Polygalacturonase gene AmPG1 and application thereof

Abstract

The application discloses a polygalacturonase AmPG1 , and the nucleotide sequence of the polygalacturonase is shown as SEQ ID NO:1. The gene is used for improving the growth ability and wood decay ability of Armillaria mellea, and experimental results show that AmPG1 the growth condition of OE Armillaria mellea in PDA culture medium and wood culture medium is better than that of WT Armillaria mellea, and the area of covering wood is more than that of WT Armillaria mellea. The research provides technical support and theoretical basis for obtaining excellent engineering Armillaria mellea through genetic engineering means, and has important significance for the sustainable development of Gastrodia industrial.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic engineering technology, specifically relating to a polygalacturonase gene from Armillaria mellea. AmPG1 And its use in enhancing the growth ability of Armillaria mellea and its ability to decompose wood. Background Technology

[0002] Gastrodia elata ( Gastrodia elata Gastrodia elata is a traditional and precious Chinese medicinal herb, and also a plant used for both food and medicine. There is a huge market demand for it. Due to the high content of active ingredients and good quality of wild Gastrodia elata, it has been over-harvested, leading to its near extinction. Demand for Gastrodia elata is now mainly met through artificial cultivation. Artificial cultivation of Gastrodia elata requires wood and Armillaria mellea (a type of fungus). Armillaria mellea Armillaria mellea plays an irreplaceable and crucial role in its symbiotic relationship with Gastrodia elata. It decomposes wood to sustain its own growth, while Gastrodia elata obtains nutrients from the symbiotic Armillaria mellea for its own growth. Armillaria mellea is the primary nutrient source for Gastrodia elata; without it, Gastrodia elata cannot grow independently. The growth characteristics of Armillaria mellea directly affect the quality of Gastrodia elata. Cultivating superior Armillaria mellea is of great significance to Gastrodia elata production. Only when Armillaria mellea has a strong ability to decompose and utilize wood, a strong symbiotic relationship with Gastrodia elata, and a strong growth capacity can it ensure the vigorous growth of Gastrodia elata.

[0003] Pectin is one of the main components of plant cell walls, with galacturon polysaccharides (HG) accounting for approximately 65% ​​of its composition. Polygalacturonase (PG) belongs to... GH28 The PG family, one of the largest families of hydrolases, is considered an important pathogenic factor. It participates in the degradation of pectin, a major component of plant cell walls, and can hydrolyze the GalA bonds in homogalacturonic acid polysaccharides. It plays a dual role in disrupting plant cell wall structure for better host invasion and as a signaling factor triggering plant defense responses. The PG activity of pathogenic fungi is crucial to their virulence activity, affecting the success and survival of host infection.

[0004] The polygalacturonase gene from Armillaria mellea has not yet been identified. AmPG1 There are reports on its ability to enhance the growth capacity and wood-decomposing ability of Armillaria mellea. Summary of the Invention

[0005] This invention provides a polygalacturonase gene. AmPG1 It comes from Armillaria mellea ( Armillaria gallica The nucleotide sequence of the polygalacturonase gene is shown in SEQ ID NO:1. AmPG1 The polygalacturonase gene is used to improve the growth ability of Armillaria mellea. AmPG1The engineering Armillaria mellea with enhanced growth ability can be used for further research on the gene and applied in the symbiotic process with Gastrodia elata.

[0006] In order to achieve the above-mentioned purpose of the present application, the technical scheme of the present application is as follows:

[0007] 1. According to the existing Armillaria mellea whole genome data (GenBank: GCA_026212265.1), the glycoside hydrolase 28 gene family in Armillaria mellea is identified and analyzed by using bioinformatics methods and tools, 15 genes are identified, cluster analysis finds that 12 genes are clustered into the polygalacturonase branch. AmGH28 AmGH28 The expression pattern analysis of the 15 genes finds that the genes clustered into the polygalacturonase branch have the highest expression amount in the rhizomorph and the most significant differential expression; AmGH28 AmPG1

