A SNP molecular marker for detecting intramuscular fat content in pigs, primers containing this molecular marker, and their applications.

Abstract

This invention relates to a SNP molecular marker for detecting intramuscular fat content in pigs, primers containing this molecular marker, and their applications, belonging to the field of molecular biology technology. The mutation site in this invention is located in the third intron region of the porcine CTSS gene (base position 98424251 on the fourth chromosome of pigs), and is a polymorphic SNP site. The genotype of this SNP site is GG, GA, or AA, and the intramuscular fat content of pork can be determined based on the genotype of this mutation site. This invention screens for an SNP site related to intramuscular fat content in pork within the intron region of the porcine CTSS gene, thereby obtaining a functional gene and molecular genetic marker related to intramuscular fat content. The beneficial effects of this invention are: by optimizing the dominant allele of the porcine CTSS gene intron SNP site, it can provide marker resources for marker-assisted breeding of porcine intramuscular fat content, providing a new approach to improving pork quality.

Description

Technical Field

[0001] This invention relates to an SNP molecular marker for detecting intramuscular fat content in pigs, primers containing the molecular marker, and their applications, belonging to the field of molecular biology technology. Background Technology

[0002] my country is a major producer and consumer of meat, accounting for about one-third of the world's total meat production, with pork making up more than half. In recent years, with the continuous improvement of people's living standards, the demand for pork has gradually shifted from quantity to quality; that is, the quality of pork has become an increasingly important focus, and delicious, nutritious, and healthy meat products have become new goals for consumers. Intramuscular fat is one of the core elements for improving pork quality and has high economic value; however, conventional breeding methods have limited effectiveness, while molecular modification has enormous potential. Intramuscular fat is significantly correlated with pork tenderness and palatability, and its content has become one of the main factors in measuring pork quality. Therefore, increasing the intramuscular fat content in pork is of significant practical importance for improving pork quality, enhancing its edible value, and meeting the demands of consumers.

[0003] Intramuscular fat content is a moderately heritable trait, and theoretically, conventional phenotypic selection methods are effective in improving its quality through breeding. However, intramuscular fat content can only be determined post-slaughter and cannot be directly measured in vivo. Marker-assisted selection (MAG) can be used for in vivo selection, but identifying key genes or tightly linked markers for intramuscular fat content is a prerequisite for MAG. Single nucleotide polymorphisms (SNPs), as genetic markers, are DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. By screening for SNP sites associated with intramuscular fat content at the whole-genome level, and analyzing the location of SNPs in the genome and linkage disequilibrium, potential candidate genes can be inferred. The relationship between these candidate genes and intramuscular fat is then validated and their functions studied. Therefore, the development and utilization of molecular markers and related detection technologies have led to rapid progress in the genetic breeding improvement of intramuscular fat.

[0004] The microenvironment for intramuscular fat deposition is complex, with the components of the extracellular matrix (ECM) influencing deposition conditions. The ECM is the non-cellular portion of tissue, comprising a three-dimensional reticular structure and a gelatinous structure filling that reticular structure. Studies have shown that changes in ECM components, such as fibronectin and collagen, affect the degree of intramuscular fat deposition. The cathepsin family consists of lysosomal proteases activated in acidic environments, which can be released extracellularly to degrade ECM components such as fibronectin and collagenase. Cathepsin S (CTSS) is a member of this family, and studies have confirmed its role in promoting adipogenesis. Furthermore, CTSS expression is elevated in obese adipose tissue. Therefore, the CTSS gene may be an important candidate gene influencing fat deposition. Screening for SNP sites on this gene could provide a technical basis for molecular selection of intramuscular fat traits; however, there are currently no studies targeting the CTSS gene for intramuscular fat analysis. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by proposing an SNP molecular marker for detecting intramuscular fat content in pigs, primers containing this molecular marker, and their applications, so as to facilitate rapid determination of intramuscular fat content in pork and thus provide a basis for obtaining better meat quality.

