An engineered Saccharomyces cerevisiae strain dependent on an isoprenol utilization pathway, and its construction method and application

Abstract

The present invention belongs to the field of microbial metabolic engineering, and discloses an engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway, a construction method thereof and an application thereof. The engineered Saccharomyces cerevisiae strain has the following characteristics: the natural mevalonate pathway is inactivated, the 156th amino acid in the PRM10 gene is mutated from leucine to glutamine, and it contains the phosphokinase SmDAGK or its mutant, and the phosphokinase AtIPK or its mutant. The engineered Saccharomyces cerevisiae strain can efficiently express terpenoids synthesized by the isoprenol utilization pathway; compared with the strain directly introducing the isoprenol utilization pathway, the engineered Saccharomyces cerevisiae strain has higher substrate conversion rate and yield, providing a feasible strategy for the efficient synthesis of terpenoids by using an artificial pathway.

Description

Technical Field

[0001] The present invention belongs to the field of microbial metabolic engineering, and particularly relates to a Saccharomyces cerevisiae engineering bacterium dependent on an isoprenol utilization pathway, a construction method thereof, and an application thereof. Background Art

[0002] Terpenoids, also known as isoprenoids, are abundant natural compounds present in animals, plants, and microorganisms, and play a crucial role in maintaining normal biological activities. These compounds have a wide range of applications, including fragrances, biofuels, colorants, micronutrients, cosmetics, and drugs. However, traditional extraction methods are no longer sufficient to meet the growing market demand for terpenoids. Synthetic biology techniques enable the design and construction of microbial cell factories, providing sustainable and scalable solutions for the production of terpenoids.

[0003] The mevalonate pathway and the methylerythritol 4-phosphate pathway are two classical natural biosynthetic pathways of terpenoids. Currently, the synthesis of terpenoids is almost based on these two pathways, but one of the disadvantages is that the synthesis pathway is too long and requires the participation of multiple cofactors. Recently, the isoprenol utilization pathway (IUP) has become a potential alternative to natural biosynthetic pathways. The characteristic of IUP is that the inexpensive bulk chemical isoprenol is converted into the C5 precursors of terpenoids, isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP), through two-step phosphorylation, and ATP is the only cofactor.

[0004] IUP has been used to synthesize some terpenoids, such as lycopene, limonene, and taxadiene, etc., mainly using Escherichia coli as the host. However, Escherichia coli has inherent limitations in synthesizing complex natural compounds because their production usually requires the participation of glycoproteins, membrane proteins, and other elements; and Escherichia coli lacks a post-translational modification system, making it less effective in protein folding and modification. In contrast, Saccharomyces cerevisiae, as a widely used eukaryotic model organism, performs excellently in synthesizing natural products due to its clear genetic background and mature genetic manipulation tools. As one of the main production platforms for terpenoids, attempts have been made to introduce IUP into Saccharomyces cerevisiae, but the effect is not significant. This is because the substrate of IUP, isoprenol, is a non-natural substrate and belongs to short-chain alcohol, which destroys the cell mitochondrial membrane structure, resulting in a decrease in membrane potential, and ultimately leads to insufficient ATP synthesis and reduces the effect of the isoprenol utilization pathway. Summary of the Invention

[0005] The primary object of the present invention is to overcome the disadvantages and deficiencies of the prior art and provide a Saccharomyces cerevisiae engineering bacterium dependent on an isoprenol utilization pathway.

[0006] Another object of the present invention is to provide a method for constructing an engineered Saccharomyces cerevisiae strain dependent on the above-mentioned isoprenol utilization pathway.

[0007] Another object of the present invention is to provide the application of the engineered Saccharomyces cerevisiae strain dependent on the above-mentioned isoprenol utilization pathway.

[0008] The object of the present invention is achieved by the following technical solutions:

[0009] An engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway has the following characteristics: the native mevalonate pathway is inactivated, the 156th amino acid in the PRM10 gene is mutated from leucine to glutamine (PRM10 L156Q ), and contains the phosphokinase SmDAGK or its mutant, and the phosphokinase AtIPK or its mutant.

[0010] The mutant of the said SmDAGK is preferably SmDAGK S47A,L124A .

[0011] The said SmDAGK S47A,L124A refers to that the 47th amino acid of SmDAGK is mutated from serine to alanine, and the 124th amino acid is mutated from leucine to alanine.

[0012] The amino acid sequence of the said SmDAGK is shown as Genbank accession number AAA26867.1, which is 137 amino acids.

