RNAmotif Sequences and Their Application in Improving Prime Editing Efficiency
By introducing the HOXB13-5’UTR RNAmotif sequence into the pegRNA vector, the stem loop structure is formed to improve the stability of pegRNA, and the problem of low pilot editing efficiency is solved, and efficient editing in a variety of cells and sites is achieved, with the efficiency being improved to 3.58 times.
Patent Information
- Application Number
- CN202410737289.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-07
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-06-07
AI Technical Summary
Existing pilot editing tools are inefficient and need further optimization to improve editing efficiency.
The HOXB13-5’UTR RNAmotif sequence was used to add to the pegRNA vector at the 3’ end of the pegRNA to form a stem loop structure to increase the stability of the pegRNA, and its reverse complementary sequence was added to the 5’ end when constructing the pegRNA vector to form an RNAmotif-pegRNA expression vector.
Among the various editing types in different cells and different sites, the efficiency of pilot editing is significantly improved, up to 3.58 times, and the RNAmotif sequence is short, making it easier to synthesis and ligation.
Smart Images

Figure CN118497203B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene editing tool optimization, and more specifically to RNAmotif sequences and their application in improving prime editing efficiency. Background Art
[0002] Prime editing is a new editing tool developed by David Liu in 2019, including a PE2 protein (Cas9 nickase + reverse transcriptase) and a pegRNA (for targeting and providing a reverse transcription template); it can achieve precise and flexible gene editing, but its efficiency is low and needs to be continuously improved. Currently, other techniques to solve the problem of low efficiency include co-expressing the dominant-negative mismatch repair protein MLH1dn, optimizing the codons of the PE2 protein, adding a nuclear localization signal, adding dsgRNA and CMP, adding an 85AA polypeptide, etc.
[0003] Prime editing tools are also divided into several editing systems, and the components vary. For example, PE3 adds an sgRNA on the basis of PE, which can improve the editing efficiency.
[0004] Currently, in the literature on improving prime editing efficiency through RNAmotif, the efficiency that EvoPreQ1 RNAmoti can improve is relatively low, only 1.5 - 2.5 times. And the xrRNAmotif sequence is relatively long, 70 - 90 nt, which is inconvenient to ligate when constructing vectors.
[0005] Therefore, providing RNAmotif sequences and their application in improving prime editing efficiency is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0006] In view of this, the present invention provides RNAmotif sequences and their application in improving prime editing efficiency. The Hoxb13 - 5’UTR RNAmotif used in the present invention is 38 nt long, which is convenient to ligate, and can increase the efficiency by up to 3.58 times.
[0007] Principle: In 2019, David Liu developed the prime editing (PE) system that can achieve all 12 types of base editing and their combinations (Anzalone and Randolph et al., 2019). The PE system consists of the Cas9n (a mutated Cas9 at the H840A site) nickase, the murine leukemia virus engineered reverse transcriptase (M-MLV-RT), and the prime editing guide RNA (pegRNA). The pegRNA contains a spacer sequence, a scaffold, an RTT sequence, and a PBS sequence. The spacer sequence targets a specific DNA sequence, and the RTT sequence serves as the reverse transcription template for encoding new genetic information. Under the guidance of the pegRNA, the Cas9n protein binds to the target site and cleaves the target DNA. The cleaved target DNA strand binds complementarily to the PBS sequence on the pegRNA, and the RT enzyme causes the pegRNA to undergo a reverse transcription reaction. After the reverse transcription reaction is completed, a dynamic balance of 3' overhang and 5' overhang appears at the DNA nick (the 3' overhang contains the target mutation). The 5' overhang is more easily excised by the intracellular repair mechanism, and the dynamic balance of the 3' overhang and 5' overhang will tilt towards the 3' overhang containing the target mutation. Subsequently, through DNA strand ligation and intracellular mismatch repair, the replacement of the target sequence is achieved. The editing efficiency of this system (PE1) on mouse and human cells is approximately 0.7 - 5.5%, and the off-target effect is approximately 0.2%.
[0008] Prime editing can perform all 12 types of single-base mutations, as well as insertions, deletions, and replacements of several bases, greatly expanding the scope of application of precise gene editing. For different editing types, it can be achieved by simply designing the corresponding pegRNA, without the need to provide an additional donor vector, which has high flexibility. Prime editing uses the Cas9n nickase to avoid generating DSBs, and requires three base complementary pairings to target the target DNA, resulting in a lower off-target effect and higher safety. Correspondingly, the editing efficiency of the PE system is also relatively low and needs to be continuously optimized to achieve a higher editing efficiency.