[0006] This invention solves the technical problem through the following technical solution: a SNP molecular marker for detecting intramuscular fat content in pigs, wherein the SNP molecular marker is located at base 98424251 on the fourth chromosome of the pig in the third intron region of the CTSS gene, and the genotype of the SNP molecular marker is GG, GA, or AA. The genotype is designated as g.98424251 A>G.

[0007] When the genotype of the SNP molecular marker is AA, the intramuscular fat content of pork is higher than that of the GG genotype. That is, the intramuscular fat content of samples with the AA genotype mutation site is higher than that of samples with the GG genotype mutation site. The intramuscular fat content of pork is determined based on the g.98424251 A>G mutation site in the intron region of the CTSS gene.

[0008] The present invention further provides a primer pair containing an SNP molecular marker for detecting intramuscular fat content in porcine muscle, the nucleotide sequences of which are shown in SEQ NO.1 and SEQ NO.2, CTSS-F: 5'-CAACTGCACCAAGTCAAT-3'SEQ NO.1;

[0009] CTSS-R: 5'-AGCCCACATTTCTTTCTAAC-3' SEQ NO.2. The amplified product sequence is shown in SEQ NO.3.

[0010] The present invention further provides an application of primer pairs containing SNP molecular markers for detecting intramuscular fat content in pigs, and a kit for genotyping G / A mutation sites of SNP molecular markers, wherein the kit contains primer pairs with nucleotide sequences as shown in SEQ NO.1 and SEQ NO.2.

[0011] The present invention further provides an application of primer pairs containing SNP molecular markers for detecting intramuscular fat content in pigs, which is used to assist in the determination of intramuscular fat content in the genetic improvement of high intramuscular fat trait in selected pigs.

[0012] The criteria for determining the above two applications are: genotyping of the G / A mutation sites of the SNP molecular markers, with pork samples of genotype AA having a higher intramuscular fat content than pork samples of genotype GG.

[0013] The beneficial effects of this invention are as follows: By studying the correlation between the CTSS gene, which affects lipid deposition, and intramuscular fat content, a SNP site g.98424251 A>G related to intramuscular fat content was screened in the intron region. This yielded functional genes and molecular genetic markers related to intramuscular fat content, laying the foundation for further control of intramuscular fat content in pork. This is of great significance for improving meat quality and allows for convenient and rapid assessment of intramuscular fat content in pork, thus providing a basis for obtaining better meat quality. Attached Figure Description

[0014] Figure 1 This diagram illustrates the expression levels of the CTSS gene at different levels in the intramuscular fat group.

[0015] Figure 2 This is a PCR-SSCP genotyping sequencing diagram.

[0016] Figure 3 This diagram illustrates the correlation between SNPs and intramuscular fat content in individuals with different genotypes.

[0017] Figure 4 This diagram illustrates the expression results of the CTSS gene in individuals with different genotypes. Detailed Implementation

[0018] The present invention will be further illustrated below with reference to examples. Experimental methods in the following embodiments that do not specify specific conditions are generally carried out in accordance with known methods in the art.

[0019] experimental animals

[0020] The experimental animals were adult Duroc × Landrace × Large White three-way crossbred pigs provided by Nantong Jialun Food Factory. The longissimus dorsi muscle of the Duroc × Landrace × Large White pigs was collected for DNA extraction, RNA extraction, and determination of intramuscular fat content.

[0021] Test Procedure

[0022] 2.1 Measurement of intramuscular fat content

[0023] (1) Distribute the quantitative filter paper in a clean enamel dish and dry it at 105°C for more than 2 hours until its weight does not change. Accurately weigh the dried filter paper (W1) using a precision balance (sensitivity: 0.00001g).

[0024] (2) Cut 2-3g of muscle sample into small pieces, wrap them in dried filter paper, and weigh the paper package (W2). Spread the paper package on a clean enamel tray, place it in an oven, and dry it at 65℃ for more than 15 hours (or overnight) until its weight no longer changes. Weigh the dried paper package (W3).

[0025] (3) Place the dried filter paper package into a Soxhlet extractor and pour in anhydrous ether to soak overnight (the ether should completely submerge the filter paper package). The next morning, turn on the ether reflux device and reflux at 75°C for more than 9 hours. (Ether is volatile, so seal the bottle opening with water and observe the reflux status regularly to replenish ether in time).

