A molecular marker for identifying duck body weight traits based on the LYN gene and its application

Abstract

The present invention relates to a molecular marker for identifying duck body weight traits based on the LYN gene and its application, belonging to the technical field of molecular marker detection. The nucleotide sequence of the molecular marker consists of the 1279th polymorphic site of the LYN gene sequence shown in SEQ ID NO.1 and the upstream and downstream bases thereof. The 1279th polymorphic site of the sequence shown in SEQ ID NO.1 is T or C. By studying the relationship between the LYN gene and duck body weight traits, the present invention develops a molecular marker. By identifying the type of the molecular marker existing in the duck genome, the body weight traits of ducks can be selected, and a breeding method for early body weight selection of poultry is established, providing a new molecular marker-assisted breeding method for the detection of duck growth traits.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker detection, and particularly relates to a molecular marker for identifying duck body weight traits based on LYN genes and its application. Background Technique

[0002] As an important economic trait of poultry, the growth rate and stability of body weight directly reflect its growth performance. The body weight of poultry is affected by various factors, and genetic factors play a crucial role among them. In recent years, with the further development of molecular biology technology, more and more candidate genes have been found to be related to poultry body weight. These genes show different expression patterns and genetic variations in different breeds and families of poultry, providing an important breakthrough for further revealing the genetic mechanism of poultry body weight, and also providing an important basis for theoretical support and practical guidance in poultry breeding.

[0003] LYN The proto-oncogene, Src family tyrosine kinase (proto-oncogene, Src family tyrosine kinase, LYN ) is a protein-coding gene. Like most genes regulating growth traits, it can play a role in the signal transduction of growth factor receptors. Yang et al. identified LYN gene as an important candidate gene affecting duck growth rate (XI Y, WU Q, ZENG Y, et al. Identification of the genetic basis of the duck growth rate in multiple growth stages using genome-wide association analysis[J]. BMC Genomics, 2023, 24(1): 285-296.). In the genomic study of bovine carcass traits, it was found that LYNGenes are directly related to the expression of beef cattle growth traits (MEDEIROS DE OLIVEIRA SILVAR, BONVINO STAFUZZA N, DE OLIVEIRA FRAGOMENI B, et al. Genome-WideAssociation Study for Carcass Traits in an Experimental Nelore CattlePopulation[J]. PLoS One, 2017, 12(1): e0169860.). Terakado et al. identified in the candidate region of beef cattle BW that LYN genes are related to the height of cattle (TERAKADO A P N, COSTA R B, DE CAMARGO G M F, etal. Genome-wide association study for growth traits in Nelore cattle[J].Animal, 2018, 12(7): 1358-1362.).

[0004] Therefore LYN genes may be important candidate genes affecting livestock growth traits. Currently, the research on LYN genes mainly focuses on livestock such as cattle, and there are few studies on poultry such as ducks. SUMMARY OF THE INVENTION

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a molecular marker and application for identifying the body weight traits of ducks based on LYN genes. The SNP (single nucleotide polymorphism) molecular markers related to the candidate genes for the body weight traits of ducks are developed. By deeply studying the LYN relationship between gene variation and expression and the body weight of ducks, it helps to reveal that its genes play a key role in the growth and development of ducks, and it is expected to provide theoretical support for the precise regulation of duck growth and development and provide a scientific basis for duck breeding.

[0006] The present invention is achieved through the following technical solutions:

[0007] The first object of the present invention is to provide a molecular marker for identifying the body weight traits of ducks based on LYN genes. The CDS sequence of the LYN gene is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker consists of the 1279th polymorphic site of the sequence shown in SEQ ID NO.1 and the upstream and downstream bases thereof. The 1279th polymorphic site of the sequence shown in SEQ ID NO.1 is T or C.

[0008] As a further optimized solution of the present invention, the nucleotide sequence of the molecular marker is as described in SEQ ID NO.1, and the 1279th base of the sequence shown in SEQ ID NO.1 is T or C.

[0009] As a further optimized solution of the present invention, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.2. The sequence shown in SEQ ID NO.2 is derived from duck genomic DNA, and the 323rd base of the sequence shown in SEQ ID NO.2 is T or C.

[0010] The second object of the present invention is to provide an application of the above-mentioned molecular marker for identifying duck body weight traits based on LYN genes in identifying duck body weight traits. Ducks with the polymorphic locus of the molecular marker being of the C type have a faster growth rate in the later stage than T-type ducks.

