A cotton high temperature response gene GhMucin17-like, its encoded protein and its application

Abstract

The present invention belongs to the technical field of plant molecular breeding, and in particular to a cotton high temperature response gene GhMucin17-like, an encoded protein and its application. The present invention utilizes a natural population of 510 upland cotton germplasms, collects anther phenotypes under normal and high temperature conditions for many years at multiple points, evaluates the anther cracking heat resistance index, and through genome-wide association analysis, LD-block analysis and haplotype analysis, finds the cotton high temperature response gene GhMucin17-like, whose gene sequence is shown in SEQ ID No.4. By constructing a vector for knocking out the gene, a mutant plant is obtained, and the results of the embodiment after editing and testing the plant show that the GhMucin17-like gene significantly affects the cracking of cotton anthers and even the development of anthers, and the GhMucin17-like gene is of great significance in guiding cotton germplasm improvement.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and in particular relates to a cotton high temperature response gene GhMucin17-like, an encoded protein and applications thereof. Background Art

[0002] Cotton is the seed fiber of the Gossypium plant of the Malvaceae family. It is native to the subtropics and is an essential raw material in life.

[0003] Prior art (Min et al., 2014; Khan et al., 2020; 2023) has disclosed that cotton, a summer crop, has an optimal growing temperature of 20-30°C. July and August are the flowering and boll-setting periods. Frequent high temperatures can severely impact cotton's reproductive development, leading to significant yield reductions. Stamen development is more sensitive to high temperatures than pistil development. High temperatures above 35°C can severely impact the development of cotton's male reproductive organs, causing pollen abortion and anther failure, ultimately leading to pollination failure and yield reduction. The degree of anther dehiscence can be used as a key indicator for screening and breeding heat-tolerant cotton varieties.

[0004] Currently, there are relatively few heat-tolerant genes and germplasm resources available for cotton, and the innovation of heat-tolerant germplasm has reached a bottleneck. Therefore, to address yield reductions caused by high temperatures, discovering new heat-responsive genes and using them to improve cotton's heat tolerance has become an urgent challenge in this field. Summary of the Invention

[0005] In view of this, the present invention provides a cotton high temperature response gene GhMucin17-like, an encoded protein and its application. The cotton high temperature response gene GhMucin17-like provided by the present invention regulates the plant's high temperature resistance through a positive regulation manner.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] A cotton high temperature response gene GhMucin17-like, wherein the nucleotide sequence of the GhMucin17-like is one of the following sequences:

[0008] 1) the DNA sequence shown in SEQ ID No. 4;

[0009] 2) A DNA sequence encoding the protein shown in SEQ ID No. 5.

[0010] The present invention also provides a protein encoded by the cotton high temperature response gene GhMucin17-like described in the above technical solution, and the amino acid sequence of the protein is shown in SEQ ID No.5.

[0011] The present invention also provides a biological material of the gene or protein described in the above technical solution, wherein the biological material includes any one of a knockout recombinant vector, a knockout recombinant microorganism, and an sgRNA that inhibits the expression of the cotton high temperature response gene GhMucin17-like.

[0012] The present invention also provides the biomaterial described in the above technical solution, wherein the nucleotide sequence of the sgRNA is shown as SEQ ID No.6.

[0013] The present invention also provides the use of the cotton high temperature response gene GhMucin17-like, protein or biological material described in the above technical solution in plant molecular breeding.

[0014] The present invention also provides the application described in the above technical solution, namely, the application of the cotton high temperature response gene GhMucin17-like as a negative regulatory factor in creating plant male sterile line germplasm and / or creating a high temperature sensitive plant model.

[0015] The present invention also provides the use of the cotton high temperature response gene GhMucin17-like described in the above technical solution or the protein described in the above technical solution in the screening or identification of high temperature resistant plant germplasm.