[0013] The mutant of the said AtIPK is preferably AtIPK S270P,A272R .

[0014] The said AtIPK S270P,A272R refers to that the 270th amino acid of AtIPK is mutated from serine to proline, and the 272nd amino acid is mutated from alanine to arginine.

[0015] The amino acid sequence of the said AtIPK is shown as Genbank accession number NP_173986.2, which is 332 amino acids.

[0016] The starting strain of the engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway is preferably a Saccharomyces cerevisiae strain of the CEN.PK series; more preferably Saccharomyces cerevisiae CEN.PK2-1C.

[0017] The method for constructing the above-mentioned engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway includes the following steps:

[0018] (1) Mutate the 156th amino acid in the PRM10 gene in the genome of the starting Saccharomyces cerevisiae strain from leucine to glutamine to obtain the PRM10 L156Q mutated Saccharomyces cerevisiae;

[0019] (2) Integrate the coding gene of phosphokinase SmDAGK or its mutant, and the coding gene of phosphokinase AtIPK or its mutant into PRM10 L156Q In the mevalonate pathway of the mutant Saccharomyces cerevisiae, inactivate the mevalonate pathway to obtain an engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway.

[0020] The starting strain described in step (1) is preferably Saccharomyces cerevisiae of the CEN.PK series; more preferably Saccharomyces cerevisiae CEN.PK2-1C.

[0021] The mutation method described in step (1) is preferably gene editing technology; more preferably Crispr-Cas9 gene editing technology.

[0022] The specific 20nt sequence of the sgRNA used in the mutation is preferably 5’-TCATTGGCATTAATCCTGCC-3’.

[0023] The sequence of the donor DNA used in the mutation is preferably as shown in SEQ ID NO.4.

[0024] The integration method described in step (2) is preferably gene editing technology; more preferably Crispr-Cas9 gene editing technology.

[0025] The donor fragment in the integration described in step (2) has the following structure A-B; wherein, A is a fragment obtained by constructing the upstream and downstream of the coding gene of phosphokinase SmDAGK or its mutant into a promoter and a terminator; B is a fragment obtained by constructing the upstream and downstream of the coding gene of phosphokinase AtIPK or its mutant into a promoter and a terminator.

[0026] The promoter in the said A is preferably the GPD promoter.

[0027] The terminator in the said A is preferably the CYC1 terminator.

[0028] The promoter in the said B is preferably the TEF1 promoter.

[0029] The terminator in the said B is preferably the ADH1 terminator.

[0030] The nucleic acid sequence of the donor DNA in the integration described in step (2) is preferably as shown in SEQ ID NO.3.

[0031] The inactivation of the mevalonate pathway described in step (2) is to cause the deletion or frameshift mutation of the key enzyme gene in the mevalonate pathway during integration.

[0032] The key enzyme described above is preferably ERG8, ERG12, ERG13 or HMG1 / 2.

[0033] The specific 20-nt sequence of the sgRNA in the integration described in step (2) is preferably 5'-GATTGGTTGACACATTGAGT-3'.

[0034] The engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway can only grow on a medium supplemented with isoprenol, isoprene or mevalonic acid. Therefore, the engineered Saccharomyces cerevisiae strain dependent on the isoprenol utilization pathway is more suitable for application in the synthesis of terpene precursors or terpene compounds.

[0035] The terpene compound described above is preferably squalene.

[0036] The present invention has the following advantages and effects compared with the prior art:

[0037] (1) The engineered strain provided by the present invention has a more suitable pathway expression. The strain dependent on the isoprenol utilization pathway has a more active energy metabolism, providing sufficient ATP for the conversion of isoprenol.

[0038] (2) The engineered strain provided by the present invention can efficiently utilize the substrate. The growth of the strain dependent on the isoprenol utilization pathway depends on the conversion of isoprenol, so it has a higher isoprenol conversion rate.

[0039] (3) The engineered strain provided by the present invention has a higher yield of terpene compounds. Compared with the strain not dependent on the isoprenol utilization pathway, it has a greater accumulation of squalene. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 is the schematic diagram of the principle of introducing PRM10 L156Q gene mutation in Saccharomyces cerevisiae.

[0041] Figure 2 is the schematic diagram of the pY26-SmDAGKM-AtIPKM plasmid.

[0042] Figure 3 is the schematic diagram of the pY26-SmDAGK-AtIPK plasmid.

