A method for screening nuclear genes of the receptor for retrograde regulation of mitochondrial sterility genes responsive to rapeseed cytoplasmic male sterility

Abstract

The present invention discloses a method for screening nuclear genes that are retroregulated by mitochondrial sterility genes responsive to rapeseed cytoplasmic male sterility. The method includes: cloning the mitochondrial sterility gene of rapeseed cytoplasmic male sterility pollen abortion; constructing a plant expression vector of the mitochondrial sterility gene and genetically transforming Arabidopsis thaliana; obtaining differentially expressed genes (DEGs); calculating the co-expression relationship between genes to obtain the expression regulation relationship and regulation direction between genes, thereby constructing a co-expression network diagram of genes; selecting candidate nuclear genes to construct double mutant homozygous Arabidopsis thaliana mutants; and identifying nuclear genes that can restore the pollen fertility of the mutants. The present invention solves the problem that existing methods cannot accurately identify nuclear genes involved in the nuclear-cytoplasmic interaction of mitochondrial sterility genes. By constructing double mutant mutants and observing pollen fertility, the present invention can efficiently find nuclear genes that are retroregulated by mitochondrial genes jointly regulated by mitochondrial sterility gene expression and involved in pollen abortion.

Description

Technical Field

[0001] The present invention relates to a method for screening retrograde regulatory receptor nuclear genes, and particularly to a method for screening receptor nuclear genes that respond to the retrograde regulation of mitochondrial sterility genes in rapeseed cytoplasmic male sterility. Background Art

[0002] Rapeseed cytoplasmic male sterility is a result of nuclear-cytoplasmic interaction. At present, the research on mitochondrial genes of cytoplasmic male sterility mainly focuses on gene functions, and there is a lack of effective methods to identify nuclear genes involved in nuclear-cytoplasmic interaction. Although the existing literature 1 (Luo D, Xu H, Liu Z, et al. A detrimental mitochondrial-nuclear interaction causes cytoplasmic male sterility in rice [J]. Nature Genetics, 2013, 45(5): 573-577) and literature 2 (Xiao S, Zang J, Pei Y, et al. Activation of mitochondrial orf355 gene expression by a nuclear-encoded DREB transcription factor causes cytoplasmic male sterility in maize [J]. Molecular Plant, 2020, 13(9): 1270-1283) can screen nuclear genes that interact with mitochondrial sterility genes through the yeast two-hybrid method, this method has a too high false positive rate, and many interacting genes are not genes that participate in the co-regulation of pollen fertility by mitochondrial genes in nuclear-cytoplasmic interaction. Therefore, there is an urgent need to establish a method for screening receptor nuclear genes that respond to the retrograde regulation of mitochondrial sterility genes in rapeseed cytoplasmic male sterility, which can directly find the mitochondrial sterility genes and receptor nuclear genes that jointly act on pollen fertility. Summary of the Invention

[0003] The object of the present invention is to provide a method for screening receptor nuclear genes that respond to the retrograde regulation of mitochondrial sterility genes in rapeseed cytoplasmic male sterility, which solves the problem that the existing method cannot accurately identify nuclear genes involved in nuclear-cytoplasmic interaction of mitochondrial sterility genes, and can directly find the mitochondrial sterility genes and receptor nuclear genes that jointly act on pollen fertility.

[0004] To achieve the above object, the present invention provides a method for screening receptor nuclear genes that respond to the retrograde regulation of mitochondrial sterility genes in rapeseed cytoplasmic male sterility, the method comprising:

[0005] (1) Clone the mitochondrial gene sterility gene responsible for pollen abortion in cytoplasmic male sterility of rapeseed;

[0006] (2) Construct a plant expression vector for the mitochondrial gene sterility gene and genetically transform Arabidopsis thaliana;

[0007] (3) Take the transcriptome sequencing of the pollen abortion inflorescence of transgenic Arabidopsis thaliana to obtain differentially expressed genes (DEGs);

[0008] (4) According to the dynamic changes of the differential gene expression levels (FPKM), calculate the co-expression relationship between genes, obtain the expression regulation relationship and regulation direction between genes, and thus construct a co-expression network diagram of genes;

[0009] (5) According to the significance analysis of gene expression, select candidate nuclear genes to construct Arabidopsis thaliana mutants homozygous for the double mutation of MTgene / nucleargene; the MTgene is the mitochondrial sterility gene, and the nucleargene is the nuclear gene;

[0010] (6) According to the pollen abortion function of the mitochondrial gene, identify the nuclear genes that can restore the pollen fertility of the MTgene / nucleargene mutant.