[0016] The present invention also provides a method for creating male sterile germplasm and / or a high-temperature sensitive plant model based on the cotton high-temperature response gene GhMucin17-like described in the above technical solution or the protein described in the above technical solution, comprising the following steps:

[0017] The cotton high temperature response gene GhMucin17-like is knocked out in the target plant or the content of the GhMucin17-like protein in the target plant is reduced to obtain the plant male sterile line germplasm and / or high temperature sensitive plant model.

[0018] Preferably, the plant comprises cotton; and the cotton comprises upland cotton.

[0019] The beneficial effects of the above technical solution are:

[0020] The present invention provides a cotton high-temperature response gene, GhMucin17-like, whose nucleotide sequence is shown in SEQ ID No. 4. This invention breaks the bottleneck of cotton gene resources, enriches the genetic resources of cotton high-temperature response, and provides a gene that can be used to improve cotton high-temperature resistance and create high-temperature-tolerant germplasm. The present invention found that mutant materials of GhMucin17-like exhibit obvious anther growth defects, ultimately causing sterility. This invention enriches the genetic resources of cotton high-temperature response and provides a strategy and method for creating improved cotton germplasm.

[0021] At the same time, since knocking out the cotton high temperature response gene GhMucin17-like in plants can lead to severe degeneration of male organs and even male sterility, the GhMucin17-like gene can also be used to create plant male sterile line germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0023] Figure 1 This is the overall technical route of the present invention;

[0024] Figure 2 This is the technical route for obtaining anther dehiscence data of natural populations using the CAI-YOLO model in Example 2 of the present invention;

[0025] Figure 3 In Example 3 of the present invention, a genome-wide association analysis of anther dehiscence data of 510 natural populations collected based on the CAI-YOLO model in Example 2 was performed;

[0026] Figure 4 In Example 3 of the present invention, Figure 3 Schematic diagram of LD-block analysis results of 4 consecutively distributed significant association loci;

[0027] Figure 5 Schematic diagram of preliminary prediction results of the functions of 15 candidate genes in Example 4 of the present invention;

[0028] Figure 6 The expression of GhMucin17-like was detected during the entire growth period of Jin668 under normal temperature and high temperature natural conditions in Example 4 of the present invention;

[0029] Figure 7 This is the phenotype and editing detection results of the GhMucin17-like mutant strain in Example 5 of the present invention. DETAILED DESCRIPTION

[0030] The present invention provides a cotton high temperature corresponding gene GhMucin17-like, wherein the nucleotide sequence of the GhMucin17-like is one of the following sequences:

[0031] 1) the DNA sequence as shown in SEQ ID No. 4 in the sequence listing;

[0032] 2) A DNA sequence encoding the protein shown in SEQ ID No. 5 in the sequence listing.

[0033] The amino acid sequence shown in SEQ ID No. 4 and the amino acid sequence shown in SEQ ID No. 5 of the present invention are shown in the Examples section and will not be described in detail.

[0034] The present invention also provides a protein encoded by the cotton high temperature response gene GhMucin17-like described in the above technical solution, the amino acid sequence of which is shown in SEQ ID No. 5. The nucleotide sequence shown in SEQ ID No. 5 of the present invention is shown in the Examples section and will not be repeated here.

[0035] The present invention also provides a biological material of the gene or protein described in the above technical solution, wherein the biological material preferably includes any one of a knockout recombinant vector, a knockout recombinant microorganism and an sgRNA that inhibits the expression of the cotton high temperature response gene GhMucin17-like.

[0036] The sgRNA for inhibiting the expression of the cotton high temperature response gene GhMucin17-like of the present invention is preferably as shown in SEQ ID No. 6, which is specifically shown in the examples and will not be repeated here.