[0043] Figure 4 is the efficiency comparison result diagram of wild-type SmDAGK and AtIPK and mutant SmDAGK S47A,L124A and S270P,A272R

[0044] Figure 5 is the genomic construction map of the strain dependent on the isoprenol utilization pathway.

[0045] ​Figure 6 It is a graph showing the comparison results of squalene accumulation between strains dependent on the isoprenol utilization pathway and strains not dependent on the isoprenol utilization pathway. Specific implementation manners

[0046] The present invention will be further described in detail below in conjunction with examples and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0047] For the Gibson assembly method, the specific operation is carried out in accordance with the instructions of the NEB Gibson Assembly Cloning kit (product number E2611, NEB).

[0048] Transformation of yeast strains: Unless otherwise specified, use the Frozen-EZ Yeast Transformation II TM kit (purchased from ZYMO RESEARCH Corporation, USA) for transformation according to the product instructions.

[0049] PCR amplification includes conventional denaturation, annealing, and extension steps; among them, the annealing temperature is based on the temperature recommended during primer design, generally 56°C, and the extension time of the fragment is determined according to the instructions of the enzyme used.

[0050] The composition of the uracil-deficient medium is as follows: yeast nitrogen source 1.7 g / L, ammonium sulfate 5 g / L, glucose 20 g / L, histidine 50 mg / L, leucine 50 mg / L, tryptophan 50 mg / L.

[0051] Determination of squalene accumulation: Take 0.2 mL of the fermentation broth and add it to a disruption tube containing 2 mL of glass beads with a diameter of 0.5 mm and 1 mL of ethyl acetate. Use a Bioprep-24R homogenizer to disrupt the cells, and then centrifuge at 10,000 g for 1 minute. The upper ethyl acetate layer is filtered through a 0.22 μm syringe filter for high-performance liquid chromatography analysis. Use an LC-16 (Shimadzu Corporation, Japan) equipped with an SPD-16 dual-wavelength ultraviolet detector, and use an Agilent Poroshell 120 EC-C18 2.1×100 mm chromatographic column. The eluent is 100% acetonitrile, the flow rate is 0.5 mL / min, the injection volume is 2 μL, and the detection wavelength of squalene is 210 nm.

[0052] The primers used in the present invention are shown in Table 1:

[0053] Table 1

[0054]

[0055] Example 1: Introduction of PRM10 into Saccharomyces cerevisiaeL156Q Gene mutation

[0056] Amplify pYZ463 (obtained from the addgene global plasmid sharing platform, Plasmid#187971, TEF1p-Cas9-CYC1t and SNR52p-Not1-SUP4t) using primers PRM10sg-F and PRM10sg-R, then transform through Escherichia coli DH5α, extract the plasmid and verify by sequencing. Finally, the Crispr-Cas9 plasmid with sgRNA DNA of TCATTGGCATTAATCCTGCC can be obtained, which is pYZ463-PRM10 and targets the PRM10 gene. Use primers PRM10-F and PRM10-R as templates for each other, and after amplification and purification, the PRM10 site donor DNA is obtained, and its sequence is as follows (also as shown in SEQ ID NO.4):

[0057] TGCAGTTACACAAGGCTCATTGGCATTAATCCAACCAGGTTATATTATTCTGTGTGGTGCACTAGAACTGCAAAGTCGAAGCTTAGTTGC。

[0058] Using the Frozen-EZ Yeast Transformation Kit, transform 1 μg of pYZ463-PRM10 plasmid and 100 ng of PRM10 site donor DNA into Saccharomyces cerevisiae CEN.PK2-1C to complete the PRM10 L156Q gene mutation, and the obtained strain is named IUP0( Figure 1 ).

[0059] Example 2: Construction of a plasmid for an efficient isoprenol utilization pathway

[0060] Synthesize the SmDAGK gene with the nucleotide sequence as shown in SEQ ID NO.1 and the AtIPK gene with the nucleotide sequence as shown in SEQ ID NO.2 by the company. Amplify the two genes using primers SmDAGK-F / SmDAGK-R and AtIPK-F / AtIPK-R respectively to obtain the SmDAGK S47A,L124A gene fragment and the AtIPK S270P,A272R gene fragment. Using the pY26-GPD-TEF (also named pY26TEF-GPD) plasmid (obtained from the BioVector NTCC plasmid vector strain cell gene preservation center) as a template, amplify the two promoters using the primer pair TEF_GPD-F / TEF_GPD-R to obtain P S47A,L124A -P S270P,A272R -P TEF -P GPDFragment; The plasmid backbone was amplified using the pY26-F / pY26-R primer pair to obtain the pY26 framework. After recovering the product, the SmDAGK S47A,L124A gene fragment, AtIPK S270P,A272R gene fragment, P TEF -P GPD fragment and the PY26 framework were used to construct a plasmid, obtaining pY26-T CYC1 -SmDAGK S47A,L124A -P GPD -P TEF1 -AtIPK S270P,A272R -T ADH1 (abbreviated as pY26-SmDAGKM-AtIPKM) plasmid, as Figure 2 shown.