[0011] Preferably, in step (1), the cloning specifically includes the following content:

[0012] Extract RNA from the flower buds of the rapeseed wild oil cytoplasmic male sterile line 1258A and reverse transcribe it into cDNA; use the reverse transcribed cDNA as a template, and perform PCR amplification with the upstream primer with the nucleotide sequence shown in SEQ ID NO.1 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.2; after detecting the target band by 1% agarose gel electrophoresis, cut the gel and recover it, and connect it with the vector, transform Escherichia coli DH5α by heat shock method, and after sequencing, preserve the positive strain containing the orf113b gene. The nucleotide sequence of the orf113b gene is shown in SEQ ID NO.3.

[0013] More preferably, the PCR reaction system for the PCR amplification: 1 μL of template, 2 μL of 2.5 mmol / L dNTP, 2 μL of 10×Reaction Buffer, 1 μL of primer Fw, 1 μL of primer Rv, 0.5 μL of HiFi high-fidelity DNA polymerase, 12.5 μL of ddH2O; the PCR reaction program for the PCR amplification: 94°C, 3 min; 94°C, 45 s; 55°C, 45 s, 72°C, 90 s; 35 cycles; 72°C, 10 min.

[0014] Preferably, in step (2), the specific process is as follows:

[0015] Using the plant expression vector PC2300 vector driven by the AP3 anther-specific promoter and containing the sequence shown in SEQ ID NO.4, a specific expression vector with a HindIII restriction site at the 5' end and a BamHI restriction site at the 3' end of the target fragment was constructed; using the overexpression vector PC1300S driven by the CaMV35S constitutive promoter, a plant overexpression vector with SacI and BamHI restriction sites at both ends of the mitochondrial sterility gene fragment was constructed.

[0016] The specific expression vector and the plant overexpression vector were transferred into Arabidopsis thaliana by the floral dip method to obtain transgenic lines.

[0017] Preferably, in step (3), the specific process is as follows:

[0018] The pollen abortion inflorescences of the transgenic lines were first frozen in liquid nitrogen and then stored at 80 °C; RNA of the stored inflorescences was extracted using the TRIzol method, and the RNA purity and integrity were detected. A library was constructed using a kit (NEB Next Ultra RNA LibraryPrep Kit); after the library quality inspection was completed, sequencing was performed based on the Illumina high-throughput sequencing platform (HiSeq2000). The screening conditions for differentially expressed genes (DEGs) were |log2(FoldChange)|≥1 and q<0.05.

[0019] Preferably, in step (4), the specific process is as follows:

[0020] Through R language analysis, the co-expression relationship was obtained by calculating the gene correlation coefficient and p-value using the expression levels (FPKM) of differential genes and the Pearson model; a co-expression network diagram was made using Cytoscape software, and the node genes of the co-expression network diagram were abnormally expressed nuclear genes affected by mitochondrial retrograde signals.

[0021] According to the method described in claim 6, the screening criteria are that the absolute value of the correlation coefficient is greater than 0.99, the p-value is less than 0.05, and the number of samples in each group is at least 3.

[0022] Preferably, in step (5), the specific process is as follows:

[0023] Candidate genes were identified by searching the BnTIR (https: / / yanglab.hzau.edu.cn / BnTIR) database and excluding known genes unrelated to pollen development. An Arabidopsis thaliana with a mitochondrial sterility gene was used as the female parent, and an Arabidopsis thaliana deletion mutant was used as the male parent for hybridization, followed by backcrossing to obtain a homozygous mutant of MT gene / nuclear gene (mitochondrial sterility gene / nuclear gene).