[0037] The knockout recombinant vector of the present invention preferably includes an initial vector and the sgRNA; the initial vector preferably includes a modified pRGEB32-HtKt vector, and the improved pRGEB32-HtKt vector is preferably disclosed in Ramadan, M., Alariqi, M., Ma, Y., Li, Y., Liu, Z., Zhang, R., Jin, S., Min, L., & Zhang, X. (2021). Efficient CRISPR / Cas9 mediated Pooled-sgRNAs assembly accelerates targeting multiplegenes related to male sterility in cotton. Plant methods, 17 (1), 16. When the initial vector is the improved pRGEB32-HtKt vector, the sgRNA is preferably inserted into the Exnase II restriction site of the improved pRGEB32-HtKt vector. The primer sequences for amplifying the sgRNA of the present invention are preferably as shown in SEQ ID No. 7 and SEQ ID No. 8 in the embodiment, and are not repeated here.

[0038] The knockout recombinant microorganism of the present invention preferably includes an initial strain and the sgRNA, the initial strain is preferably Agrobacterium, and the Agrobacterium is preferably a GV3101 strain.

[0039] The present invention does not specifically limit the reagents and procedures used in the preparation of the knockout recombinant vector, the knockout recombinant microorganism, and the sgRNA for inhibiting the expression of the cotton high temperature response gene GhMucin17-like. Conventional commercially available reagents in the art and their corresponding amplification procedures can be used.

[0040] The present invention also provides the use of the cotton high-temperature response gene GhMucin17-like, protein, or biomaterial described in the above technical solution in plant molecular breeding. The use of the cotton high-temperature response gene GhMucin17-like in plant molecular breeding preferably includes the use of the cotton high-temperature response gene GhMucin17-like as a negative regulatory factor in creating plant male sterile germplasm and / or creating high-temperature sensitive plant models.

[0041] In the present invention, the negative regulation preferably includes: knocking out the GhMucin17-like gene fragment in the target cotton plant by using the CRISPR / Cas9 system, and the nucleotide sequence of the sgRNA used for the knockout is shown in SEQ ID NO.6;

[0042] The present invention also provides the use of the cotton high temperature response gene GhMucin17-like or protein described in the above technical solution in the screening or identification of high temperature resistant plant germplasm.

[0043] The present invention also provides a method for creating male sterile germplasm and / or a high-temperature sensitive plant model based on the cotton high-temperature response gene GhMucin17-like described in the above technical solution or the protein described in the above technical solution, comprising the following steps:

[0044] The cotton high temperature response gene GhMucin17-like is knocked out in the target plant or the content of the GhMucin17-like protein in the target plant is reduced to obtain the plant male sterile line germplasm and / or high temperature sensitive plant model.

[0045] The present invention preferably transforms the expression vector into the cotton plant by any method to reduce the expression level of the cotton high temperature response gene GhMucin17-like or the protein GhMucin17-like content to obtain a knockout modified plant, and the knockout modified plant is a male sterile germplasm plant and / or a high temperature sensitive plant model; more preferably, the knockout expression vector is infected into the target plant by Agrobacterium transformation to obtain a knockout modified plant, and the knockout modified plant is preferably a male sterile germplasm and / or a high temperature sensitive plant model.

[0046] In the applications and methods of the present invention, the plant preferably comprises cotton, more preferably upland cotton. The cotton heat-responsive gene GhMucin17-like provided by the present invention has a significant effect on cotton's heat response and can be used as a gene for improving cotton's heat resistance and creating heat-tolerant germplasm.

[0047] To further illustrate the present invention, a cotton high temperature response gene GhMucin17-like, the encoded protein and its application provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0048] The overall experimental process described in Examples 1 to 4 below is as follows Figure 1 shown.