[0061] Example 3: Comparison of the efficiency between the wild-type and mutant of phosphokinase

[0062] The wild-type SmDAGK gene with the nucleotide sequence as shown in SEQ ID NO.5 and the wild-type AtIPK gene with the nucleotide sequence as shown in SEQ ID NO.6 were synthesized by the company. Using the same primers and methods as in Example 2, pY26-T CYC1 -SmDAGK-P GPD -P TEF1 -AtIPK-T ADH1 (abbreviated as pY26-SmDAGK-AtIPK) plasmid, as Figure 3 shown. The plasmid transformation was carried out using the Frozen-EZ Yeast Transformation Kit. The pY26-SmDAGK-AtIPK and pY26-SmDAGKM-AtIPKM plasmids were respectively transformed into yeast IUP0 for expression. After culturing in a 48-well plate at 220 rpm and 30 °C for 4 days (the medium was YPD containing 5 g / L isopentenol). By measuring the content of squalene to compare the activity of the mutants, it was found that the efficiency of the mutants was 1.5 times higher than that of the wild-type (as Figure 4 shown).

[0063] Example 4: Preparation of DNA for replacing the mevalonate pathway with the isopentenol utilization pathway

[0064] The pYZ463 plasmid was amplified using the ERG13sg-F and ERG13sg-R primers, and then through Escherichia coli transformation, plasmid extraction and sequencing verification, finally, the Crispr-Cas9 plasmid with sgRNA DNA of GATTGGTTGACACATTGAGT, which was pYZ463-ERG13, was obtained. It targeted the ERG13 gene. Using the IUP-F / IUP-R primer pair, with pY26-TCYC1 -SmDAGK S47A ,L124A -P GPD -P TEF1 -AtIPK S270P,A272R -T ADH1 Using the plasmid as a template for PCR amplification, the purified DNA is T CYC1 -SmDAGK S47A,L124A -P GPD -P TEF1 -AtIPK S270P,A272R -T ADH1 (Its nucleotide sequence is shown in SEQ ID NO.3), and it is the donor DNA at the ERG13 locus. Under the action of ERG13 sgRNA, the fragment shown in SEQ ID NO.3 will replace the 135th to 225th bases of the ERG13 gene.

[0065] Example 5: Replacement of the mevalonate pathway with the isoprenol utilization pathway

[0066] Using the Frozen-EZ Yeast Transformation Kit, 1 μg of pYZ463-ERG13 plasmid and 1 μg of the Donor DNA at the ERG13 locus were transformed into the IUP0 strain, and then spread on any one of the following three selective plates: uracil-deficient medium agar plates supplemented with 2 g / L prenol, uracil-deficient medium agar plates supplemented with 2 g / L isoprenol, and uracil-deficient medium agar plates supplemented with 5 mM mevalonate. After culturing in a 30 °C incubator for four days, 16 single colonies were selected and colony PCR was performed using the IUP-CP-F / IUP-CP-R primer pair. The positive colonies were transferred to YPD plates. If they could not grow, it was proved that the isoprenol utilization pathway had successfully replaced the mevalonate pathway (as Figure 5 shown), and the resulting strain was an isoprenol utilization pathway-dependent strain, named IUP2.

[0067] Example 6: Superiority of isoprenol utilization pathway-dependent Saccharomyces cerevisiae in synthesizing terpenoids

[0068] Amplify pYZ463 using the primers X-1sg-F and X-1sg-R, then transform through Escherichia coli DH5α, extract the plasmid and verify by sequencing. Finally, a Crispr-Cas9 plasmid with GACACATTAGTCTCGTATGT as the sgRNA can be obtained, which is pYZ463-X-1. Use X-1-F and X-1-R as primer pairs to amplify pY26-T CYC1 -SmDAGKS47A,L124A -P GPD -P TEF1 -AtIPK S270P,A272R -T ADH1 , the Donor DNA at the X-1 site is obtained. 1 μg of the pYZ463-X-1 plasmid and 1 μg of the Donor DNA at the X-1 site are transformed into the IUP0 strain, spread on a uracil-deficient agar plate, and cultured for four days. PCR verification is performed using the X-1-CP-F / X-1-CP-R primer pair, and the obtained strain belongs to a non-prenol utilization pathway-dependent strain, named MVA-IUP1. MVA-IUP1 can grow on YPD medium.

