A method for constructing a humanized pig model of type II collagen and its application

Abstract

This invention relates to a method for constructing a humanized pig model of type II collagen and its application, belonging to the field of gene modification technology. The invention first provides a CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 gene. Using CRISPR / Cas9-mediated homologous recombination, the porcine COL2A1 gene is orally replaced with the human COL2A1 gene. Then, using somatic cell cloning technology, a humanized pig model of type II collagen is constructed, allowing the pig to produce cartilage tissue more similar to that of humans, reducing post-transplant immune rejection. This is expected to fundamentally solve the problem of human cartilage tissue shortage and has significant implications for the treatment of articular cartilage damage, providing a better and more suitable transplant material for the treatment of articular cartilage damage.

Description

Technical Field

[0001] This invention relates to the field of gene modification technology, and in particular to a method for constructing a humanized pig model of type II collagen and its application. Background Technology

[0002] Osteoarthritis (OA) is the most common chronic joint disease worldwide, affecting an estimated 240 million people globally. Osteoarthritis primarily affects middle-aged and elderly individuals, often causing joint pain, stiffness, and even disability, severely impacting patients' quality of life. With the aging global population and increasing obesity rates, this problem will be further exacerbated, placing a greater burden on social healthcare. The onset of osteoarthritis is closely related to multiple risk factors, including aging, obesity, estrogen deficiency, trauma, and genetic predisposition. Its pathological changes mainly include cartilage destruction, subchondral bone sclerosis, osteophyte formation, and synovial inflammation. Osteoarthritis is one of the leading causes of cartilage damage. Patients with severe cartilage damage require articular cartilage transplantation to improve their quality of life.

[0003] In clinical applications, articular cartilage grafts primarily utilize autologous cartilage, allogeneic cartilage, and tissue-engineered artificial cartilage. Autologous cartilage grafting is suitable for treating small-scale, early-stage cartilage damage, but it has limitations in large-area repair. Allogeneic grafts are relatively easy to obtain, but still face challenges such as limited availability and immune rejection. Furthermore, compared to natural cartilage, artificial cartilage is relatively inferior in terms of biocompatibility, structural stability, and long-term functional maintenance, leading to a higher incidence of adverse reactions such as rejection, infection, and displacement.

[0004] Xenograft materials from mammals such as pigs, horses, cattle, and dogs are widely available and inexpensive to prepare, providing a new avenue for addressing the shortage of natural cartilage donors. Pigs, in particular, are more similar to humans in organ size, anatomy, and physiological characteristics. Currently, pig chondrocytes are used to repair human cartilage defects, and extracellular matrix (ECM) is also used as a bioscaffold in artificial cartilage tissue engineering. Furthermore, pigs are easy to raise, somatic cell cloning technology is highly mature, and their reproductive characteristics allow for the effective cultivation of inbred strains, providing advantages such as the ability to cultivate large numbers of genetically engineered donors in a clean environment. However, the main problem with xenografting is immune rejection, which hinders its clinical application and widespread adoption.

[0005] Recently, the humanization of animal organs or tissues has offered a solution to the problem of immune rejection in xenotransplantation. This involves using gene editing technology to replace specific genes in porcine chondrocytes with corresponding genes in human chondrocytes, thereby reducing the risk of post-transplant immune rejection. Type II collagen is a major component of articular cartilage and intervertebral discs, and is an important part of the extracellular matrix of articular cartilage tissue, accounting for approximately 60% of the dry weight of cartilage tissue. In articular cartilage, type II collagen forms a fibrous network structure, interacting with other types of collagen (such as type I collagen) and proteoglycans (such as proteoglycans) to impart elasticity and toughness to the cartilage tissue, enabling it to withstand mechanical stress and protect the joint. Currently, type II collagen is widely used as a biological scaffold material for the repair, reconstruction, and regeneration of articular cartilage. It is one of the key proteins for achieving the humanization of porcine cartilage, and its encoding gene is COL2A1.

[0006] Therefore, in order to solve the problem of immune rejection in xenografts and reduce the immunogenicity of xenografts, it is essential to develop pigs with key proteins and other components that can be humanized, and to provide humanized pig organs and other xenografts. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for constructing a humanized pig model of type II collagen and its application.