[0008] 2. The full-length polygalacturonase gene is cloned from Armillaria mellea, and the pCouldTM TF - AmPG1 prokaryotic expression vector is constructed, the AmPG1 recombinant protein is successfully induced and purified in Escherichia coli (BL21), the enzymatic property analysis of AmPG1 finds that the optimal pH value of AmPG1 enzyme activity is 4.4, the optimal temperature is 40 DEG C, the residual enzyme activity is the highest after 40 DEG C incubation, Fe 3+ has a high activation effect on AmPG1; the purified AmPG1 protein is used to immunize mice, and the polyclonal antibody is obtained for subsequent experiments; PG1 3. The eukaryotic overexpression vector PRI101

[0009] -GFP of the gene and the genetic transformation of Armillaria mellea are constructed AmPG1 AmPG1

[0010] The total RNA of Armillaria mellea is extracted by using the Trizol method; the cDNA is obtained by reverse transcription; the gene sequence is obtained from the genome database, and the gene-specific primer with the homologous arm of the PRI101-GFP vector is designed by using Oligo7 software; AmPG1

[0011] The upstream primer is 5'- CATATGCCCGTCGACCCCGGGATGTCGTCGAAGCAGGATAGC;

[0012] The downstream primer is 3'- TCAGAATTCGGATCCGGTACCTTACCCTGAACAGTTTCCACAGTCG;

[0013] ​​​​​​Using cDNA reverse-engineered from total RNA of *Armillaria mellea* as a template, primers containing the homologous arm of the PRI101-GFP vector, and high-fidelity enzyme, PCR amplification was performed, yielding a target band of 1050 bp. The homologous recombination kit was then used to amplify the target band containing the homologous arm. AmPG1 The target gene was ligated into a linearized PRI101-GFP vector, and DH5α cells were transformed using the heat shock method. Positive bacteria were detected by bacterial culture PCR, and sequence accuracy was verified by sequencing. Agrobacterium competent cells were transformed using the freeze-thaw method, and positive bacteria were detected by bacterial culture PCR. The obtained positive Agrobacterium cells were transformed into WT Armillaria mellea using the Agrobacterium-mediated transformation method. Transgenic Armillaria mellea grown on resistance plates were identified by resistance gene amplification, gene expression level, and protein expression level detection.

[0014] 4. Cultured on PDA solid medium AmPG1 - Using Armillaria mellea (OE) and Armillaria wt as materials, mycelial cords of the same length were inoculated into semi-solid PDA medium and cultured in a dark incubator at 25℃. The growth status and biomass were observed and measured at 6, 12 and 18 days of culture.

[0015] 5. Culture WT Armillaria mellea and AmPG1 - After the Armillaria mellea mycelium was crushed with a crusher, 10 mL of mycelial liquid was added to the fungal culture medium and placed in a dark incubator at 25°C for 30 days. The growth status of Armillaria mellea was then observed, and the content of reducing sugars in the liquid and wood of the fungal culture medium was measured.

[0016] The beneficial effects of this invention are:

[0017] The above experiments were conducted on the polygalacturonase gene. AmPG1 Perform functional verification, AmPG1 Overexpression of the gene in Armillaria mellea was found to promote the growth of Armillaria mellea. AmPG1 The dry and wet weights of *Armillaria mellea* (OE) were significantly higher than those of *Armillaria wroughtii* (WT) after 12 days of culture. It was also found that… AmPG1 -OE Armillaria mellea also grows vigorously in the culture medium, with lower reducing sugar content in the wood and liquid of the culture medium compared to WT Armillaria mellea, and its ability to decompose wood is also higher than that of WT Armillaria mellea. These findings provide technical support and a theoretical basis for obtaining superior engineered Armillaria mellea through genetic engineering, which is of great significance for the sustainable development of the Gastrodia elata industry. Attached Figure Description

[0018] AmPG1 pCould TM TF- Figure 1 PCR validation of the vector in bacterial culture (Figure A) and pCould TM TF- AmPG1Detection results of vector transformation of BL21 (Figure B);

[0019] AmPG1 The results show the induced expression (Figure A) and purification (Figure B) of the AmPG1 recombinant protein;

[0020] Figure 2 The results of the optimal enzyme activity detection for AmPG1 recombinant protein;

[0021] Figure 3 The results of the thermosusceptibility analysis of AmPG1 enzyme;

[0022] Figure 4 The effect of pH on the activity of AmPG1 recombinant protease;

[0023] Figure 5 The effect of metal ions on the activity of AmPG1 recombinant protease;

[0024] Figure 6 Western blot detection of AmPG1 antibody;

[0025] Figure 7 For PRI101- Figure 8 - PCR verification of the GFP vector (Figure A), and detection of transformation of Agrobacterium LBA4404 (Figure B).