[0049] Example 1: Using the CAI-YOLO model to obtain anther dehiscence data of natural populations

[0050] 510 cotton germplasms from home and abroad were collected and planted in Turpan, Xinjiang, Aral and Korla, Xinjiang in 2018 and 2019 respectively. Open flowers were collected in the field under normal temperature (daytime temperature below 35°C, nighttime temperature below 27°C) and natural high temperature (daytime temperature above 35°C, nighttime temperature above 27°C) conditions. They were photographed indoors on the same day using a Canon 70d high-definition digital camera, resulting in a total of 64,445 high-definition RGB images of cotton anthers. These anther images were sorted by year, processing, and variety, and cropped to an appropriate size using Photoshop software. Anther images with a wide range of phenotypical representations were selected to construct a dataset, which was divided into training, validation, and test sets. In view of the dense clustering of anthers in single cotton flowers and the subsequent need to be installed on mobile devices, the powerful and lightweight YOLOv5 network model was selected. After iterative learning on the dataset, an improved CAI-YOLO network model was obtained, which can quickly and accurately count the anther dehiscence status of cotton anther images, including the number of dehiscence anthers, the number of non-dehiscence anthers, and the total number of anthers. The construction process and results are shown in the figure. Figure 2 shown.

[0051] Example 2: Based on genome-wide association analysis, LD-block and haplotype analysis of anther dehiscence data, QTL loci significantly associated with anther dehiscence were obtained.

[0052] The trained CAI-YOLO model was used to detect all the sorted anther images, and the anther dehiscence phenotypic data of all anther images were obtained, including the number of anthers that dehisced, the number of anthers that did not dehisce, and the total number of anthers. The anther dehiscence index of each anther image was then calculated (the number of anthers that dehisced was divided by the total number of anthers), and the anther dehiscence index of all images of each variety treated at high temperature and normal temperature were used to form the high temperature and normal temperature anther dehiscence index sets of the corresponding variety, respectively. In order to improve the authenticity of the associated sites, 1 / 3, 1 / 2, and 2 / 3 of the total data were randomly captured from the anther dehiscence heat resistance index dataset for 3 times each. The average value of the randomly captured data was used as the trait, and association analysis was performed separately. A total of 9 association analyses were performed, and the results are as follows: Figure 3 As shown ( Figure 3 T refers to all data).

[0053] Depend on Figure 3 The association analysis combined with the statistical analysis of associated loci revealed the following QTL frequencies in 10 association analyses: D10 (8 times), D01 (5 times and 4 times), A09 (5 times), A11 (5 times), A03 (4 times and 1 time), D06 (3 times), A01, A05, and D02 (2 times each), with the remaining loci appearing once. The more frequent D10, D01 (5 times), qRHI_A09, and A11 loci were selected as candidate QTLs.

[0054] LD-block analysis was performed on these four continuously distributed significant association sites, and the results are shown in Figure 4 .

[0055] Depend on Figure 4 It can be seen that the r 2 The coefficient is large, and there is a gene cluster at 6010kb~6236kb on qRHI_A09 and 55414kb~55669kb on qRHI_D01 that may affect the heat resistance index of upland cotton cracking ( Figure 4 (a). Haplotype analysis was then performed on the gene clusters containing qRHI_A09 and qRHI_D01. The qRHI_A09 gene cluster has a total of 10 non-synonymous mutation SNPs; the qRHI_D01 gene cluster has a total of 13 non-synonymous mutation SNPs. The haplotype analysis results showed that the SNP mutations in the qRHI_A09 and qRHI_D01 gene clusters are linked, which also supports the results of the LD-block analysis. In addition, the anther dehiscence heat resistance index of the lines with homozygous mutations in the qRHI_D01 gene cluster was significantly higher than that of the lines without mutations. The lines without mutations are the reference genotype. ( Figure 4 (b) Based on the results of LD-block and haplotype analysis, qRHI-D01 was identified as the main locus for high-temperature tolerance in upland cotton.

[0056] Example 3 Analysis of candidate genes in qRHI_D01 identified GhMucin17-like as a key gene. There are 15 genes in the qRHI-D01 gene cluster (Ghir_D01G018420 to Ghir_D01G018560). Combined with the annotation of the Arabidopsis homologous proteins of these 15 genes, their gene functions were preliminarily predicted. The results are shown in Figure 5 Middle a.