[0008] The main technical problem addressed by this invention is to provide a homologous targeting vector and single-stranded guide RNA (sgRNA) design for the efficient and precise integration of the human type II collagen coding sequence into the endogenous COL2A1 gene site in the porcine genome. Simultaneously, this invention also provides a method and application for modifying porcine cells using the aforementioned targeting vector and sgRNA to further construct a humanized type II collagen model pig. This invention utilizes a CRISPR / Cas9 gene editing technology-mediated homologous recombination method, employing designed and constructed target-site-specific sgRNA and homologous targeting vector to precisely modify the porcine genome, site-specifically integrating the human type II collagen coding sequence downstream of the porcine endogenous gene COL2A1 promoter. The porcine endogenous promoter drives the expression of human type II collagen while simultaneously blocking the expression of the corresponding porcine endogenous type II collagen, thereby constructing a humanized type II collagen model pig.

[0009] This invention utilizes site-specific sgRNA to guide Cas9 to target and cleave sequences near the start codon of the porcine COL2A1 gene, causing a DNA double-strand break. Then, using a given exogenous homologous targeting vector, the porcine COL2A1 gene is orthotopically replaced with the human COL2A1 gene. Combined with somatic cell nuclear transfer technology, a humanized pig model of type II collagen is obtained. The cartilage tissue of this model pig is more similar to that of the human body, reducing the attack of the graft by the human immune system and lowering the risk of immune rejection, thereby improving the success rate and therapeutic effect of cartilage transplantation.

[0010] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0011] In a first aspect, the present invention provides a CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 (COL2A1) gene, wherein the CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 (COL2A1) gene includes an sgRNA vector targeting the porcine type II collagen α1 (COL2A1) gene and a homologous targeting vector containing the human COL2A1 protein coding sequence;

[0012] The sgRNA vector targeting the porcine type II collagen α1 (COL2A1) gene contains an sgRNA sequence targeting the porcine type II collagen α1 (COL2A1) gene and a nucleic acid sequence encoding the Cas9 nuclease; the nucleotide sequence of the target site of the sgRNA is shown in SEQ ID NO.1.

[0013] The homologous targeting vector containing the human COL2A1 protein coding sequence comprises donor DNA, which is composed of an upstream homologous arm (5' homologous arm), a human COL2A1 protein coding sequence, a BGH polyA transcription termination signal (pA) sequence, a puromycin resistance gene expression cassette (PGK-PURO-pA), and a downstream homologous arm (3' homologous arm) connected in sequence.

[0014] The nucleotide sequence of the upstream homologous arm (5' homologous arm) is shown in SEQ ID NO.6;

[0015] The nucleotide sequence encoding the human COL2A1 protein is shown in SEQ ID NO.7;

[0016] The nucleotide sequence of the BGH polyA transcription termination signal (pA) sequence is shown in SEQ ID NO. 8;

[0017] The nucleotide sequence of the puromycin resistance gene expression cassette (PGK-PURO-pA) is shown in SEQ ID NO. 9;

[0018] The nucleotide sequence of the downstream homologous arm is shown in SEQ ID NO.10.

[0019] In a preferred embodiment of the CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 (COL2A1) gene described in this invention, the nucleotide sequence of the donor DNA is shown in SEQ ID NO.5.

[0020] Secondly, the present invention provides the application of the CRISPR-Cas9 system for targeting and editing the porcine type II collagen α1 (COL2A1) gene in constructing humanized transgenic cell lines of type II collagen, recombinant porcine embryos, or model pigs.

[0021] Thirdly, the present invention provides a kit for constructing humanized transgenic cell lines of type II collagen, recombinant porcine embryos, or model pigs, comprising the CRISPR-Cas9 system for targeting and editing the porcine type II collagen α1 (COL2A1) gene.

[0022] Fourthly, the present invention provides a method for constructing a humanized transgenic cell line of type II collagen, wherein the CRISPR-Cas9 system that targets and edits the porcine type II collagen α1 (COL2A1) gene is introduced into a porcine fetal fibroblast cell line, and the obtained target-positive monoclonal cells are the humanized transgenic cell line of type II collagen.

[0023] Fifthly, the present invention provides a method for constructing a type II collagen humanized transgenic pig recombinant embryo, wherein the type II collagen humanized transgenic cell line constructed by the method described above is used as the donor cell, and a pig recombinant embryo is obtained by somatic cell nuclear transfer.

[0024] Sixthly, the present invention provides a method for constructing a type II collagen humanized transgenic model pig, wherein the type II collagen humanized transgenic pig recombinant embryo constructed by the method described above is transferred into the oviduct of a sow through a non-surgical method, and after pregnancy, a type II collagen humanized transgenic pig is obtained.