[0026] AmPG1 Figure A shows the transformation of Armillaria mellea on a plate, the subculture of Armillaria mellea on a resistance plate after picking mycelia (Figure B), the growth of WT Armillaria mellea on a resistance plate (Figure C), the PCR detection of the Kan resistance gene (Figure D), the detection of gene expression level (Figure E), and the detection of protein expression level (Figure F).

[0027] Figure 9 For WT Armillaria and Figure 10 -Observation of the growth status and biomass detection of Armillaria mellea mycelial cords (OE);

[0028] AmPG1 for Figure 11 - Observation of the lateral growth of OE Armillaria mellea and wild-type Armillaria mellea on the mycelial culture medium (Figure A), observation of the growth of the side of the bottle after removing it (Figure B), observation of the growth and quantity of Armillaria mellea in the middle part (Figure C), and observation of the growth of Armillaria mellea at the bottom (Figure D).

[0029] AmPG1 Figure A shows the determination of reducing sugar content in liquid culture medium for fungi and in wood (Figure B). Detailed Implementation

[0030] The application will be further described in detail by examples and drawings, but the scope of protection of the application is not limited to the content described. The methods in the examples are performed according to the conventional operation unless otherwise specified, and the reagents used are all conventional reagents purchased or prepared according to the conventional method unless otherwise specified.

[0031] Example 1: Figure 12 Construction of prokaryotic expression vector of gene and purification of protein expression

[0032] 1. Extraction of total RNA (Trizol method)

[0033] 0.2 g of Armillaria mellea sample was placed in a mortar and 1 mL of Trizol was added and ground for 5 min; the ground sample was transferred to a centrifuge tube; 200 μL of chloroform was added and shaken until it became milky white and did not separate; centrifugation was performed at 4°C (12000 rpm for 15 min), and the upper liquid was transferred to a new centrifuge tube (the step was repeated); an equal volume of isopropanol was added, and after standing at -20°C for 10 min, centrifugation was performed at 4°C (12000 rpm for 20 min), and the supernatant was removed; the precipitate was washed with 75% DEPC alcohol (repeated three times); the precipitate was dissolved in DEPC water, agarose gel electrophoresis was performed for verification, and stored in a -80°C refrigerator. The RNA was reverse transcribed into cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Vazyme Company) reverse transcription kit according to the instructions. The cDNA was used as a template, the primer containing the homologous arm of the PRI101-GFP vector, and the high-fidelity DNA polymerase (purchased from Novozyme Biotech Co., Ltd.) to amplify AmPG1 the gene (1050 bp). The amplification system was performed according to the instructions (annealing temperature was 65°C). The SanPrep Column DNA Gel Recovery Kit produced by Shanghai Biotechnology Co., Ltd. was used to recover AmPG1 the gene fragment. According to the instructions of the ClonExpress® II One Step Cloning Kit produced by Novozyme, the AmPG1 gene was ligated to pCould TMTF vector (reaction system: linearized vector pCould™ TF 2μL, target gene fragment 2μL, 5× CEII Buffer 4μL, Exnase II 2μL, double-distilled water to 20μL; react at 37℃ for 30 min on a PCR instrument, then cool to 4℃, and store at -20℃ for later use). Add 5μL of ligation buffer to 100μL of thawed DH5α competent cells and transform DH5α competent cells using the heat shock method. After thawing and plating, PCR is used to test for positive single clones, and sequencing is used to verify the sequence correctness to obtain pCould. TM TF- AmPG1 carrier ( AmPG1 A). Preserve the correct bacterial culture in glycerol at -80°C. Extract the plasmid and transform BL21 using the heat shock method. Verify the positive strain by PCR. Figure 1 B), used for subsequent protein induction and purification.