[0009] On the basis of PE1, Liu Ruqian mutated 5 amino acids of RT (D200N, L603W, T330P, T306K, W313F), increasing the editing efficiency by 1.6 - 5.1 times, which is the PE2 system. Subsequently, he added an sgRNA that recognizes the non-edited strand to the PE2 system, enabling Cas9n to simultaneously cleave the non-edited strand and allowing the non-edited strand to be repaired using the edited strand as a template, further increasing the efficiency by 1.5 - 4.2 times, which is the PE3. The editing efficiency of PE3 can reach 55%.
[0010] To achieve the above object, the present invention adopts the following technical solutions:
[0011] The HOXB13 gene encodes a transcription factor belonging to the homeobox gene family. Genes in this family are highly conserved in vertebrates and are crucial for vertebrate embryonic development. The 5’UTR of the HOXB13 gene has a stable secondary structure, which affects the recruitment process of ribosomes and the scanning process of the start codon, and promotes gene expression by regulating the translation initiation of its mRNA. A sequence in HOXB13-5’UTR was selected, and its RNA structure was predicted using the RNAfold website, showing that it can form a stem-loop structure. Adding this stem-loop structure to the 3’ end of the pegRNA can inhibit the degradation of the pegRNA, increase its stability, and prevent the complementary PBS sequence and spacer sequence in the pegRNA from forming a double strand.
[0012] The Hoxb13-5’UTR RNAmotif sequence is:
[0013] CTTAGCCACTGCACCAGGGAATTCCCTGCCAGCGATTT.
[0014] When constructing the pegRNA vector, this sequence is added to the 3’ end of the synthesized extension top strand, and the reverse complementary sequence of this sequence is added to the 5’ end of the extension bottom strand. The remaining steps are the same as those for constructing the pegRNA.
[0015] Furthermore, the application of the RNAmotif sequence in improving prime editing efficiency.
[0016] Furthermore, the pGL3-U6-RNAmotif-pegRNA expression vector contains the RNAmotif sequence described above.
[0017] Furthermore, the application of the pGL3-U6-RNAmotif-pegRNA expression vector in improving prime editing efficiency.
[0018] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses the RNAmotif sequence and its application in improving prime editing efficiency. The RNAmotif sequence of the present invention effectively improves the prime editing efficiency in different cells, different sites, and different editing types, with the highest increase of 3.58 times; and the sequence is short, which is convenient for synthesis and ligation. Description of the Drawings
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on the provided drawings.
[0020] Figure 1 The attached drawing is a schematic diagram for predicting the RNAmotif structure of the present invention;
[0021] Figure 2 The attached drawing is a schematic diagram of the RNAmotif-pegRNA structure of the present invention;
[0022] Figure 3 The attached drawing is for the editing efficiency of each system of the present invention for detecting FANCF 179(A to T), FANCF 261-266(TCCAGG del), FANCF 327-332(ATGCAG to GGATCC), FANCF 594-595(GGATCC ins), CCR5 2317-2318(GG to CC), CCR5 3272-3277(AAAGAA del), CCR5 4848-4852(AGGGT to GATCC) by deep targeted sequencing. Detailed implementation manners
[0023] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0024] The primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.
[0025] Example 1 Screening of targeting sites and gRNA design for human CCR5 and FANCF gene loci
[0026] (1) Selection and screening of targeting sites for human CCR5 and FANCF gene loci
[0027] The human CCR5 gene sequence (as shown in SEQ ID NO.1) and the FANCF gene sequence (as shown in SEQ ID NO.2) were obtained from NCBI. The CRISPOR (http: / / crispor.tefor.net / ), a sgRNA prediction website designed by the Zhang Feng laboratory, was used to predict the targeting sites of spCas9n used in the PE system. This website comprehensively evaluates the targeting sites in terms of specificity, efficiency, off-target effects, etc. The screening constraints include: ① The MIT and CFD specificity scores are greater than 50; ② The predicted efficiency is greater than 50; ③ There are no off-target sites with a mismatch number less than 3; ④ It does not end with the TT motif.