[0026] (4) After extraction, take out the filter paper package and spread it on a clean enamel tray. Let the ether evaporate completely in a ventilated place for 30 minutes. Dry it at 105°C for more than 2 hours until its weight does not change. Weigh the paper package after drying (W4).

[0027] (5) To eliminate the error caused by uneven moisture loss during sample pretreatment, the relative content of intramuscular fat is expressed as the percentage of the total extracted fat content in the dried sample (dried at 105℃ for 15h), and the calculation formula is as follows:

[0028] Intramuscular fat percentage (%) = (W3-W4) / (W3-W1)×100%

[0029] 2.2 Extraction of muscle DNA

[0030] (1) Cut off about 100 mg of longissimus dorsi muscle sample, chop it up, and put it into a 2 mL centrifuge tube without DNase enzyme.

[0031] (2) Add 1 mL of lysis buffer and 50 µL of proteinase K to the centrifuge tube, mix thoroughly, and digest in a water bath at 55°C for 12 h to overnight. The next day, add 900 µL of Tris saturated phenol to the centrifuge tube, mix well, and centrifuge at 12,000 rpm for 15 min at 4°C.

[0032] (3) Take 1,000 µL of supernatant and put it into a new 2 mL centrifuge tube. Add 500 µL of chloroform / isoamyl alcohol (24:1) and 500 µL of saturated phenol, mix well, and centrifuge at 12,000 rpm for 15 min at 4 °C.

[0033] (4) Take 850 µL of supernatant and put it into a new 2 mL centrifuge tube. Add 850 µL of chloroform / isoamyl alcohol (24:1), mix well, and centrifuge at 12,000 rpm for 15 min at 4℃.

[0034] (5) Take 700 µL of supernatant and put it into a new 2 mL centrifuge tube. Add 700 µL of chloroform, mix well, and centrifuge at 12,000 rpm for 15 min at 4℃.

[0035] (6) Take 500 µL of supernatant and put it into a new 1.5 mL centrifuge tube. Add 1,000 µL of anhydrous ethanol, shake gently, and centrifuge at 10,000 rpm for 10 min at 4 °C.

[0036] (7) Discard the supernatant, add 1,000 µL of 70% ethanol, shake gently, and centrifuge at 10,000 rpm for 5 min at 4°C.

[0037] (8) Discard the supernatant, carefully remove the remaining liquid in the centrifuge tube, and blow dry the centrifuge tube in the clean bench until there are no liquid droplets in the tube. The drying time is about 30 minutes.

[0038] (9) Add 50µL of deionized water (55℃) to dissolve the DNA, then perform sample quality testing and store at -20℃ for a long time.

[0039] 2.3 DNA Concentration Detection

[0040] The DNA concentration of the longissimus dorsi muscle samples from 180 Duroc × Landrace × Large White three-way crossbred pigs was determined using a NanoDrop spectrophotometer. The OD260 / 280 ratio was calculated to determine the quality of the DNA. An OD260 / 280 ratio of 1.8-2.0 indicates that the DNA quality is qualified.

[0041] 2.4 Primer Design and Synthesis

[0042] Based on the porcine CTSS gene sequence (Chr4, NC_010446.5) published in the GenBank database, genotyping primers CTSS-F and CTSS-R, including intron SNP (g.98424251 A>G), were designed. Primer sequences are shown in Table 1. The amplification product sequence is shown in SEQ NO.3.

[0043] Primer Product Length Primer Sequence (5'-3') CTSS-FCTSS-R 180 bp 5'- CAACTGCACCAAGTCAAT -3'5'- AGCCCACATTTCTTTCTAAC -3'

[0044] 2.5 PCR-SSCP Reaction Procedure

[0045] For the g.98424251 A>G site, genotyping was performed using the PCR-SSCP method. The PCR reaction system used for the genotyping experiment is shown in Table 2.