[0024] Preferably, in step (6), the identification includes: bagging and selfing the MT gene / nuclear gene (mitochondrial sterility gene / nuclear gene) mutant and observing the selfing seed setting situation.

[0025] More preferably, the pollen fertility of the MT gene / nuclear gene (mitochondrial sterility gene / nuclear gene) mutant is restored. The nuclear gene of this MT gene / nuclear gene is a receptor gene that can respond to the mitochondrial retrograde signal triggered by the pollen sterile mitochondrial gene and regulates cytoplasmic male sterility through "nucleus-cytoplasm" interaction.

[0026] A method for screening nuclear genes that respond to mitochondrial sterility gene retrograde regulation in rapeseed cytoplasmic male sterility of the present invention solves the problem that existing methods cannot accurately identify nuclear genes with nucleus-cytoplasm interaction of mitochondrial sterility genes and has the following advantages:

[0027] 1. In the present invention, transgenic lines of mitochondrial sterility genes were constructed in Arabidopsis thaliana, and through transcriptome sequencing and gene co-expression network construction, nuclear genes affected by the expression of mitochondrial sterility genes were quickly screened out.

[0028] 2. By constructing mutants with double mutations of MT gene / nuclear gene (mitochondrial sterility gene / nuclear gene) and observing pollen fertility in the present invention, receptor nuclear genes that act together with mitochondrial sterility gene retrograde regulation on pollen abortion were identified.

[0029] 3. Using the method of the present invention, nuclear genes that are retrograde regulated by mitochondrial genes and are co-regulated by the expression of mitochondrial sterility genes on pollen abortion can be directly and efficiently found. Description of the Drawings

[0030] Figure 1 It is a phenotypic identification diagram of an Arabidopsis thaliana plant with the mitochondrial sterility gene orf113b transferred in the present invention.

[0031] Figure 2 It is a gene co-expression network and nuclear gene clustering analysis diagram of the present invention.

[0032] Figure 3This is the identification diagram of the fertility restoration phenotype of the Arabidopsis thaliana orf113b / sks14 strain of the present invention. Detailed implementation manners

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0034] Example 1

[0035] A method for screening nuclear genes of a receptor for retrograde regulation of mitochondrial sterility genes responsive to cytoplasmic male sterility in rapeseed, the method comprising:

[0036] 1. Cloning of the mitochondrial gene orf113b for pollen abortion of rapeseed cytoplasmic male sterility

[0037] (1) Extract RNA from the flower buds of Brassica napus var. oleifera CMS (1258A), and reverse transcribe it into cDNA;

[0038] (2) Using the reverse-transcribed cDNA as a template, amplify with primers orf113b-Fw and orf113b-Rv. The PCR reaction system: 1 μL of template, 2 μL of 2.5 mmol / L dNTP, 2 μL of 10×Reaction Buffer, 1 μL of primer orf113b-Fw, 1 μL of primer orf113b-Rv, 0.5 μL of HiFi high-fidelity DNA polymerase, 12.5 μL of ddH2O. The PCR reaction program: 94 °C, 3 min; 94 °C, 45 s; 55 °C, 45 s, 72 °C, 90 s; 35 cycles; 72 °C, 10 min. After detecting the target band by 1% agarose gel electrophoresis, cut the gel and recover it, and ligate it with the vector, and transform Escherichia coli DH5α by heat shock method. After sequencing, preserve the positive strain containing the orf113b gene (the nucleotide sequence of the orf113b gene is shown in SEQ ID NO.3).

[0039] Among them, the nucleotide sequence of primer orf113b-Fw is shown in SEQ ID NO.1:

[0040] ATGAACGATGCACAGAGTCATACC;

[0041] The nucleotide sequence of orf113b-Rv is shown in SEQ ID NO.2:

[0042] TTAGTTTAGTGACAGCTCATCAAA.

[0043] 2. Construct a plant expression vector for mitochondrial gene orf113b and genetically transform Arabidopsis thaliana

[0044] (1) Use the plant expression vector PC2300 vector driven by the AP3 anther-specific promoter and containing a mitochondrial targeting sequence (MTS, the first 1 - 165 bp sequence before the restorer gene Rfo (Genbank Accession: LOC108827691) of Ogu CMS in rapeseed, as shown in SEQ ID NO.4) to construct a specific expression vector AP3::MTS:orf113b with HindIII (5' end) and BamHI (3' end) restriction enzyme sites at both ends of the target fragment.