[0025] In a seventh aspect, the present invention provides the application of the method for constructing the type II collagen humanized transgenic model pig in the preparation of cartilage transplant materials.

[0026] The humanized transgenic pig model of type II collagen constructed in this invention can express human type II collagen but does not express porcine type II collagen, and can provide humanized organs as cartilage transplant material.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention utilizes CRISPR / Cas9-mediated homologous recombination to replace the human COL2A1 gene in situ with the porcine COL2A1 gene, and constructs a humanized pig model of type II collagen using somatic cell cloning technology. This allows the pig to produce cartilage tissue more similar to that of humans, reducing the immune rejection response after transplantation. This invention has the potential to fundamentally solve the problem of the shortage of human cartilage tissue and is of great significance for the treatment of articular cartilage damage, providing a better and more suitable transplant material for the treatment of articular cartilage damage. Attached Figure Description

[0029] Figure 1 This refers to the design of a pig COL2A1 gene target site-specific sgRNA in Example 1 of the present invention;

[0030] Figure 2 This refers to the target site cleavage effect of the COL2A1 gene corresponding to the four sgRNA vectors in Example 1 of the present invention;

[0031] Figure 3 This is a schematic diagram illustrating the precise targeting of the porcine COL2A1 gene locus in this invention.

[0032] Figure 4 The results of genotyping of the porcine fetal fibroblast cell line precisely modified with the human COL2A1 gene in Example 3 of this invention;

[0033] Figure 5 The body shape and skeletal morphology of the type II collagen humanized transgenic pig in Example 4 of this invention;

[0034] Figure 6 The results of human COL2A1 gene expression in the cartilage of the ribs, femur, ear bones, arm bones, and trachea of ​​the type II collagen-humanized transgenic pig in Example 4 of this invention are shown in (A); where hCOL2A1 represents the human COL2A1 gene and pCOL2A1 represents the porcine COL2A1 gene; and the results of human COL2A1 protein expression in the cartilage of the ribs, femur, ear bones, arm bones, and trachea of ​​the type II collagen-humanized transgenic pig are shown in (B). Detailed Implementation

[0035] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0036] Unless otherwise specified, all other materials and reagents used in the examples are commercially available.

[0037] Example 1: Design of sgRNA, Construction of sgRNA Vector, and Determination of Gene Targeting Efficiency

[0038] 1. Design of sgRNA

[0039] Download the porcine COL2A1 gene (NC_010447) from the NCBI website. Target sites were selected near the ATG start codon of the porcine COL2A1 gene. Target site selection followed the principle that the protospacer-jacent motif (PAM) of spCas9 should be 5'-sgRNA-NGG-3' (N being any base). A total of four sgRNA target sites were designed. The design of the porcine COL2A1 gene target site-specific sgRNAs is as follows: Figure 1 As shown in Table 1, the nucleotide sequence information of the four sgRNA target sites is as follows.

[0040] Table 1

[0041] sgRNA target sites Nucleotide sequence (5'-3') Serial Number pCOL2A1-sgRNA-1 gagaagacgcagagcgctgct SEQ ID NO.1 pCOL2A1-sgRNA-2 tccacgggcttcctgcatga SEQ ID NO.2 pCOL2A1-sgRNA-3 aggcggcaggagcacggcgt SEQ ID NO.3 pCOL2A1-sgRNA-4 gcccggctccgccaggccccg SEQ ID NO.4

[0042] 2. Construction of sgRNA vector and testing of sgRNA gene targeting efficiency.

[0043] (1) Construction of sgRNA vector

[0044] Based on the sgRNA target site sequences in Table 1, two complementary single-stranded oligonucleotide sequences (Oligo1 and Oligo2) matching the target sites were identified, and 4 nucleotides were added to the 5' end of each sequence: 5'-cacc-3' was added to the Oligo1 sequence, and 5'-aaac-3' was added to the Oligo2 sequence. These sequences were then synthesized by a third-party company. The two oligonucleotides (Oligo1 and Oligo2) were subjected to an annealing process (heating at 98°C for 5 minutes, then cooling to room temperature at a rate of 1°C every 15 seconds) to obtain double-stranded DNA of the sgRNA.