[0028] (2) Design of gRNA for targeting sites of human CCR5 and FANCF gene loci
[0029] The sequences of each targeting site obtained by screening were input into the Prime Design (https: / / primedesign.pinellolab.partners.org / ), a pegRNA design website designed by the Liu Ruqian laboratory, and the parameters were adjusted according to the experimental purpose. The main parameters of the PE3 system include: ① The PBS length is 11 - 15 nt; ② The RTT length is 10 - 30 nt; ③ The distance from the sgRNA to the pegRNA cleavage site is 40 - 60 bp. The pegRNA sequences for each targeting site are shown in Table 1; the sgRNA sequences for each targeting site are shown in Table 2.
[0030] Table 1 pegRNA sequences for each targeting site
[0031]
[0032] Note: FANCF 179(A to T) means that the A at the 179th position of the FANCF gene locus is mutated to T. FANCF 261 - 266(TCCAGG del) means deleting the bases from the 261st to the 266th of the FANCF gene locus, that is, deleting TCCAGG. FANCF 327 - 332(ATGCAG to GGATCC) means replacing the bases from the 327th to the 332nd of the FANCF gene locus, that is, ATGCAG with GGATCC. FANCF 594 - 595(GGATCC ins) means inserting GGATCC between the 594th and 595th bases of the FANCF gene locus. The same applies to each site of the CCR5 gene locus.
[0033] Table 2 sgRNA sequences for each targeting site
[0034]
[0035]
[0036] Example 2 Vector Construction
[0037] (1) Construction of pGL3-U6-pegRNA / pGL3-U6-RNAmotif-pegRNA Expression Vector
[0038] (1) Preparation of pGL3-U6-pegRNA / pGL3-U6-RNAmotif-pegRNA Vector Backbone
[0039] Using the pGL3-U6-sgRNA-EGFP vector as a template, and pegRNA-linearize-F and pegRNA-linearize-R as upstream and downstream primers, amplify with PrimeSTAR DNA Polymerase. The primer sequences are shown in Table 3. The amplified product is electrophoresed on a 1% agarose gel for nucleic acids, and the 4855bp linearized pGL3-U6-sgRNA-EGFP target band is recovered for subsequent digestion. The PCR reaction system and reaction program are shown in Tables 4 and 5.
[0040] Table 3 Primers for Amplifying pegRNA Backbone
[0041] Primer Sequence Serial number pegRNA-linearize-F AGCTAGGTCTCCTTTTTTTAAAGAATTCTCGACCTCGAGAC SEQ ID NO.24 pegRNA-linearize-R TCTCTCGGTCTCACGGTGTTTCGT SEQ ID NO.25
[0042] Table 4 Amplification System for pegRNA Backbone
[0043]
[0044] Table 5 Amplification Program for pegRNA Backbone
[0045]
[0046] The linearized pGL3-U6-sgRNA-EGFP is digested with endonuclease, and the digestion system is shown in Table 6. Place the digestion system in a 37°C constant temperature water bath for 2 h. The digested product is electrophoresed on a 1% agarose gel for nucleic acids, and the pegRNA vector backbone is recovered for subsequent ligation.
[0047] Table 6 Digestion System for Linear pegRNA
[0048]
[0049] (2) Preparation of Each Fragment of pegRNA / RNAmotif-pegRNA
[0050] The single-stranded DNA fragments that need to be synthesized for pegRNA / RNAmotif-pegRNA include spacer (top / bottom) (Table 1), scaffold (top / bottom), and 3' extension (top / bottom) (Table 1). The top sequence and the bottom sequence are reverse complementary.
[0051] Scaffold top:
[0052] CTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG CACCGAGTCG; SEQ ID NO.26.
[0053] Hoxb13-5’UTR RNAmotif sequence:
[0054] CTTAGCCACTGCACCAGGGAATTCCCTGCCAGCGATTT; SEQ ID NO.27.
[0055] The schematic diagram for RNAmotif structure prediction is shown in Figure 1 ; The schematic diagram for RNAmotif-pegRNA structure is shown in Figure 2 .
[0056] The HOXB13-5’UTR RNAmotif top strand can be added to the 3’ end of the 3’ extension top strand, and the HOXB13-5’UTR RNAmotif bottom strand can be added to the 5’ end of the 3’ extension bottom strand. Taking FANCF 179 (A to T) as an example, the sequences of pegRNA and RNAmotif-pegRNA are shown in Table 7.