[0045] The nucleotide sequence of the restriction enzyme HindIII is AAGCTT; the nucleotide sequence of the BamHI enzyme is 5'-GGATCC-3'.

[0046] (2) Use the overexpression vector PC1300S driven by the CaMV35S constitutive promoter to construct a plant expression vector 35S::orf113b with SacI and BamHI restriction enzyme sites at both ends of the target fragment.

[0047] (3) Use the floral dip method of Arabidopsis thaliana to transfer the AP3::MTS:orf113b and 35S::orf113b genes into Arabidopsis thaliana to obtain transgenic lines.

[0048] As Figure 1 shown, the phenotypic identification diagram of Arabidopsis thaliana plants transfected with the mitochondrial sterility gene orf113b of the present invention, where A - D are the phenotypic observations of the stamens, anthers, siliques, and pollen of wild-type Arabidopsis thaliana; E - H are the phenotypic observations of the stamens, anthers, siliques, and pollen of Arabidopsis thaliana transfected with the AP3::MTS:orf113b vector; I - L are the phenotypic observations of the stamens, anthers, siliques, and pollen of Arabidopsis thaliana transfected with the 35S::orf113b vector. It can be Figure 1 seen that wild-type Arabidopsis thaliana (WT) has a normal "tetradynamous stamen" structure, the anther surface is covered with oval pollen grains, and the siliques develop normally. However, the anthers of orf113b transgenic Arabidopsis thaliana are fleshy, shriveled, produce no pollen grains, the filaments of the stamens become shorter and vary in length, and the pistils cannot be pollinated and further develop.

[0049] 3. Take the inflorescence transcriptome sequencing according to the pollen abortion phenotype of the transgenic orf113b plants to obtain differentially expressed genes (DEGs)

[0050] (1) Take the pollen abortion inflorescences of the transgenic lines, first quickly freeze them in liquid nitrogen, and store them in an 80°C refrigerator for testing, with 3 independent biological replicates for each treatment.

[0051] (2) The RNA of Arabidopsis inflorescence was extracted using the TRIzol method, and the RNA purity and integrity were detected. A library was constructed using a kit (NEB Next Ultra RNA Library Prep Kit).

[0052] (3) After the library quality inspection was completed, sequencing was performed based on the Illumina high-throughput sequencing platform (HiSeq2000). The screening criteria for differentially expressed genes (DEGs) were |log2(Fold Change)| ≥ 1 and q < 0.05.

[0053] 4. Construct a gene co-expression network diagram. The node genes of the co-expression network diagram are abnormally expressed nuclear genes affected by mitochondrial retrograde signals.

[0054] (1) Using the R language analysis software, the correlation coefficient and Pvalue between genes were calculated using the expression levels (FPKM) of differential genes and the Pearson model to obtain co-expression relationships. The screening criteria were that the absolute value of the correlation coefficient was greater than 0.99, the p-value was less than 0.05, and the number of samples in each group was at least 3.

[0055] (2) Use Cytoscape software to create a co-expression network diagram. All nodes are genes. Red lines represent positive correlations. The larger the node, the more nodes it is connected to (such as Figure 2 A).

[0056] 5. Select candidate nuclear genes to construct Arabidopsis mutants homozygous for orf113b / nuclear gene double mutants.

[0057] (1) Based on the results of the significance analysis of gene expression levels in two transgenic lines of vectors, the genes with significantly higher expression levels than the control in each line are the candidate genes most likely to respond to the expression of the orf113b gene (such as Figure 2 B).

[0058] (2) Search for the functional annotations of candidate genes through the BnTIR (https: / / yanglab.hzau.edu.cn / BnTIR) database. Exclude known genes unrelated to pollen development based on the functional gene annotations. The remaining genes are candidate genes, with a focus on genes with larger nodes. The serial numbers of the screened candidate genes are AT5G50030, AT1G01980, AT1G55560, AT1G58120, AT5G18910, AT1G04470, AT3G02810, AT4G36490, AT3G09530, and AT5G50830. The above gene sequences can be searched through the BnTIR database.