[0034] The BL21 strain, stored at -80℃, was activated on LB solid medium. Cells were scraped and transferred to LB liquid medium containing the corresponding carrier resistance for expansion to OD. 600 =0.5; Add IPTG to make the final IPTG concentration in the bacterial culture 1mM, and incubate in shakers at different temperatures (28℃, 37℃) for induction; Use uninduced bacterial culture as a control, and take samples every two hours until 8 h, and store the collected bacterial culture at 4℃; After all the bacterial culture has been collected, centrifuge at 8000 rpm for 5 min, remove the supernatant, resuspend the bacterial cells in 300 μL of 1×PBS, centrifuge again to remove the supernatant; Add 50 μL of 1×SDS-PAGE loading buffer to the bacterial cells, boil and centrifuge at low temperature; Load 20 μL for SDS-PAGE detection, and analyze protein expression after staining and destaining. Figure 1 A). It was found that the expression level of AmPG1 protein was highest when induced at 28℃ and 1 mM IPTG concentration for 4 h.

[0035] 150 mL of activated and expanded culture (OD) 600=0.4~0.6) BL21 bacterial culture was induced under optimal induction conditions; the successfully induced culture was centrifuged to remove the supernatant, and the bacterial cells were preserved. The bacterial cells were lysed according to the protein solubility detection procedure; the protein content in the supernatant was detected by SDS-PAGE; the supernatant was filtered through a 0.22 μM filter membrane to remove impurities and stored at 4℃ for later use; the chromatography column was washed and equilibrated with 5 column volumes of deionized water and Lysis Buffer; the supernatant was slowly added to the column and placed at 4℃ for 1 h, inverting and mixing every 10 min; impurities were eluted with 15 column volumes of Wash Buffer; the target protein was eluted with 10 column volumes of Elution Buffer, with each 5 column volumes forming a gradient; the purified sample (washed and eluted fractions) was analyzed by SDS-PAGE to determine the purification effect. Figure 2 B).

[0036] Example 2: AmPG1 enzyme activity assay

[0037] Using pectin as a substrate and the supernatant from prokaryotic expression lysis as crude enzyme solution, a standard curve was prepared using D-galacturonic acid. The reaction system consisted of 0.5 mL pectin solution (5 g / L), 0.5 mL citrate-disodium hydrogen phosphate buffer (different pH), and 1 mL crude enzyme solution. The activity of AmPG1 enzyme was determined by the 3,5-dinitrosalicylic acid method. After the reaction system was fully reacted, 3,5-dinitrosalicylic acid solution was added, and the mixture was placed in boiling water for 10 minutes. It was then immediately cooled in water, and the absorbance was measured at 540 nm to determine the content of D-galacturonic acid produced.

[0038] 1. Optimal temperature and insulation performance of polygalacturonase AmPG1

[0039] The reaction system was reacted at different temperatures (20℃, 30℃, 40℃, 50℃, 60℃, 70℃) for 30 min. A curve was plotted with temperature on the x-axis and relative enzyme activity on the y-axis (relative enzyme activity = enzyme activity value / maximum enzyme activity value, defined as 100%) to determine the optimal enzyme activity temperature of AmPG1. After incubation at different temperatures (20℃, 30℃, 40℃, 50℃, 60℃, 70℃) for 1.5 h, the incubated enzyme solution was added to the reaction system. After reacting for 30 min at the optimal pH and temperature, the enzyme activity of the AmPG1 recombinant protein was measured. The untreated group served as the control group, and the enzyme activity of the control group was defined as 100%. The ratio of the experimental group to the control group was the relative enzyme activity. The relative enzyme activities of the experimental group and the control group were compared, and the results are shown below. Figure 2The effect of temperature on the enzyme catalytic reaction speed is actually the combined result of the effect of temperature on the reaction speed and the enzyme denaturation. The optimum enzyme activity temperature of AmPG1 is 40℃, and the maximum enzyme activity ratio can be achieved. Therefore, we determine that the optimum enzyme activity temperature of the enzyme is 40℃. The incubation results are shown in Figure 3 As shown, it is found that the residual enzyme activity of AmPG1 recombinant protein after incubation at different temperatures is quite different, indicating that the enzyme is relatively sensitive to temperature changes. The residual enzyme activity of AmPG1 after incubation at 40℃ is the highest, about 70%.

[0040] 2. Optimum pH of polygalacturonase AmPG1

[0041] The reaction system was reacted at different pH for 30 min, and the curve was drawn with pH as the abscissa and the relative enzyme activity as the ordinate (relative enzyme activity = enzyme activity value / maximum enzyme activity value, defined as 100%). The results are shown in Figure 4 As shown, it is found that the relative enzyme activity of AmPG1 is the highest at pH 4.4, and we can determine that the optimum pH of AmGH28-1 is 4.4. In addition, it is also speculated that the enzyme activity is suitable for an acidic environment.