[0057] according to Figure 5 The results shown in (a) were further analyzed using the transcriptome data of 218 upland cotton related populations during the tetrad period after 3 days of natural high temperature stress in the field (daytime temperature exceeded 35°C and nighttime temperature exceeded 27°C) and the normal temperature and high temperature expression profiles of the extreme cotton lines "84021" and "H05". The population expression and high temperature induced expression of 15 candidate genes in the qRHI-D01 gene cluster were analyzed. The results are shown in (a). Figure 5 Middle b~c.

[0058] according to Figure 5As shown in Figures b to c, the candidate genes Ghir_D01G018440, Ghir_D01G018450, Ghir_D01G018480, Ghir_D01G018510, and Ghir_D01G018540 were concentrated in the tetrad stage (TS), while the candidate gene Ghir_D01G018420 was most highly expressed in the anther dehiscence stage (ADS). Under high temperature conditions, the expression levels of candidate genes Ghir_D01G018420 and Ghir_D01G018450 were upregulated in the heat-resistant variety "84021" and the heat-sensitive variety "H05" compared with normal temperature; the expression levels of candidate genes Ghir_D01G018480 and Ghir_D01G018510 were downregulated in the heat-resistant variety "84021", but upregulated in the heat-sensitive variety "H05"; the expression level of candidate gene Ghir_D01G018540 was upregulated in the heat-resistant variety "84021", but lower in the heat-sensitive variety "H05"; the expression level of candidate gene Ghir_D01G018440 was upregulated in the heat-resistant variety "84021", but downregulated in the heat-sensitive variety "H05", showing completely opposite change trends. Among them, the gene Ghir_D01G018440 encodes a Mucin17-like protein, named GhMucin17-lik, which may be involved in cotton anther dehiscence.

[0059] Therefore, the expression of GhMucin17-like was detected during the entire anther development period of Jin668 at normal and high temperatures.

[0060] Design q-PCR primers, the primer sequences are shown in SEQ ID No. 1-2;

[0061] SEQ ID No.1: qPCR-F:5'-TACTCTGCAGGATGGGGGTGTT-3'

[0062] SEQ ID No.2: qPCR-R:5'-TCCATTGCTAGAACCGTGCTGAGA-3'

[0063] The amplified sequence is as follows:

[0064] SEQ ID No.3: 5'-TACTCTGCAGGATGGGGGTGTTCCATCATCAGAGAT CTCAATTGCTGACTTGCCAGCTGACAATAGGAGTGAAGTGGCCTTGAATG GAGATGCTTATGCTGAGTCTCAGCACGGTTCTAGCAATGGA-3'

[0065] RT-PCR reaction system: 7.5 μL of 2× ChamQ SYBR Color qPCR Master Mix (Low ROX Premix); 10.3 μL of 50× ROX Reference Dye; 0.3 μL of forward primer 1 (SEQ ID No. 1); 0.3 μL of reverse primer 1 (SEQ ID No. 2); 6.6 μL of cDNA template; reaction procedure: a. 95°C for 2 min; b. 95°C for 15 sec, 60°C for 35 sec, 40 cycles. Amplified sequences were used to screen for genes that met the criteria, and the results were downloaded and analyzed.

[0066] The results are as follows Figure 6 As shown, the GhMucin17-like gene sequence is 1890 bp in length, as specifically shown in SEQ ID No.4.