[0059] (3) Using the completely sterile Arabidopsis thaliana in orf113b as the female parent and the Arabidopsis thaliana deletion mutant purchased from AraShare Technology Service Center (www.arashare.cn) as the male parent, cross them with the completely sterile Arabidopsis thaliana in orf113b, and after backcrossing, obtain the orf113b / nuclear gene double mutant homozygous mutant plants of 10 candidate genes.

[0060] As Figure 2 shown, the gene co-expression network and nuclear gene clustering analysis diagram of the present invention, where A is the gene co-expression network diagram; B is the co-expression nuclear gene clustering analysis of transgenic lines (logFC < 0.5), significance level: *p < 0.05, **p < 0.01. From Figure 2 A of, the nodes represent genes, the larger the node, the more nodes it is connected to, and the red lines represent positive correlations; from Figure 2 B of, the expression levels of the node genes in the transgenic lines are significantly higher than those of the wild type. The genes with extremely significantly higher expression levels than the wild type in both vectors are most likely the receptor genes responding to the expression of the orf113b gene.

[0061] 6. Identification of pollen fertility of orf113b / nuclear gene mutants

[0062] (1) Take the flower organs of different orf113b / nuclear gene mutants, observe whether there is pollen production under a microscope, and stain the pollen viability with acetic carmine for observation.

[0063] (2) Bag the orf113b / nuclear gene mutants for self-pollination and observe the self-pollination and fruiting situation.

[0064] (3) If the pollen fertility of the orf113b / nuclear gene mutants is restored, it indicates that this nuclear gene is the receptor nuclear gene retrograde regulated by the mitochondrial sterile gene orf113b, jointly regulating pollen fertility. Finally, it is identified that the gene AT1G55560 (AtSKS14) is the receptor nuclear gene retrograde regulated by the mitochondrial sterile gene orf113b, and the mutant line orf113b / sks14 of this gene shows a fertility restoration situation.

[0065] As Figure 3 shown, the fertility restoration phenotype identification diagram of the Arabidopsis thaliana orf113b / sks14 line of the present invention, where A is the observation of the anther morphology of the sks14 mutant; B is the observation of the anther morphology of the orf113b / sks14 homozygous mutant; C is the pollen staining of the sks14 mutant; D is the pollen staining of the orf113b / sks14 homozygous mutant; E is the observation of self-pollination and fruiting of the orf113b / sks14 homozygous mutant. From Figure 3It can be seen that the fertility of orf113b / sks14 has been partially restored, and it can produce pollen. Through self-crossing, siliques can develop and form seeds. The mutation of the AtSKS14 gene blocks the interaction with the sterile gene orf113b, restoring pollen fertility, indicating that pollen abortion caused by the expression of the orf113b gene is co-regulated with the nucleo-cytoplasmic interaction of SKS14 in pollen development.

[0066] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be recognized that the above description should not be construed as a limitation of the present invention. After those skilled in the art have read the above content, various modifications and alternatives to the present invention will be obvious. Therefore, the protection scope of the present invention should be defined by the appended claims.