[0042] 3. Effect of metal ions on the enzyme activity of polygalacturonase AmPG1

[0043] KCl, MnSO4, ZnSO4, MgSO4, CaCl2, CuSO4, and FeCl3 solutions were added to the reaction system to make the final concentration of metal ions in the reaction system 5 mmol / L, and the effect of metal ions on the enzyme activity of AmPG1 recombinant protein was explored at the optimum pH 4.4 and 40℃ for 1 h. The system without adding metal ions was used as the control group, and the enzyme activity was defined as 100%. The relative enzyme activity of the experimental group to the control group was compared. The results are shown in Figure 5 As shown, it is found that metal ions have a certain promoting effect on the enzyme activity, among which Ca 2+ has a smaller promoting effect, and Fe 3+ has a larger promoting effect. Compared with the control, the enzyme activity is increased by more than 2 times.

[0044] Example 3: Preparation and detection of AmPG1 polyclonal antibody

[0045] Balbc mice were immunized to obtain polyclonal antibodies. The recombinant protein containing 200 μg AmPG1 was mixed with an equal volume of Freund's adjuvant, shaken to a milky white viscous state and not layered. For the first mouse immunization, 30 μg to 50 μg of the recombinant protein emulsified with complete Freund's adjuvant was injected subcutaneously to each mouse. After the first immunization, the protein emulsified with incomplete Freund's adjuvant was used for booster immunization, and the immunization time was: 2 weeks apart (first), 3 weeks apart (second), and 4 weeks apart (third). One week after the third booster immunization, the antibody was verified by tail blood, and finally the eyeball blood was taken. The obtained blood was placed at room temperature for 1 h, then placed at 4°C for overnight to allow the serum to separate. The serum was centrifuged at 4°C, 1500 rpm for 15 min, then the serum was loaded into sterile 1.5 mL centrifuge tubes, NaN3 was added for preservation, and the serum was aliquoted and stored at -20°C for later use.

[0046] To verify whether the prepared AmPG1 polyclonal antibody is effective, we performed specific detection of AmPG1 antibody. The total protein of Armillaria mellea was extracted, and 20 μg, 25 μg, and 30 μg of total protein were loaded for SDS-PAGE electrophoresis. Western blot analysis was performed using self-made AmPG1 antibody as the primary antibody and commercial goat anti-rabbit as the secondary antibody. The results are shown in Figure 6 , it was found that the Western Blot band was relatively single, and the band gradually thickened with the increase of the loading amount, indicating that the prepared polyclonal antibody could specifically bind to AmPG1 protein in Armillaria mellea and had high specificity, which could be used for subsequent experiments.

[0047] Example 4: Construction of eukaryotic overexpression vector PRI101- Figure 7 -GFP AmPG1 Obtaining Armillaria mellea

[0048] 1. Construction of eukaryotic overexpression vector PRI101- AmPG1 -GFP

[0049] The eukaryotic overexpression vector PRI101- AmPG1 -GFP was constructed by homologous recombination technology. The gene target fragment (1050 bp) containing the homologous arm was obtained by PCR amplification. The double-digested linearized PRI101-GFP vector was connected with the target fragment, and the DH5α competent cells were transformed. The positive strain was tested by PCR, and the sequence correctness was verified by sequencing; it was proved that the PRI101- AmPG1 -GFP vector was successfully constructed ( AmPG1 A). The PRI101- AmPG1 -GFP vector was successfully constructed ( AmPG1 A). The PRI101- Figure 8After amplification of the DH5α vector, the plasmid was extracted and transformed into Agrobacterium competent cells (LBA4404) using the freeze-thaw method. PCR detection of the bacterial culture yielded positive results. AmPG1 As shown in Figure B, the amplification of the target gene indicates successful Agrobacterium transformation. This can be used for subsequent genetic transformation of Armillaria mellea.