[0067] SEQ ID No.4:>Ghir_D01G018440

[0068]

[0069] The protein sequence encoded by the GhMucin17-like gene is shown below:

[0070] SEQ ID No.5: >Ghir_D01G018440

[0071] MERSEPSLVPEWLKCSGSLTGSGNSSNQFTSSSSSSHSDNHSALRHARNKLSVDSDGDIGRTSVLDRASSAYFRRSSSSKGASDSWSYSNFGKGHRERDWEKVSNGYHDRKNAVLSDHRNRNYSDSLDNLPPSMFEKDVLRRSQSLKTGKHSDTWPRKATNESSGTGKSHHSSGNGKLSTVAAVGNKSAFERDFPSLGAEVRQVGSEIGRILSPGLTNPVQSLPVGTSPVLGSDGRTSALADIPVGVGNSGRGVAVASQNVPAGSTPTTVTGLNMAEAVAQGPSRARTPPLLNVETQRLEELAIKQSRQLIPLVTVSTPKTLVVSPSEKSRPKVGQQLHPSLSFGSTRGGTSRSDSQKVSNESRLLILKPSRESNGVSSITTRDNLSPTNGSNKFANSPINITPSAAASVPFRSSGNSPRLATAERNQTPVRMTMEKRATAQAQSRNDFFNLLKKKSTSNSASSVLDSGSAVSPPVSEKSDELGTEDSSTSVTLQDGGVPSSEISIADLPADNRSEVALNGDAYAESQHGSSNGDEHSRPDAYLYPDEEEVAFLRSLGWEENAEDDDGLTEEEISAFFEQYMKLKPSAKVSQLMQSLSPLNSQNGTHGDALSGSSSMDSNGAAWTRQNV*。

[0072] According to Figure 6The results showed that under normal temperature, GhMucin17-like expression levels increased dramatically just before anther dehiscence, remaining low throughout the rest of the growth period. However, after high temperature induction, the peak expression period at normal temperature shifted earlier, explaining the downregulation in the heat-sensitive variety "H05." Peaks in expression also occurred at 6-7 mm and 13-14 mm, two critical stages of anther development. This suggests that the GhMucin17-like gene plays a crucial role during anther dehiscence and throughout all three critical stages. Therefore, GhMucin17-like was identified as a key gene.

[0073] Example 4: Construction of a GhMucin17-like knockout vector to obtain mutant plants

[0074] The knockout vector is the pRGEB32-HtKt vector (Ramanda et al., 2021), which was modified by our laboratory. This vector introduces a tRNA, which can save the process of cloning tRNA from an additional vector, and introduces a lethal gene in-frame on the vector, which can effectively avoid false positives caused by insufficient enzyme digestion of the vector.

[0075] The website http: / / crispr.hzau.edu.cn / CRISPR2 / was used to design sgRNA targeting the CDS region of the candidate gene. When synthesizing the sgRNA, linkers of the pRGEB32-HtKt vector were added on both sides and used as a template for PCR amplification to obtain the target fragment.

[0076] The sequence of the sgRNA is shown in SEQ ID No. 6, specifically GGCAAAAGCCATCATAGCAG

[0077] The sequence of forward primer 2 is as follows:

[0078] SEQ ID No. 7: pRGEB32-HtKt5' linker: 5'-TTCCCGGCTGGTGCA-3';

[0079] The sequence of reverse primer 2 is as follows:

[0080] SEQ ID No. 8: pRGEB32-HtKt 3' linker: 5'-GTTTTAGAGCTAGAA-3'.

[0081] The reaction system consisted of 2 μL of 10× Buffer solution; 0.3 μL of Taq polymerase; 0.3 μL of 10 mM dNTPs; 0.2 μL of forward primer 2 (SEQ ID No. 7); 0.2 μL of reverse primer 2 (SEQ ID No. 8); 1 μL of template DNA; and 16 μL of ddH2O. The reaction procedure was as follows: a. 95°C for 5 min; b. 32 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 10 sec; c. 72°C for 1 min; d. Incubation at 15°C. The amplified PCR product was ligated into the linearized pRGEB32-HtKt vector by infusion and then transformed into the Top10 strain.

[0082] Infusion reaction system: target fragment, 100 ng (2.5 μL); linearized expression vector, 100 ng (1 μL); Exnase II, 0.5 μL; 5× CE Buffer, 1 μL. After screening in solid LB medium containing kanamycin antibody, positive clones were selected for bacterial PCR and sequencing to obtain mutation-free clones.