[0011] As a further optimized solution of the present invention, if the molecular marker type of the duck to be tested is TT type, the body weight trait of this duck is poor; if the molecular marker type of the duck to be tested is CC type, the body weight trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the body weight trait of this duck is medium.

[0012] The third object of the present invention is to provide a method for identifying duck body weight traits using the above-mentioned molecular marker, including the following steps:

[0013] (1) Extract the total DNA of duck tissues, organs or blood;

[0014] (2) Use the duck genomic database to find the polymorphic locus of the molecular marker. Using the nucleotide sequence composed of this locus and its upstream and downstream bases as a template, design specific amplification primers and perform PCR amplification to obtain a PCR amplification product;

[0015] (3) Perform genotyping detection on the PCR amplification product to obtain the molecular marker type of the duck to be tested;

[0016] (4) Judge the duck body weight trait according to the molecular marker type. If the molecular marker type of the duck to be tested is TT type, the body weight trait of this duck is poor; if the molecular marker type of the duck to be tested is CC type, the body weight trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the body weight trait of this duck is medium.

[0017] As a further optimized solution of the present invention, the sequences of the specific amplification primers are:

[0018] SEQ ID NO.3: Forward primer: CAAAAGTTCACAATACCGAG;

[0019] SEQ ID NO.4: Reverse primer: TGTTGCTACTGTCAGATGC。

[0020] As a further optimized solution of the present invention, the genotyping detection method is Eam1105I Restriction enzyme digestion of the PCR amplification product. If the digested product contains 1 band, it is of the TT type; if it contains 2 bands, it is of the CC type; if it contains 3 bands, it is of the CT type.

[0021] The fourth object of the present invention is to provide another method for identifying the body weight trait of ducks using the above molecular marker, including the following steps:

[0022] (1) Extract the RNA of duck tissue organs or blood and reverse transcribe it into cDNA;

[0023] (2) Using the LYN gene CDS sequence as a template, design specific amplification primers and perform PCR amplification to obtain a PCR amplification product containing the polymorphic site of the molecular marker;

[0024] (3) Perform genotyping detection on the PCR amplification product to obtain the molecular marker type of the duck to be tested;

[0025] (4) Judge the body weight trait of the duck according to the molecular marker type. If the molecular marker type of the duck to be tested is of the TT type, the body weight trait of this duck is poor; if the molecular marker type of the duck to be tested is of the CC type, the body weight trait of this duck is the best; if the molecular marker type of the duck to be tested is of the CT type, the body weight trait of this duck is medium.

[0026] As a further optimized solution of the present invention, the duck tissue organ or blood is the wing vein blood of the duck.

[0027] The present invention has the following advantages compared with the prior art: By studying the LYN relationship between the gene and the body weight trait of ducks, and developing a molecular marker, by identifying the type of the molecular marker existing in the duck genome, the body weight trait of ducks can be selected, and a breeding method for early body weight selection of poultry is established, providing a new molecular marker-assisted breeding method for the detection of the growth traits of ducks. Description of the Drawings

[0028] Figure 1 It is the agarose gel electrophoresis diagram of the PCR amplification products of some samples;

[0029] Figure 2 It is the agarose gel electrophoresis diagram of the digested products obtained by digesting the PCR amplification products of some samples;

[0030] Figure 3 For duck LYNGenotype verification sequencing results of the gene polymorphism locus C42476355T. Detailed implementation manners

[0031] The present application will be further described in detail below with reference to the accompanying drawings. It is necessary to point out here that the following detailed implementation manners are only used to further illustrate the present application and should not be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0032] Example 1

[0033] 1. Materials

[0034] Unless otherwise specified, the methods used in this example are conventional methods well known to those skilled in the art. The reagents and other materials used are commercially available products unless otherwise specified.

[0035] 2. Methods

[0036] 2.1 Primer design

[0037] Locate the polymorphic locus of the molecular marker according to the duck genome database. The polymorphic locus is located at position 42476355 in the duck genome database, and its base type is C or T. Hereinafter, it is called the C42476355T locus. The gene corresponding to this polymorphic locus is the duck LYN gene, and the full-length CDS sequence of the duck LYN gene is shown in SEQ ID NO.1. The polymorphic locus is located at the 1279th position of the SEQ ID NO.1 sequence.