[0069] The non-prenol utilization pathway-dependent strain MVA-IUP1 and the prenol utilization pathway-dependent strain IUP2 are respectively cultured in YPD medium supplemented with 5 g / L prenol at 220 rpm and 30 °C for 4 days, and then the squalene accumulation is measured. It is found that the squalene accumulation of the prenol utilization pathway-dependent strain is 5 times that of the non-prenol utilization pathway-dependent strain, as Figure 6 shown.

[0070] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An engineered strain of Saccharomyces cerevisiae that is prenol-utilizing pathway-dependent, characterized in that: The isopentenol utilization pathway-dependent Saccharomyces cerevisiae engineered bacteria has the following characteristics: the natural mevalonate pathway is inactivated, the 156th amino acid in the PRM10 gene is mutated from leucine to glutamine, and contains phosphokinase SmDAGK or its mutant, and phosphokinase AtIPK or its mutant; The inactivation of the mevalonate pathway is to delete the ERG13 gene in the mevalonate pathway or generate a frameshift mutation by gene editing technology; The mutant of SmDAGK is SmDAGK S47A, L124A ; The mutant of AtIPK is AtIPK S270P, A272R ; The starting strain of the wine yeast engineering bacteria is the CEN.PK series of wine yeast.

2. The method for constructing the isopentenol utilization pathway-dependent Saccharomyces cerevisiae engineered bacteria according to claim 1, characterized in that The steps include: (1) The amino acid 156 of the PRM10 gene in the genome of the starting strain of Saccharomyces cerevisiae was mutated from leucine to glutamine to obtain PRM10 L156Q mutant Saccharomyces cerevisiae; (2) Integrate the gene encoding the phosphokinase SmDAGK or its mutant, and the gene encoding the phosphokinase AtIPK or its mutant into PRM10 L156Q In the mutated mevalonate pathway of Saccharomyces cerevisiae, the mevalonate pathway is inactivated, and an engineered Saccharomyces cerevisiae strain dependent on the isopentenol utilization pathway is obtained; The integration method described in step (2) is gene editing technology; Inactivating the mevalonate pathway in step (2) is to cause a key enzyme gene in the mevalonate pathway to be deleted or to generate a frameshift mutation during integration; The key enzyme is ERG13.

3. The method for constructing an engineered strain of Saccharomyces cerevisiae that is prenol utilization pathway-dependent according to claim 2, characterized in that: The mutation method described in step (1) is gene editing technology.

4. The method for constructing an engineered strain of Saccharomyces cerevisiae that is prenol utilization pathway-dependent according to claim 3, characterized in that: The specific 20nt sequence of the sgRNA used in the mutation is TCATTGGCATTAATCCTGCC; The donor fragment in the integration has the following structure AB; wherein A is a fragment obtained by constructing the upstream and downstream of the coding gene of the phosphokinase SmDAGK or its mutant into the promoter and terminator; B is a fragment obtained by constructing the upstream and downstream of the coding gene of the phosphokinase AtIPK or its mutant into the promoter and terminator.

5. The method for constructing an engineered strain of Saccharomyces cerevisiae that is prenol utilization pathway-dependent according to claim 4, characterized in that: The promoter in A is the GPD promoter; The promoter in B is TEF1 promoter.

6. The method for constructing an engineered strain of Saccharomyces cerevisiae that is prenol utilization pathway-dependent according to claim 5, characterized in that: The nucleic acid sequence of the donor DNA being integrated in step (2) is shown in SEQ ID NO. 3; The specific 20 nt sequence of the sgRNA being integrated in step (2) is GATTGGTTGACACATTGAGT.

7. Use of the prenol utilization pathway-dependent Saccharomyces cerevisiae engineered bacteria according to claim 1 in the synthesis of terpenoid precursors or terpenoid compounds.

8. The use according to claim 7, characterized in that: The terpene compound is squalene.

Images