[0046] Components Volume 2×Taq Master MixDNA template 5 µL 1 µL Upstream primer (CTSS-F) 0.5µL Downstream primer (CTSS-R) 0.5µL Double distilled water 3µL Total volume 10 µL

[0047] Following the reaction system in Table 2, add each component to a 0.2 mL PCR tube, mix well, and centrifuge. Then perform the PCR reaction under the following conditions: 94℃, 5 min; (94℃, 30 s, 53℃, 30 s, 72℃, 30 s) (32 cycles in total); 72℃, 10 min. Take 5-6 µL of the amplified PCR product and add an equal volume of loading buffer (98% deionized formamide, 0.025% bromophenol blue, 0.025% dibenzopyrene, 10 mM EDTA, 2% glycerol), denature at 98℃ for 10 min, then immediately incubate on ice for 10 min. The denatured PCR product is then electrophoresed on a 12% non-denaturing polyacrylamide gel at 150 V and 4℃ for 12 h. After electrophoresis, the gel was washed twice with double-distilled water, then immersed in silver staining solution for 10 min, followed by rapid rinsing of the gel twice with double-distilled water. The gel was then immersed in the developing solution until the bands were clearly visible. The developing solution was removed, and the gel was washed three times with double-distilled water before taking a picture.

[0048] 2.6 Tissue RNA Extraction

[0049] (1) Clean the homogenizer rotor with DEPC water, and then clean it with Trizol reagent.

[0050] (2) Take about 100 mg of longissimus dorsi muscle tissue and put it into a 2 mL centrifuge tube. Add 500 µL of Trizol reagent to the tube, process the longissimus dorsi muscle tissue with a homogenizer, and finally add another 500 µL of Trizol reagent. Place on ice for 5 min.

[0051] (3) Add 200 µL of chloroform to the centrifuge tube, shake to mix for 30 seconds, then place on ice for 10 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C.

[0052] (4) Transfer the upper liquid to a 1.5 mL centrifuge tube, add 500 µL of pre-cooled isopropanol to the centrifuge tube, mix thoroughly, let stand at room temperature for 10 min, and centrifuge at 12,000 rpm for 10 min at 4℃.

[0053] (5) Discard the supernatant, add 1000 µL of pre-cooled 75% ethanol, gently shake, and centrifuge at 12,000 rpm for 5 min at 4°C.

[0054] (6) Discard the supernatant, retain the RNA precipitate at the bottom, remove the water at the bottom of the tube as much as possible with a pipette, and air dry in a clean bench for 25 minutes.

[0055] (7) Add 20 µL of DEPC water to a centrifuge tube to dissolve the RNA, let it stand for 15 min, and use a NanoDrop spectrophotometer to determine the RNA concentration. Calculate the OD260 / 280 ratio to judge the quality of the RNA. The OD260 / 280 ratio should be 1.8-2.0, indicating that the quality of the RNA is qualified. After determining the RNA quality, store it at -80℃ or use it directly for reverse transcription.

[0056] 2.7 Reverse transcription

[0057] Add the components to a 0.2 mL PCR tube according to the reverse transcription system in Table 3, mix well, and centrifuge.

[0058] Components Volume 5×Prime Script® RT Master MixTotal RNA 2 µL 500 ng RNase Free Double Distilled Water Add to 10 µL Total volume 10 µL

[0059] The 0.2 mL PCR tube was then placed in the PCR instrument, and the reaction program was 37°C for 15 min; 85°C for 5 s; 4°C for cooling and storage. The cDNA obtained after the reaction was completed was stored at -20°C.

[0060] 2.8 Primer Design for Quantitative Real-Time PCR

[0061] The primer sequences for real-time PCR of CTSS and the internal reference gene RPLP0 were designed using the reference sequences of CTSS (XM_021089893.1) and RPLP0 (NM_001098598.1) published on the website https: / / www.ncbi.nlm.nih.gov / . The specific sequences are shown in Table 4.

[0062] Table 4 Primer Sequences for Quantitative Real-Time PCR

[0063] 2.9 Quantitative Real-Time PCR

[0064] The mRNA expression level of CTSS was detected using a real-time PCR instrument. Components were added to 96-well plates according to the reaction system in Table 5. After adding all components, the plates were mixed and centrifuged for a few seconds. The detection was then performed according to the real-time PCR reaction procedure in Table 6, using the RPLPO gene as an internal reference gene. -ΔΔCt The method involves statistical analysis of the validity data.