[0038] Based on the position of the polymorphic locus C42476355T in the duck genome database and the base sequences upstream and downstream thereof (taking a partial DNA sequence of the duck LYN gene), specific amplification primers are designed. The sequences of the specific amplification primers are as follows:

[0039] SEQ ID NO.3: Forward primer: CAAAAGTTCACAATACCGAG;

[0040] SEQ ID NO.4: Reverse primer: TGTTGCTACTGTCAGATGC.

[0041] The length of the amplifiable region of this primer is 484 bp, and the sequence is shown in SEQ ID NO.2, which contains a molecular marker of the T / C mutation at the C42476355T locus (the 323rd position in SEQ ID NO.2).

[0042] 2.2 Extraction of total blood DNA

[0043] A total of 459 Qiangying ducks were selected, and blood was collected from the wing vein. Total blood DNA was extracted using a blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. The extraction steps were carried out according to the kit instructions.

[0044] 2.3 PCR amplification

[0045] Using the Mix produced by Shanghai Yisheng Biotech Co., Ltd., the target fragment of the gene was subjected to PCR amplification reaction through the synthesized sequencing-specific primers LYN The PCR amplification system is shown in Table 1:

[0046] Table 1 PCR amplification system

[0047] ;

[0048] The PCR reaction conditions were as follows: pre-denaturation at 95 °C for 5 min; the first step, denaturation at 95 °C for 45 s; the second step, annealing at 64.8 °C for 45 s; the third step, extension at 72 °C for 30 s. Among them, the second step to the third step were cycled 31 times, for a total of 32 cycles; extension at 72 °C for 10 min.

[0049] 2.4 Detection and sequencing of PCR amplification products

[0050] The PCR amplification products were detected by 2% (mass ratio) agarose gel electrophoresis. As Figure 1 shown, after imaging with a gel imager, a band with an approximate length of 484 bp was obtained, which was consistent with the predicted length, indicating that the target fragment was obtained. The PCR products were sent to Beijing Qingke Biotech Co., Ltd. (Nanjing), and the sequence was as shown in SEQ ID NO.2, which was consistent with the predicted result.

[0051] 2.5 Genotyping

[0052] 2.5.1 Prepare the digestion system shown in Table 2. The digestion condition was a water bath at 37 °C for 1 hour, and the PCR amplification products were digested using the restriction endonuclease from Thermo Fisher Scientific Eam1105I Company.

[0053] Table 2 Digestion system

[0054] ;

[0055] 2.5.2 Detection was carried out using 1.5% (mass ratio) low-voltage agarose gel electrophoresis to obtain the results (partial results) as Figure 2 shown; among them, if the digestion product contains 1 band, it is the TT type; if it contains 2 bands, it is the CC type; if it contains 3 bands, it is the CT type.

[0056] 2.6 Enzyme digestion sequencing verification

[0057] The agarose gel electrophoresis maps of gene enzyme digestion typing were statistically analyzed to obtain three types: TT, CT, and CC. One individual was selected from each of these three types for sequencing alignment. The sequencing alignment map is as Figure 3 shown. In the sequencing results, T mutated to C, and the mutation position was marked by an arrow, which was consistent with the enzyme digestion typing results.

[0058] 2.7 Effect verification

[0059] To determine the association between the T / C polymorphism at the C42476355T locus of the duck LYN gene and important phenotypic traits of ducks, 459 Qiangying ducks in 2.2 were used as experimental materials, and the 1-day-old birth weight (BW1), 21-day-old body weight (BW 21 ), 42-day-old body weight (BW 42 ), average daily gain from 1 to 21 days of age (ADG 21 ), and average daily gain from 21 to 42 days of age (ADG 42 ) were statistically analyzed. Using the gene typing method in 2.5, 459 Qiangying ducks were genotyped. The results are shown in Table 3:

[0060] Table 3 Genotype detection results of individuals with different phenotypes

[0061] ;

[0062] Experimental conclusion: The chi-square test results showed that the genotypes of the experimental duck population were in Hardy-Weinberg equilibrium ( P >0.05).

[0063] 2.8 Statistical analysis

[0064] The least squares analysis method in SAS9.4 software was used to analyze the association between the three genotypes and duck body weight traits. The results of the association analysis between different genotypes and each trait are shown in Table 4:

[0065] Table 4 Association analysis between duck LYN genotype and duck body weight traits

[0066] ;

[0067] Note: Different lowercase letters in the same row indicate significant differences ( P <0.05), and different capital letters in the same row indicate extremely significant differences ( P <0.01).