[0057] Table 7
[0058]
[0059] The adapters and modifications to be added to each fragment are shown in Table 8. Each top and bottom fragment needs to be annealed, and the annealing system is shown in Table 9. The annealing program is 95°C for 3 min, then it decreases by 0.1°C every 1 s until 22°C. After the reaction ends, 75 μL of ddH2O is added to dilute it to 0.1 μM.
[0060] Table 8 Modifications of each part of pGL3-U6-pegRNA / pGL3-U6-RNAmotif-pegRNA
[0061]
[0062] Table 9 Annealing system of pGL3-U6-pegRNA / pGL3-U6-RNAmotif-pegRNA
[0063]
[0064] (3) Ligation and transformation of pegRNA / RNAmotif-pegRNA vector
[0065] The pegRNA vector backbone is sequentially ligated with the spacer double-strand, scaffold double-strand, and extension double-strand with sticky ends. The ligation system is shown in Table 10. The ligation system is placed in a 16°C constant-temperature metal bath for 2 h, and then transformed into DH5α competent cells and plated. After 12 h, single colonies are picked, and sanger sequencing is performed using the universal primer RV3 (CTAGCAAAATAGGCTGTCCC; SEQ ID NO.32). Colonies with correct sequencing results are expanded and endotoxin-free plasmids are extracted for subsequent transfection.
[0066] Table 10 Ligation system of pGL3-U6-pegRNA / pGL3-U6-RNAmotif-pegRNA
[0067]
[0068] 2) Construction of pGL3-U6-sgRNA expression vector
[0069] (1) Preparation of pGL3-U6-sgRNA vector backbone
[0070] The pGL3-U6-sgRNA-EGFP plasmid is digested with endonuclease. The digestion system is shown in Table 11. The digestion system is placed in a 37°C water bath for 2 h. The digestion product is subjected to nucleic acid electrophoresis on a 1% agarose gel, and the sgRNA vector backbone is recovered for subsequent ligation.
[0071] Table 11 sgRNA digestion system
[0072]
[0073] (2) Preparation of sgRNA fragment
[0074] Synthesize the DNA single-strand fragments spacer (top / bottom) (Table 2). Add an accg linker to the 5' end of the spacer top strand and an aaac linker to the 5' end of the spacer bottom strand. The top and bottom strands are annealed. The annealing system is shown in Table 12. The annealing program is 95°C for 3 min, then decrease by 0.1°C every 1 s to 22°C. After the reaction, add 75 μL of ddH2O to dilute to 0.1 μM.
[0075] Table 12 pGL3-U6-sgRNA Annealing System
[0076]
[0077] (3) Ligation and Transformation of sgRNA Vector
[0078] Ligate the sgRNA vector backbone with the double-stranded sgRNA with sticky ends. The ligation system is shown in Table 13. Place the ligation system in a 16°C constant-temperature metal bath for 2 h, then transform DH5α competent cells and plate them. After 12 h, pick monoclonal colonies and perform Sanger sequencing using the universal primer RV3. Expand the colonies with correct sequencing results and extract endotoxin-free plasmids for subsequent transfection.
[0079] Table 13 pGL3-U6-sgRNA Ligation System
[0080]
[0081] Method for Extracting Endotoxin-Free Plasmids (Omega Endotoxin-Free Plasmid Maxi Kit):
[0082] (1) Take 10 - 15 mL of bacterial liquid and centrifuge at 3,500 - 5,000 × g for 10 min at room temperature to collect bacteria. Try to completely discard the culture medium.
[0083] (2) Add 500 μL of SolutionⅠ / RNaseA mixture and vortex to completely resuspend the cells.
[0084] (3) Add 500 μL of SolutionⅡ to the resuspended mixture, gently invert and mix 7 - 10 times, then let it stand at room temperature for 4 min to completely lyse the bacteria.
[0085] (4) Add 250 μL of ice-bath N3 Buffer, gently invert the centrifuge tube several times until a white flocculent precipitate forms. Put the adsorption column on the collection tube, centrifuge the bacterial lysate at 17,000 × g for 10 min at room temperature, and transfer the supernatant to a new 1.5 mL centrifuge tube.
[0086] (5) Add 0.1 volume of ETR Solution to the supernatant, invert up and down 10 times to mix well, incubate on ice for 10 min. After adding ETR Solution, the solution becomes turbid and then clarifies after ice-bathing. Incubate in a 42°C water bath for 5 min, and the solution becomes turbid again.