[0045] Using the PX330 plasmid (#42230, purchased from Addgene, containing the nucleic acid sequences of the SpCas9 effector protein and the U6 promoter) as a blank vector, the linearized vector was obtained by digestion with BpiI restriction endonuclease. The linearized vector was then mixed with double-stranded DNA containing sgRNA to obtain the ligation product. The ligation product was added to competent DH5α cells, and colonies that had been selected through resistant culture were shaken. The plasmid was then extracted and Sanger sequencing was performed using the universal primer M13F (5'-TGTAAAACGACGGCCAGT-3'). The successfully identified plasmid was the sgRNA vector targeting the porcine COL2A1 gene, denoted as plasmid PX330-pCOL2A1-sgRNA. The sgRNA vectors corresponding to the four sgRNAs were designated as PX330-pCOL2A1-sgRNA1, PX330-pCOL2A1-sgRNA2, PX330-pCOL2A1-sgRNA3, and PX330-pCOL2A1-sgRNA4, respectively. The successfully identified plasmids were subjected to large-scale extraction to obtain plasmid PX330-pCOL2A1-sgRNA, which was then stored for later use.

[0046] (2) Gene targeting efficiency test

[0047] The gene targeting efficiency of sgRNA on the COL2A1 gene was tested using porcine primary fetal fibroblasts. Plasmid PX330-pCOL2A1-sgRNA was electroporated into porcine primary fetal fibroblasts. The Neon™ transfection system (Invitrogen) was used for electroporation of porcine fetal fibroblasts, following a program of 1350V, 30ms, and 1 pulse. Approximately 2.5 × 10⁶ cells were transfected with 6 μg of plasmids PX330-pCOL2A1-sgRNA1, PX330-pCOL2A1-sgRNA2, PX330-pCOL2A1-sgRNA3, and PX330-pCOL2A1-sgRNA4 obtained in Example 1 via electroporation. 5 Primary fetal fibroblasts of Large White pigs were transfected. Forty-eight hours after transfection, the cells were harvested, and the genome was extracted. PCR was performed using the genomic genome as a template, amplifying the target fragment using site-specific primers (forward primer: 5'-CGGGGTCTCAGGTTACAACC-3'; reverse primer: 5'-CTTCTCCTGACTGATGGGCC-3') and then sequencing.

[0048] The target site cleavage efficiency of the COL2A1 gene corresponding to the four sgRNA vectors is as follows: Figure 2As shown, the results indicate that the target site cleavage efficiencies of pCOL2A1-sgRNA-1, PX330-pCOL2A1-sgRNA2, PX330-pCOL2A1-sgRNA3, and PX330-pCOL2A1-sgRNA4 targeting the porcine COL2A1 site were 8%, 0%, 0%, and 1%, respectively, with pCOL2A1-sgRNA-1 exhibiting the highest targeting efficiency.

[0049] Example 2: Design and construction of a homologous targeting vector containing the human COL2A1 protein coding sequence

[0050] To ensure the precise insertion of the human COL2A1 protein coding sequence downstream of the promoter of the porcine endogenous COL2A1 gene, such as... Figure 3 As shown, the homologous targeting vector needs to contain a 5' homologous arm, a human COL2A1 protein coding sequence, a BHG polyA transcription termination signal, a puromycin resistance gene expression cassette (PGK-PURO-pA), and a 3' homologous arm connected sequentially to donor DNA.

[0051] The homologous targeting vector containing the human COL2A1 protein coding sequence comprises donor DNA, which is composed of an upstream homologous arm (5' homologous arm), a human COL2A1 protein coding sequence, a BGH polyA transcription termination signal (pA) sequence, a puromycin resistance gene expression cassette (PGK-PURO-pA), and a downstream homologous arm (3' homologous arm) connected in sequence.

[0052] The nucleotide sequence of the donor DNA is shown in SEQ ID NO.5.

[0053]

[0054] The upstream homologous arm sequence of the donor DNA, the nucleotide sequence of which is shown in SEQ ID NO.6;

[0055] The human COL2A1 protein coding sequence (including the start codon and the end stop codon) has the nucleotide sequence shown in SEQ ID NO.7;

[0056] The BGH polyA transcription termination signal (pA) sequence, the nucleotide sequence of which is shown in SEQ ID NO.8;

[0057] The puromycin resistance gene expression cassette (PGK-PURO-pA) sequence, the nucleotide sequence of which is shown in SEQ ID NO.9;

[0058] The downstream homologous arm sequence of the donor DNA, the nucleotide sequence of which is shown in SEQ ID NO.10.

[0059] The homologous targeting vector containing the human COL2A1 protein coding sequence is synthesized by a third-party company based on the nucleotide sequence of the donor DNA.

