results of real-time fluorescence quantitative PCR ( Figure 4 ) It is known that the Ct of the Y116F-A439R mutant used for amplification of MON87427 transformants is 28.02, which can effectively perform double real-time fluorescent PCR amplification and complete 40 cycles within 30 minutes. The amplification of the wild-type enzyme is inhibited by the plant supernatant template. It is proved that the Taq DNA polymerase in the present invention has superiority in amplifying samples from plant sources and can be used for direct and rapid nucleic acid analysis of plant samples.

[0095] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A Taq DNA polymerase mutant, characterized in that: The amino acid sequence of the Taq DNA polymerase mutant is shown in SEQ ID NO: 4 or 6.

2. A nucleic acid molecule encoding the Taq DNA polymerase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO: 11 or 13.

4. A recombinant expression vector containing the nucleic acid molecule according to claim 2 or 3.

5. A host cell, characterized in that The host cell contains the Taq DNA polymerase mutant according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the recombinant expression vector according to claim 4.

6. A composition comprising (i) the Taq DNA polymerase mutant of claim 1, and (ii) one or more reagents selected from the group consisting of a buffer, a primer, a probe, a dye, a target nucleic acid, and a cell lysing agent.

7. A method for preparing the Taq DNA polymerase mutant according to claim 1, wherein: The method comprises the following steps: Cultivating the host cell according to claim 5; and The Taq DNA polymerase mutant is isolated from the host cell or from the culture medium in which the host cell according to claim 5 is cultured.

8. Use of the Taq DNA polymerase mutant according to claim 1 in nucleotide polymerization, nucleic acid amplification or nucleic acid sequencing.

9. A method for producing a DNA molecule, comprising the step of using the Taq DNA polymerase mutant of claim 1.

10. The method according to claim 9, characterized in that The Taq DNA polymerase mutant was used and incubated with the template DNA and primers.

11. The method according to claim 9, characterized in that The method is implemented by polymerase chain reaction or isothermal nucleic acid amplification reaction.

Images