[0087] (6) Centrifuge the solution at 12,000×g for 3 min at room temperature. Transfer the upper aqueous phase (containing DNA) to a new 1.5 mL centrifuge tube, add 0.5 volume of absolute ethanol, invert the tube up and down 6 - 7 times, and let it stand at room temperature for 1 - 2 min.
[0088] (7) Transfer the mixture in batches to the DNA adsorption column and centrifuge at 10,000×g for 10 min at room temperature. Discard the waste liquid.
[0089] (8) Repeat operation step 7 until all the solution has passed through the column.
[0090] (9) Reinstall the column into the collection tube, add 500 μL of HBC Buffer, centrifuge at maximum speed for 1 min, and discard the filtrate.
[0091] (10) Reinstall the column into the collection tube, add 700 μL of DNA Wash Buffer, centrifuge under the above conditions, and discard the filtrate.
[0092] (11) Repeat step 10 once.
[0093] (12) Discard the filtrate, reinstall the column into the collection tube, and centrifuge at 13,000×g for 2 min to completely remove the residual liquid in the adsorption column.
[0094] (13) Place the adsorption column on a clean 1.5 mL centrifuge tube, add 80 - 100 μL of Elution Buffer to the center of the adsorption column in suspension, let it stand for 1 min, and centrifuge at maximum speed for 2 min to elute the plasmid. Discard the column and store the plasmid at -20°C.
[0095] Cell culture
[0096] The cells used in this experiment were HEK293T cells and Hela cells, which were cultured in the same way, and the cell culture medium was DMEM (containing 10% fetal bovine serum). When thawing, take the cell cryopreservation tube out of the liquid nitrogen tank, place it in warm water at 37°C and stir to thaw, transfer it to a 1.5 mL centrifuge tube, and centrifuge at 1050 rpm for 5 min. Discard the supernatant, add 1 mL of PBS to resuspend, and centrifuge at 1050 rpm for 5 min. Discard the supernatant, add 1 mL of cell culture medium to resuspend, inoculate into a 60 mm cell culture dish, and place it in an incubator at 37°C, 5% CO2, and saturated humidity for culture. Passage culture was carried out when the cell confluence rate was over 90%. When passaging, discard the original culture medium in the culture dish, add 2 mL of PBS to wash the cells, discard the PBS, add 1 mL of trypsin, place it in an incubator at 37°C for digestion for 1 min, gently pipette to blow down the adherent cells, add an equal volume of cell culture medium to terminate digestion, and centrifuge at 1050 rpm for 5 min. Discard the supernatant, add 1 mL of cell culture medium to resuspend, inoculate into a 60 mm cell culture dish, and place it in an incubator at 37°C, 5% CO2, and saturated humidity for culture.
[0097] Transfection of Cells
[0098] In this experiment, the PEI transfection reagent was used to transfect HEK293T cells and Hela cells. The PE system targeting FANCF was transfected into HEK293T cells. The PE system targeting CCR5 was transfected into Hela cells. Transfection was carried out when the cell confluence rate was 60% - 70%. Before transfection, change the cell culture medium to serum-free DMEM and place it in the cell culture incubator for 1 h. Mix each plasmid according to the ratio of pCMV-PE2:pGL3-U6-pegRNA / pGL3-U6-RNAmotif-pegRNA:pGL3-U6-sgRNA = 9:3:1. Add 10 μg of plasmid to 400 μL of opti-MEM, mix well, and let it stand for 10 min. Then add 40 μL of PEI to the system, mix well, and let it stand for 10 min. Add the system evenly to a 60 mm culture dish and place it in an incubator at 37°C, 5% CO2, and saturated humidity for culture. 12 h after transfection, change the serum-free DMEM to DMEM cell culture medium supplemented with 10% fetal bovine serum. 72 h after transfection, discard the cell culture medium, wash the cells with 2 mL of PBS, discard the PBS, add 1 mL of trypsin, place it in an incubator at 37°C for digestion for 1 min, gently pipette to blow down the adherent cells, add an equal volume of cell culture medium to terminate digestion, and centrifuge at 1050 rpm for 5 min to collect the cells for subsequent genomic extraction.