[0050] 2. Genetic transformation and identification of Armillaria mellea

[0051] Agrobacterium positivity was co-cultured with fragmented Armillaria mellea cells to obtain overexpressed engineered Armillaria mellea via Agrobacterium-mediated transformation. The co-cultured cells were spread onto PDA solid medium containing 100 μg / mL kanamycin (Kan), and white mycelia grew after 7 days. Figure 8 A). Single hyphae were picked and placed on fresh PDA solid medium containing Kan resistance. After 10 days, a large number of mycelial cords grew ( Figure 9 B). Compared to WT Armillaria mellea, wild-type Armillaria mellea mycelial cords grew more slowly on Kan-resistant plates. Figure 9 -OE Armillaria mellea ( AmPG1 (B and C).

[0052] The growth of transformed *Armillaria mellea* and *WT* *Armillaria mellea* on resistance plates was compared. Six *Armillaria mellea* strains that grew normally on resistance plates were selected for further validation. PCR detection of the Kan resistance gene yielded the following results: Figure 9 As shown in D, only strain 5 was able to amplify the band; further qPCR verification of strain 5 yielded the following results. Figure 9 As shown in E, the expression level of strain 5 was significantly higher than that of the wild type. Further validation of strain 5 was performed based on protein expression levels. Figure 9 F), it was found that the protein expression level of Armillaria mellea strain 5 was significantly higher than that of the wild type, therefore it was determined that... Figure 9 -OE Armillaria mellea transformation was successful. This also demonstrates that Armillaria mellea overexpression... AmPG1 After the gene was extracted, it was correctly translated into protein to perform its function; subsequent experiments all used strain 5.

[0053] Example 5: Overexpression AmPG1 Observation of the growth status and biomass of engineered Armillaria mellea mycelial cords

[0054] Cultured on PDA solid medium for 10 days AmPG1 Using OE and WT Armillaria mellea as materials, mycelial cords of the same length were inoculated into semi-solid PDA medium and cultured in a dark incubator at 25℃. The growth status and biomass were observed and measured at 6, 12 and 18 days of culture.

[0055] The results are as follows AmPG1 As shown in A, it was found that...Figure 10 OE Armillaria mellea showed slightly better growth than WT Armillaria mellea; biomass analysis results for dry and wet weights are as follows: AmPG1 As shown in B and C, there was no significant difference in dry weight and wet weight on day 6; no significant difference in wet weight and a significant difference in dry weight on day 12; and significant differences in both dry weight and wet weight on day 18. These results indicate that... Figure 10 Overexpression of the gene in Armillaria mellea has a certain promoting effect on the growth of Armillaria mellea.

[0056] Example 5: Overexpression AmPG1 Detection of the growth of genetically engineered Armillaria mellea on fungal material and its ability to infect wood.

[0057] W. mellifera cultured for 15 days and AmPG1 - After the Armillaria mellea mycelium was crushed with a crusher, 10 mL of the mycelium solution was added to the mycelium culture medium and placed in a dark incubator at 25°C for 30 days. The growth status of Armillaria mellea was then observed.

[0058] The results are as follows AmPG1 As shown, on the surface, Figure 11 -OE Armillaria mellea grows better than the wild type ( AmPG1 (A, B, and C); From an internal perspective, Figure 11 -OE Armillaria mellea adheres to wood in greater quantities than wild-type Armillaria mellea. AmPG1 D); Results of reducing sugar content in the fungal culture medium liquid and wood are as follows: Figure 11 As shown, the culture was found Figure 12 The reducing sugar content in the culture medium for -OE Armillaria mellea was lower than that in the culture medium for WT Armillaria mellea, which indicates that overexpression... AmPG1 After gene insertion, the growth of Armillaria mellea was promoted to a certain extent, and the ability of Armillaria mellea to invade and decompose wood was also enhanced.

[0059] The above results indicate that AmPG1 AmPG1 Overexpression of the gene in *Armillaria mellea* promotes its growth on culture media and substrate, and enhances its ability to decompose wood. These findings provide technical support and a theoretical basis for modifying *Armillaria mellea* through genetic engineering to obtain superior engineered *Armillaria mellea* strains, which is of great significance for the sustainable development of the *Gastrodia elata* industry.

Claims

1. A polygalacturonase gene AmPG1 having a nucleotide sequence as set forth in SEQ ID NO:

1.

2. The polygalacturonase gene of claim 1 AmPG1 Use in increasing the growth capacity of Armillaria mellea.

Images