[0065] Table 5. Quantitative Real-Time PCR Reaction System

[0066] Table 6. Quantitative Real-Time PCR Reaction Procedure

[0067] 2.10 Statistical Analysis

[0068] The data from this experiment were statistically analyzed using SPSS 20.0 software. Paired Student's Score was used to compare the data from the two groups. t -test analysis. GraphPad Prism version 8.0 software was used for plotting. For trait association analysis of different genotypes, a mixed linear model was used. Y = μ + G + S + D + e ,in Y Indicates intramuscular fat content. μ Represents the mean of the group. G Indicates genotype. S Indicates gender. D Carcass weight is represented as a covariate. e Residuals are represented. All data are expressed as mean ± standard error (SEM).

[0069] 3. Experimental Results

[0070] 3.1 CTSS expression is correlated with intramuscular fat content.

[0071] Eight samples of the longissimus dorsi muscle were selected from individuals with high and low intramuscular fat content, respectively. Using cDNA from these two groups as templates, quantitative real-time PCR analysis was performed to detect the expression of the CTSS gene in the high and low intramuscular fat groups. Figure 1 As shown, the results indicate that the expression level of CTSS differed significantly between the two groups, with the mRNA level of CTSS in the high-expression group being significantly higher than that in the low-expression group. p <0.05).

[0072] 3.2 PCR-SSCP Genotyping

[0073] Using DNA samples as templates, PCR amplification was performed on the CTSS intron region g.98424251 A>G site using CTSS-SNP. The products were then subjected to PCR-SSCP typing and sequencing. Figure 2 As shown, the single nucleotide base mutation at the A>G site in g.98424251 is either guanine G or adenine A, and the PCR-SSCP gel map corresponds one-to-one with the sequencing results. Based on the PCR-SSCP genotyping results, there are 59 individuals with the GG genotype, 93 with the GA genotype, and 28 with the AA genotype.

[0074] Correlation analysis of 3.3 g.98424251 A>G site and intramuscular fat content

[0075] Statistical analysis was performed on individuals with different genotypes to determine the correlation between SNPs and intramuscular fat content, such as... Figure 3 The results showed that the AA genotype had the highest intramuscular fat content, and the intramuscular fat content of the AA genotype was significantly different from that of the GG genotype. p <0.05). There was no significant difference in intramuscular fat content between the GG and GA genotypes.

[0076] 3.4 Expression of CTSS in individuals with different genotypes

[0077] Eight individuals with the GG genotype and eight individuals with the AA genotype were selected, and their cDNA was used as templates for quantitative real-time PCR analysis. Figure 4 The results showed that the expression level of CTSS differed significantly between the two groups. p <0.05), the mRNA level of individuals with the AA genotype was significantly higher than that of individuals with the GG genotype.

[0078] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. An application of a primer pair containing an SNP molecular marker for detecting intramuscular fat content in pigs, characterized in that: The method for determining intramuscular fat content in the genetic improvement of high intramuscular fat trait in pigs is used to assist in the selection and breeding of pigs. The SNP molecular marker is a nucleotide sequence as shown in SEQ NO.

3. A G / A base mutation exists at position 102 of SEQ NO.

3. The pig is a Duroc Landrace Large White Pig.

2. The application of the primer pair for detecting SNP molecular markers of intramuscular fat content in porcine muscle according to claim 1, characterized in that: The genotype of the SNP molecular marker is GG, GA, or AA.

3. The application of the primer pair for detecting SNP molecular markers of intramuscular fat content in porcine muscle according to claim 1, characterized in that: Genotyping was performed on the G / A mutation sites of the SNP molecular markers. The intramuscular fat content of pork samples with genotype AA was higher than that of pork samples with genotype GG.

4. The application of the primer pair for detecting SNP molecular markers in porcine intramuscular fat content according to claim 1, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ NO.1 and SEQ NO.2.

Images