[0099] Example 3 Detection of Prime Editing Efficiency by Deep Targeted Sequencing Method
[0100] Deep targeted sequencing is a method that can accurately quantify the editing efficiency, and any editing within 300 bp can be detected by deep targeted sequencing. Primers with a distance of approximately 250 bp are designed at both ends of the insertion site, with the primers more than 20 bp away from the editing sequence. The primers are shown in Table 14. The cell genome is amplified with these primers, and the amplification product is subjected to nucleic acid electrophoresis on a 1% agarose gel, and the target fragment is recovered. The target fragment is subjected to deep targeted sequencing by Wuhan Shadow Gene Technology Co., Ltd. The sequencing results are analyzed by CRISPRESSO2. If it is single-base editing, it is analyzed by the BE mode. If it is insertion, deletion or substitution, it is analyzed by the HDR mode.
[0101] Table 14 Amplification primers for detecting editing efficiency by deep targeted sequencing
[0102]
[0103]
[0104] The results showed that after adding RNAmotif to the 3' end of pegRNA, 6 out of 7 sites had increased efficiency. The corresponding increased efficiencies of FANCF179 (A to T), FANCF 261-266 (TCCAGG del), FANCF 327-332 (ATGCAG to GGATCC), FANCF594-595 (GGATCC ins), CCR52317-2318 (GG to CC), and CCR53272-3277 (AAAGAA del) were 1.41-fold, 3.58-fold, 2.70-fold, 1.35-fold, 1.23-fold, and 1.46-fold respectively, and the editing efficiency differences at 4 sites were significant. The highest increase in efficiency was 3.58-fold ( Figure 3 ). This result proves that adding HOXB13-5'UTRRNAmotif to the 3' end of pegRNA can effectively improve the editing efficiency of the PE system at multiple sites in multiple cell types and mediate multiple editing types.
[0105] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Application of RNAmotif in improving prime editing efficiency, characterized in that, The nucleotide sequence of the RNAmotif is shown as follows: CTTAGCCACTGCACCAGGGAATTCCCTGCCAGCGATTT。 2. The pGL3-U6-RNAmotif-pegRNA expression vector is characterized in that, Using pGL3-U6-sgRNA-EGFP as the starting vector, the linearized pGL3-U6-sgRNA-EGFP is sequentially ligated with the spacer double-strand with sticky ends, the scaffold double-strand, and the extension double-strand. The DNA single-strand fragments include spacer top / bottom, scaffold top / bottom, and 3’ extension top / bottom. Moreover, the 3’ end of the 3’ extension top strand is also ligated to the RNAmotif top strand, and the 5’ end of the 3’ extension bottom strand is also ligated to the RNAmotif bottom strand, with top and bottom being reverse complementary; after annealing of each top and bottom fragment, a double-strand is formed; the nucleotide sequence of Scaffold top is shown as SEQ ID NO.26; the nucleotide sequence of RNAmotif top is shown as SEQ ID NO.27; When the A at position 179 of the FANCF gene is mutated to T, the nucleotide sequence of Spacer top is shown as SEQ ID NO.3, and the nucleotide sequence of 3’ extension top is shown as SEQ ID NO.4; When the TCCAGG at positions 261-266 of the FANCF gene is deleted, the nucleotide sequence of Spacer top is shown as SEQ IDNO.5, and the nucleotide sequence of 3’ extension top is shown as SEQ ID NO.6; When the ATGCAG at positions 327-332 of the FANCF gene is replaced with GGATCC, the nucleotide sequence of Spacer top is shown as SEQ ID NO.7, and the nucleotide sequence of 3’ extension top is shown as SEQ ID NO.8; When GGATCC is inserted between positions 594-595 of the FANCF gene, the nucleotide sequence of Spacer top is shown as SEQ IDNO.9, and the nucleotide sequence of 3’ extension top is shown as SEQ ID NO.10; When the GG at positions 2317-2318 of the CCR5 gene is replaced with CC, the nucleotide sequence of Spacer top is shown as SEQ IDNO.11, and the nucleotide sequence of 3’ extension top is shown as SEQ ID NO.12; When deleting AAAGAA at positions 3272-3277 of the CCR5 gene, the nucleotide sequence of Spacer top is as shown in SEQ ID NO.13, and the nucleotide sequence of 3’ extension top is as shown in SEQ ID NO.
14.
3. Use of the pGL3-U6-RNAmotif-pegRNA expression vector according to claim 2 in improving prime editing efficiency.