[0083] The sequence of forward primer 3 is as follows:

[0084] SEQ ID No.9: 5'-TGCCACGGTACAGACCC-3';

[0085] The sequence of reverse primer 3 is as follows:

[0086] SEQ ID No.10: 5'-CGACTCGGTGCCACTTTT-3';

[0087] Positive test reaction system: The reaction system is 10× Buffer solution, 2 μL; Taq polymerase, 0.3 μL; 10 mM dNTP, 0.3 μL; forward primer 3 (SEQ ID No. 9), 0.2 μL; reverse primer 3 (SEQ ID No. 10), 0.2 μL; template DNA, 1 μL; ddH2O, 16 μL; reaction procedure: a. 95°C for 5 min; b. 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 32 cycles; c. 72°C for 7 min; d. Incubation at 15°C. After obtaining the knockout recombinant vector, the recombinant vector was electroporated into Agrobacterium tumefaciens GV3101 strain, and positive clones were selected for strain storage. The strains were stored in a -70°C ultra-low temperature freezer until use.

[0088] Cotton genetic transformation: After two days of co-cultivation with Agrobacterium, the hypocotyls are transferred to 2,4-D culture medium and subcultured every 25-30 days to induce dedifferentiation of plant cells into callus. Once pale yellow, granular embryonic calli have grown, they are transferred to differentiation medium to induce redifferentiation into embryos and seedlings. After the seedlings have developed approximately three true leaves, they are transferred to rooting medium. When the seedlings reach the top of the conical flask and new roots are established, they can be hydroponically cultured. After a week of hardening, the plants are transferred to small soil pots and cultured in the greenhouse. DNA from mutant plants is extracted for positive identification and editing efficiency testing.

[0089] According to the vector map, a pair of universal vector primers were designed in the Cas9 region to detect the insertion of knockout vectors in mutant materials. The primers are as follows:

[0090] The sequence of forward primer 4 is as follows:

[0091] SEQ ID No. 11: Cas9-F: 5'-AGAAATTCAAGGTGCTGGGC-3';

[0092] The sequence of reverse primer 4 is as follows:

[0093] SEQ ID No.12: Cas9-R: 5'-CACCTTGGCCATCTCGTTG-3';

[0094] The reaction system consisted of 2 μL of 10× Buffer solution; 0.3 μL of Taq polymerase; 0.3 μL of 10 mM dNTPs; 0.2 μL of forward primer 4 (SEQ ID No. 11); 0.2 μL of reverse primer 4 (SEQ ID No. 12); 1 μL of template DNA; and 16 μL of ddH₂O. The reaction procedure was as follows: a. 95°C for 5 min; b. 35 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 30 sec; c. 72°C for 7 min; d. Incubation at 15°C.

[0095] The mutant materials with successful T-DNA insertion were tested for sgRNA to determine the corresponding target gene.

[0096] The sequence of forward primer 5 is as follows:

[0097] SEQ ID No. 13: Detection primer sgRNA-F: 5′-GCGAAAGAAGCATCAGATGG-3′;

[0098] The sequence of reverse primer 5 is as follows:

[0099] SEQ ID No. 14: sgRNA-R: 5'-GACCCGAATTTGTGGACCTG-3'.

[0100] The reaction system consisted of 2 μL of 10× Buffer solution, 0.3 μL of Taq polymerase, 0.3 μL of 10 mM dNTPs, 0.2 μL of forward primer 5 (SEQ ID No. 13), 0.2 μL of reverse primer 5 (SEQ ID No. 14), 1 μL of template DNA, and 16 μL of ddH2O. The reaction procedure was as follows: a. 95°C for 5 min; b. 35 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 30 sec; c. 72°C for 7 min; d. Incubation at 15°C. Figure 7 As shown in a.

[0101] Editing efficiency detection: After determining the target gene, design detection primers before and after the target position.