[0068] Experimental conclusion: As can be seen from Table 4, for LYNFor the C42476355T locus of gene, the BW of CC genotype individuals 42 was significantly higher than that of CT genotype individuals ( P <0.05), and the ADG of CC genotype individuals 42 was extremely significantly higher than that of CT genotype individuals ( P <0.01). There were no significant differences among the three genotypes in BW1, BW 21 and ADG 21 . It shows that the mutated CC type grows faster in the later stage. Thus, it can be concluded that the body weight trait of CC genotype individuals is the best, that of CT genotype individuals is medium, and that of TT genotype individuals is poor.

[0069] The above is a detailed implementation method and specific operation process of the present invention, which is implemented on the premise of the technical solution of the present invention, but the protection scope of the present invention is not limited to the above embodiments.

Claims

1. An application of a molecular marker for identifying duck body weight traits based on LYN gene identification in identifying duck body weight traits, characterized in that The sequence of the molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2, and the duck breed is Qiangying duck; If the molecular marker type of the duck to be tested is TT type, the weight trait of this duck is poor; if the molecular marker type of the duck to be tested is CC type, the weight trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the weight trait of this duck is medium, and the weight trait is the weight at 42 days of age or the daily weight gain from 21 to 42 days of age.

2. A method for molecular marker identification of duck body weight traits based on LYN gene identification of duck body weight traits, characterized in that The duck breed is Qiangying duck, and the identification method includes the following steps: (1) Extract the total DNA of duck tissue organs or blood; (2) Use the duck genome database to find the polymorphic sites of the molecular marker. The sequence of the molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.

2. Using the nucleotide sequence composed of this site and its upstream and downstream bases as a template, design specific amplification primers and perform PCR amplification to obtain a PCR amplification product; (3) Perform genotyping detection on the PCR amplification product to obtain the molecular marker type of the duck to be tested; (4) Judge the weight trait of the duck according to the molecular marker type. If the molecular marker type of the duck to be tested is TT type, the weight trait of this duck is poor; if the molecular marker type of the duck to be tested is CC type, the weight trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the weight trait of this duck is medium, and the weight trait is the weight at 42 days of age or the daily weight gain from 21 to 42 days of age.

3. According to claim 2, a method for identifying duck body weight traits using molecular markers based on LYN gene identification of duck body weight traits, characterized in that The sequences of the specific amplification primers are: SEQ ID NO.3: Forward primer: CAAAAGTTCACAATACCGAG; SEQ ID NO.4: Reverse primer: TGTTGCTACTGTCAGATGC.

4. According to claim 2, a method for identifying the body weight trait of ducks based on LYN gene identification of the molecular marker for the body weight trait of ducks, characterized in that The genotyping detection method is Eam1105I Restriction endonuclease digestion of the PCR amplification product. If the digestion product contains 1 band, it is the TT type; if it contains 2 bands, it is the CC type; if it contains 3 bands, it is the CT type.

5. A method for identifying the body weight trait of ducks based on LYN gene identification of the body weight trait of ducks, characterized in that The duck breed is Qiangying duck, and the identification method includes the following steps: (1) Extract the RNA of duck tissue organs or blood and reverse transcribe it into cDNA; (2)Using ducks LYN Using the duck gene CDS sequence as a template, designing specific amplification primers and performing PCR amplification to obtain a PCR amplification product containing the polymorphic locus of the molecular marker, where the sequence of the molecular marker is as shown in SEQ ID NO.1 or SEQ ID NO.2; (3) Perform genotyping detection on the PCR amplification product to obtain the molecular marker type of the duck to be tested; (4) Judge the weight trait of the duck according to the molecular marker type. If the molecular marker type of the duck to be tested is TT type, the weight trait of this duck is poor; if the molecular marker type of the duck to be tested is CC type, the weight trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the weight trait of this duck is medium, and the weight trait is the weight at 42 days of age or the daily weight gain from 21 to 42 days of age.

6. According to any one of claims 2-5, a method for identifying duck body weight traits based on LYN molecular markers for identifying duck body weight traits by gene identification of duck body weight traits, characterized in that The duck tissue organ or blood is the wing vein blood of the duck.

Images