Claims

1. A method for screening a nuclear gene of a mitochondrial sterility gene retrogradely regulated receptor in response to cytoplasmic male sterility in rapeseed, the method comprising: (1) Cloning of the mitochondrial gene sterility gene of pollen abortion in the cytoplasmic male sterile line of Brassica napus orf113b ; (2) Construction of mitochondrial gene sterility gene orf113b Plant expression vectors were used to genetically transform Arabidopsis thaliana; (3) Transcriptome sequencing of pollen-aborted inflorescences of transgenic Arabidopsis was performed to obtain differentially expressed gene DEGs; (4) According to the dynamic changes of differential gene expression, the co-expression relationship between genes is calculated to obtain the expression regulation relationship and regulation direction between genes, thereby constructing a gene co-expression network diagram; the specific process is as follows: The co-expression relationship was obtained by analyzing the differential gene expression and Pearson model, and the correlation coefficient and p-value between genes were calculated. The co-expression network diagram was made using Cytoscape software, and the node genes of the co-expression network diagram were abnormally expressed nuclear genes affected by mitochondrial retrograde signals. (5) Based on the significance analysis of gene expression, candidate nuclear genes are selected to construct MT gene / nuclear gene Double homozygous Arabidopsis mutants; Said MT gene is a mitochondrial sterility gene, The nuclear gene is Nuclear genes; (6) Based on the function of mitochondrial gene in pollen abortion, identify genes that can restore pollen abortion MT gene / nuclear gene Nuclear genes for pollen fertility in mutants; Said orf113b The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. According to the method of claim 1, in step (1), the cloning specifically comprises the following contents: RNA was extracted from the flower buds of the cytoplasmic male sterile line 1258A of rapeseed oil, and reverse transcribed into cDNA; the reverse transcribed cDNA was used as a template, and PCR amplification was performed using the upstream primer with the nucleotide sequence shown in SEQ ID NO.1 and the downstream primer with the nucleotide sequence shown in SEQ ID NO.2; the target band was detected by 1% agarose gel electrophoresis, and then the gel was cut and recovered, connected to the pEASY®-T5 vector, and transformed into Escherichia coli DH5α by heat shock method, and the fragment containing the target band was preserved after sequencing. orf113b gene-positive strains.

3. According to the method of claim 2, the PCR reaction system of the PCR amplification: template 1μL, 2.5mmol / L dNTP2μL, 10×Reaction Buffer 2μL, primer Fw 1μL, primer Rv 1μL, HiFi high-fidelity DNA polymerase 0.5μL, ddH2O 12.5μL; the PCR reaction program of the PCR amplification: 94℃, 3min; 94℃, 45s; 55℃, 45s, 72℃, 90s; 35 cycles; 72℃, 10min.

4. According to the method of claim 1, in step (2), the specific process is as follows: The plant expression vector PC2300 containing the sequence shown in SEQ ID NO. 4 driven by AP3 anther-specific promoter was used to construct the target fragment containing Hind III restriction site, contains at the 3' end Bm I restriction site-specific expression vector; using CaMV35S The constitutive promoter-driven overexpression vector PC1300S was constructed to construct a mitochondrial sterility gene fragment with two ends containing SacI and B H Plant overexpression vectors with restriction sites; The specific expression vector and the plant overexpression vector are transferred into Arabidopsis thaliana by using the Arabidopsis inflorescence infection method to obtain a transgenic strain.

5. According to the method of claim 1, in step (3), the specific process is as follows: The pollen aborted inflorescences of the transgenic lines were first frozen with liquid nitrogen and then stored at -80°C. The RNA of the preserved inflorescences was extracted using the TRIzol method, and the RNA purity and integrity were tested to construct a library. After the library quality inspection was completed, sequencing was performed based on the Illumina high-throughput sequencing platform, and the screening conditions for the differentially expressed genes were |log2 (Fold Change) |≥1 and q<0.

05.

6. The method according to claim 1, wherein the screening criteria are that the absolute value of the correlation coefficient is greater than 0.99, the p value is less than 0.05, and the number of samples in each group is at least 3.

7. According to the method of claim 1, in step (5), the specific process is as follows: The node genes were searched through the BnTIR database, and the known genes irrelevant to pollen development were excluded. The remaining genes were candidate genes. The Arabidopsis thaliana with the mitochondrial sterility gene was used as the female parent and the Arabidopsis thaliana deletion mutant was used as the male parent for hybridization and backcrossing. MT gene / nuclear gene Double homozygous mutant.

8. The method according to claim 1, in step (6), the identification comprises: MT gene / nuclear gene The mutants were bagged and self-pollinated to observe their self-fertilization results.

9. The method according to claim 8, wherein MT gene / nuclear gene The pollen fertility of the mutant was restored. MT gene / nuclear gene The nuclear gene is a mitochondrial retrograde signal receptor gene that can respond to the pollen sterility mitochondrial gene, and regulates cytoplasmic male sterility through "nuclear-cytoplasmic" interaction.

Images