[0102] The sequence of forward primer 6 is as follows:

[0103] SEQ ID No.15: barcode-F: GGCCGAGGAAAGCAACAAAT

[0104] The sequence of reverse primer 6 is as follows:

[0105] SEQ ID No.16: barcode-R:ACTTGTCTTACTTCAGCACCA

[0106] The amplified fragments are shown below, with the bold part being the sgRNA:

[0107] SEQ ID No.17:

[0108] GGCCGAGGAAAGCAACAAATGAATCAAGTGGCACCGGCAAAAGCCATCATAGCAGTGGTAATGGTAAACTTAGCACAGTTGCTGCTGTTGGTAATAAATCTGCATTTGAACGTGATTTTCCTTCACTTGGTGCTGAAGTAAGACAAGT

[0109] The reaction system consisted of 2 μL of 10× Buffer solution; 0.3 μL of Taq polymerase; 0.3 μL of 10 mM dNTPs; 0.2 μL of forward primer 6 (SEQ ID No. 15); 0.2 μL of reverse primer 6 (SEQ ID No. 16); 1 μL of template DNA; and 16 μL of ddH2O. The reaction procedure was as follows: a. 95°C for 5 min; b. 35 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 30 sec; c. 72°C for 7 min; d. Incubation at 15°C. PCR products were subjected to high-throughput sequencing to determine editing efficiency.

[0110] Edit the test results as follows Figure 7 As shown in b, Figure 7 As shown in Figure b, the editing efficiency of the positive individual plants was as high as 91.98%, indicating that the degree of mutation of this gene is high. Figure 7 As shown in c, Figure 7 As shown in Figure C, the anthers of the cotton mutant are malformed, the female organs are exposed to the outside, and the male organs are severely degenerated, with only a few anthers growing. Figure 7 Figure c shows that the plant is developing abnormally at this time and has no pollen. This indicates that GhMucin17-like function does seriously affect anther dehiscence and even anther development, proving that GhMucin17-like is a positive regulator of anther dehiscence and response to high temperature stress.

[0111] References:

[0112] Min L,Li Y,Hu Q,Zhu L,Gao W,WuY,Ding Y,Liu S,Yang X,Zhang

[0113] Khan AH, Min L, Ma Y, Wu Y, Ding Y, Li Y, Xie S, Ullah A, Shaban M, ManghwarH, Shahid M, Zhao Y, Wang C, Zhang X (2020) High day and night temperatures distinctly disrupt fatty acid and jasmonic acid metabolism, inducing malesterility in cotton. J Exp Bot 71:6128-6141.

[0114] Khan AH, Ma Y, Wu Y, Akbar A, Shaban M, Ullah A, Deng J, Khan AS, Chi H, ZhuL, Zhang X, Min L (2023) High-temperature stress suppresses allene oxide cyclase2and causes male sterility in cotton by disrupting jasmonic acidsignaling. Crop J 11:33-453.

[0115] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of knockout or inhibition of cotton GhMucin17-like gene in the creation of cotton male sterile germplasm; The cotton includes upland cotton; The nucleotide sequence of the GhMucin17-like gene is one of the following sequences: 1) the DNA sequence shown in SEQ ID No. 4; 2) A DNA sequence encoding the protein shown in SEQ ID No.

5.

2. The use according to claim 1, characterized in that Creation of cotton male sterile germplasm by regulating the GhMucin17-like gene using biological materials; The biological material includes any one of a knockout recombinant vector, a knockout recombinant microorganism and an sgRNA that inhibits the expression of the GhMucin17-like gene.

3. The use according to claim 2, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID No.

6.

4. A method for creating cotton male sterile line germplasm, characterized in that: The steps include: The GhMucin17-like gene in the target cotton plant is knocked out or the content of the GhMucin17-like protein in the target cotton plant is suppressed to obtain the cotton male sterile line germplasm.

Images