[0060] Example 3: Preparation of Type II Collagen Humanized Transgenic Cell Line

[0061] This invention utilizes a pre-designed sgRNA target site. Site-specific sgRNA guides Cas9 to target and cleave sequences near the start codon of the porcine COL2A1 gene, causing a DNA double-strand break. Homologous recombination repair is then performed using a given exogenous homologous targeting vector containing the human COL2A1 protein-coding sequence (CDS) and the puromycin resistance gene. This allows the human type II collagen-coding sequence to be precisely integrated downstream of the corresponding endogenous porcine COL2A1 gene promoter, thereby disrupting the open reading frame of the porcine COL2A1 gene and inducing the expression of the human COL2A1 gene, ultimately constructing a humanized transgenic cell line for type II collagen. A schematic diagram of the precise targeting of the porcine COL2A1 gene site is shown below. Figure 3 As shown.

[0062] Porcine fetal fibroblasts were electrotransfected using the Neon™ transfection system (Invitrogen). Following a transfection program of 1350V, 30ms, and 1 pulse, 10 μg of the plasmid PX330-pCOL2A1-sgRNA1 obtained in Example 1 and 10 μg of the homologous targeting vector containing the human COL2A1 protein-coding sequence obtained in Example 2 were co-transfected into approximately 1 × 10⁶ cells via electroporation. 6In primary fetal fibroblasts of Large White pigs, cells were electroporated and then plated the day afterward, followed by approximately 10 days of puromycin selection. Once the cells had grown into appropriately sized clones, single clones were selected, and PCR identification was used to determine the genotype of porcine fetal fibroblast cell lines precisely modified with the human COL2A1 gene, thus identifying positive cell lines.

[0063] The results of cell monoclonal screening are shown in Table 2 below.

[0064] Table 2

[0065]

[0066] The genotype identification results of the porcine fetal fibroblast cell line precisely modified with the human COL2A1 gene are as follows: Figure 4 As shown, the results indicated that among the 113 monoclonal cell lines identified by PCR, 27 were heterozygous knock-in monoclonal cells of the human COL2A1 gene; and 3 were homozygous knock-in monoclonal cells of the human COL2A1 gene, i.e., positive cells, numbered #5, #71, and #101, respectively. Example 4: Construction of recombinant embryos of type II collagen-humanized transgenic pigs and phenotypic analysis of transgenic pigs.

[0067] 1. Construction of recombinant embryos and transgenic pigs.

[0068] Monoclonal cells identified as positive in Example 3 were used as donor cells. Specifically, monoclonal cells numbered #5 and #71 were selected. The somatic cell nuclei of the donor cells were transferred into enucleated porcine oocytes through somatic cell nuclear transfer. After cell fusion, recombinant transgenic porcine embryos with type II collagen were obtained.

[0069] The recombinant embryos of type II collagen-humanized transgenic pigs were transplanted into the oviducts of four recipient sows that were in estrus at the same time. Two of the sows gave birth to eight piglets after a gestation period of about 114 days, which were the type II collagen-humanized transgenic pigs.

[0070] The statistics on somatic cell nuclear transfer and embryo transfer are shown in Table 3 below.

[0071] Table 3

[0072] Donor cell monoclonal numbering Total number of embryos transferred Total number of surrogate sows Number of pregnant sows Number of newborn cloned piglets #5 and #71 857 4 2(50％) 8

[0073] 2. Phenotypic analysis of type II collagen-derived transgenic pigs

[0074] Type II collagen-modified transgenic pigs died immediately after birth. The body size and skeletal morphology of the transgenic piglets were analyzed using external appearance and X-ray images, with wild-type pigs serving as a control group.

[0075] Furthermore, cartilage from the ribs, femurs, ear bones, arm bones, and trachea of ​​transgenic newborn cloned piglets was collected for human COL2A1 gene expression analysis. RT-PCR (transcriptional level) was used to analyze the expression of the human COL2A1 gene in the cartilage of the ribs, femurs, ear bones, arm bones, and trachea of ​​the newborn cloned piglets (experimental group), with wild-type piglets serving as the control group. Western blotting (protein level) was used to detect COL2A1 protein expression in the cartilage of the ribs, femurs, ear bones, arm bones, and trachea of ​​the newborn cloned piglets, with β-ACTIN used as a reference protein.

[0076] Body size and skeletal morphology of type II collagen-derived transgenic pigs, such as Figure 5 As shown, the results indicate that, compared with wild-type newborn piglets, transgenic pigs exhibit chondrodysplasia and severe microdwarfism, such as short body and limbs, small chest, and protruding abdomen.

[0077] The expression results of the human COL2A1 gene in the cartilage of the ribs, femur, ear bones, arm bones, and trachea of ​​humanized transgenic pigs containing type II collagen are as follows: Figure 6 As shown in Figure A, hCOL2A1 represents the human COL2A1 gene, and pCOL2A1 represents the porcine COL2A1 gene. The results showed that the transgenic neonatal cloned piglets expressed only the human COL2A1 gene in the cartilage of their ribs, femurs, ear bones, arm bones, and trachea, while wild boars expressed only the porcine COL2A1 gene in the same cartilage.

[0078] The expression results of human COL2A1 protein in the cartilage of the ribs, femur, ear bones, arm bones, and trachea of ​​humanized transgenic pigs containing type II collagen are as follows: Figure 6 As shown in Figure B, the results indicate that COL2A1 protein is expressed in the cartilage of the ribs, femur, ear bones, arm bones, and trachea of ​​transgenic neonatal cloned piglets.

[0079] In summary, the transgenic pigs constructed in this invention can express human type II collagen but do not express porcine type II collagen.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 gene, characterized in that, The CRISPR-Cas9 system for targeting and editing the porcine type II collagen α1 gene includes an sgRNA vector targeting the porcine type II collagen α1 gene and a homologous targeting vector containing the human COL2A1 protein coding sequence. The sgRNA vector targeting the porcine type II collagen α1 gene contains an sgRNA sequence targeting the porcine type II collagen α1 gene and a nucleic acid sequence encoding the Cas9 nuclease; the nucleotide sequence of the target site of the sgRNA is shown in SEQ ID NO.1; based on the sequence of the sgRNA target site, two complementary sgRNA single-stranded oligonucleotide sequences, Oligo1 and Oligo2, are determined to match the target site, and 4nt nucleotides are added to the 5' end of each sequence: 5'-cacc-3' is added to the Oligo1 sequence, and 5'-aaac-3' is added to the Oligo2 sequence; The homologous targeting vector containing the human COL2A1 protein coding sequence comprises donor DNA, which is composed of an upstream homologous arm, a human COL2A1 protein coding sequence, a BGH polyA transcription termination signal sequence, a puromycin resistance gene expression cassette, and a downstream homologous arm connected in sequence. The nucleotide sequence of the upstream homologous arm is shown in SEQ ID NO.6; The nucleotide sequence of the downstream homologous arm is shown in SEQ ID NO.10; The nucleotide sequence encoding the human COL2A1 protein is shown in SEQ ID NO.7; And / or, the nucleotide sequence of the BGH polyA transcription termination signal sequence is shown in SEQ ID NO.8; And / or, the nucleotide sequence of the puromycin resistance gene expression cassette is shown in SEQ ID NO.

9.

2. The CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 gene as described in claim 1, characterized in that, The nucleotide sequence of the donor DNA is shown in SEQ ID NO.

5.

3. The application of the CRISPR-Cas9 system for targeted editing of the porcine type II collagen α1 gene as described in claim 1 or 2 in the construction of humanized transgenic cell lines of type II collagen, recombinant porcine embryos, or model pigs.

4. A kit for constructing humanized transgenic cell lines of type II collagen, recombinant porcine embryos, or model pigs, characterized in that, A CRISPR-Cas9 system comprising the targeted editing of the porcine type II collagen α1 gene as described in claim 1 or 2.

5. A method for constructing a type II collagen humanized transgenic cell line, characterized in that, The CRISPR-Cas9 system for targeting and editing the porcine type II collagen α1 gene as described in claim 1 or 2 is introduced into a porcine fetal fibroblast cell line, and the resulting positive monoclonal cells are the type II collagen humanized transgenic cell lines.

6. A method for constructing a type II collagen-humanized transgenic pig recombinant embryo, characterized in that, The type II collagen humanized transgenic cell line constructed using the construction method described in claim 5 was used as the donor cell, and recombinant pig embryos were obtained through somatic cell nuclear transfer.

7. A method for constructing a humanized transgenic pig model of type II collagen, characterized in that, The type II collagen humanized transgenic pig recombinant embryos constructed by the construction method described in claim 6 were transferred into the oviduct of a sow using a non-surgical method. After pregnancy, type II collagen humanized transgenic pigs were obtained.

8. The application of the method for constructing the type II collagen humanized transgenic model pig as described in claim 7 in the preparation of cartilage transplant materials.

Images