Application of osstrl12 gene in the improvement of drought resistance and yield traits of rice

Abstract

The application provides application of an OsSTRL12 gene in synergistic improvement of drought resistance and yield traits of rice, and belongs to the technical fields of biological genes and rice breeding. The nucleotide sequence of the OsSTRL12 gene is shown as SEQ ID NO:1, and the amino acid sequence of the encoded protein of the OsSTRL12 gene is shown as SEQ ID NO:2. Compared with a wild type (WT), the survival rate of an OsSTRL12 gene overexpression plant (OsSTRL12-OE) under drought stress induced by PEG and nutrient soil is significantly higher than that of the wild type plant (WT), the accumulation of physiological indexes such as proline content, soluble sugar content, superoxide dismutase activity and reduced malondialdehyde content is improved, and meanwhile, there is no significant difference in single plant yield, plant height and tiller number between the OsSTRL12 gene overexpression plant and the wild type plant, which proves that the overexpression of the OsSTRL12 rice can enhance the drought resistance while the yield is not reduced. The OsSTRL12 gene is a potential new target for studying the mechanism of improving the drought resistance of rice.

Description

TECHNICAL FIELD

[0001] The application relates to the field of biological genes and rice breeding, and particularly relates to application of an OsSTRL12 gene in drought resistance and yield trait of rice. BACKGROUND

[0002] Rice is one of the most important food crops in the world. In recent years, with the change of climate, the available fresh water resources are reduced. Because rice has a high requirement for water, drought will seriously affect the yield of rice. Meanwhile, solving the contradiction between resistance and yield has been a research hotspot. The improvement of crop resistance is accompanied by the possible decrease of yield. Yield traits and stress resistance traits are often antagonistic, so it is of great significance to study how crops balance yield and resistance. Therefore, it is of great significance to explore the drought response related genes of rice and clarify the regulation mechanism for breeding drought-resistant rice with high efficiency of water resources.

[0003] The ability of plants to perceive water deficit signals and initiate coping strategies is defined as drought resistance. Drought resistance is a complex trait, which is carried out through several mechanisms: one is escape. Escape refers to accelerating the plant propagation stage before stress, mainly through reducing tillering and flowering early. At present, two drought resistance mechanisms, drought avoidance and drought tolerance, are widely concerned. Drought avoidance mainly relies on developed root system to absorb water from deep soil or reduce transpiration under drought stress. Drought tolerance refers to the ability of crops to tolerate low water potential and maintain a certain level of physiological activity and growth and development, mainly through increasing intracellular osmotic substances to maintain cell turgor pressure, and reducing the accumulation of harmful substances by regulating the activity of cell defense enzymes.

[0004] Secondary metabolites play an important role in plant stress resistance in terms of drought resistance. For example, flavonoids, terpenes, alkaloids. Among them, strictosidine (STR) is a precursor compound of a variety of monoterpene alkaloid biosynthesis, which plays an important role in the defense mechanism of plants, and enhances the resistance of plants to biological or non-biological stress. In Catharanthus roseus, drought stress induces STR gene expression by up to 5.6 times, thereby reducing the drought damage suffered by the plant. Plant strictosidine synthase-like (SSL or STRL) gene is a class of genes closely related to the regulation of plant abiotic and biotic stress. At present, our limited understanding of the plant SSL family is mainly from Arabidopsis thaliana. Studies have shown that all categories of Arabidopsis thaliana strictosidine synthase-like AtSSL genes can respond to various biological and abiotic stresses, for example, AtSSL4-7 is up-regulated under osmotic stress. Most of the Populus PtrSSL genes are significantly up-regulated under drought stress. In general, although some reports show that the SSL gene family is related to plant stress response, the role of OsSSL gene in rice growth and development or response to biological / abiotic stress is not clear. SUMMARY

[0005] To overcome the problems in the related art, the purpose of the present application is to provide the application of OsSTRL12 gene in the synergistic improvement of drought resistance and yield traits of rice. OsSTRL12 is of great significance to improve the drought resistance of rice and can be used as a new target for improving the drought resistance of rice.

[0006] Application of OsSTRL12 gene in improving the drought resistance of rice.

[0007] Application of OsSTRL12 gene overexpression without affecting yield traits.

[0008] OsSTRL12 gene is introduced into rice by transgenic means, and overexpression strains are screened, so that crops with enhanced drought resistance and no effect on yield traits can be obtained.

[0009] In the preferred technical solution of the present application, the nucleotide sequence of the OsSTRL12 gene is shown in SEQ ID NO: 1.

[0010] In the preferred technical solution of the present application, the amino acid sequence of the encoded protein of the OsSTRL12 gene is shown in SEQ ID NO: 2.

[0011] In the preferred technical solution of the present application, the improvement of the drought resistance of rice is to improve the survival rate of rice under PEG-induced drought stress.

[0012] In the preferable technical scheme of the present application, the improvement of drought resistance of rice is to improve the survival rate of rice under the condition of drought stress in nutrient soil.

[0013] In the preferable technical scheme of the present application, the improvement of drought resistance of rice is to improve the survival rate of rice under the condition of drought stress in nutrient soil.

[0014] The application of the rice OsSTRL12 gene in improving proline content, soluble sugar content, antioxidant enzyme activity and reducing MDA content under the condition of PEG simulated drought stress.

[0015] In the preferable technical scheme of the present application, the improvement of drought resistance of rice is to improve the survival rate of rice under the condition of drought stress in nutrient soil.

[0016] The application of the rice OsSTRL12 gene in improving proline content, soluble sugar content, antioxidant enzyme activity and reducing MDA content under the condition of PEG simulated drought stress.

[0017] In the preferable technical scheme of the present application, the improvement of drought resistance of rice is to improve the survival rate of rice under the condition of drought stress in nutrient soil.

[0018] In the preferable technical scheme of the present application, the improvement of drought resistance of rice is to improve the survival rate of rice under the condition of drought stress in nutrient soil.

[0019] The beneficial effects of the present application are:

[0020] (1) The present application clones the OsSTRL12 gene (the corresponding gene locus number corresponds to LOC_Os07g42250 published in Rice Genome Annotation Project) from rice by the method of PCR. The OsSTRL12 gene is of great significance to improve the drought resistance of rice and can be used as a new target for improving the drought resistance of rice.

[0021] (2) The present application transfers the OsSTRL12 gene into rice by genetic transformation and screens to obtain overexpression lines OE-2 and OE-3. The phenotypes of the overexpression lines OE-2 and OE-3 are analyzed in detail.

[0022] (3) The results show that, compared with the wild type (WT), the survival rate of the OsSTRL12 gene overexpression plant (OE-2) under the conditions of simulated drought and drought in nutrient soil is significantly higher than that of the wild type plant (WT). It is inferred that OsSTRL12 positively regulates the drought response of rice.

[0023] (4) It can improve the resistance of plants to drought stress caused by PEG, improve the proline content, soluble sugar content, superoxide dismutase activity and reduce the accumulation of malondialdehyde content.

[0024] (5) In yield traits, the single plant yield, plant height and tiller number of the overexpression of OsSTRL12 rice had no significant difference compared with wild type (WT). It was inferred that the yield of overexpression of OsSTRL12 rice would not be reduced.

[0025] It can be seen that OsSTRL12 gene is a potential new target for studying drought resistance mechanism of rice. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Figure 1 is the performance of overexpression of OsSTRL12 under simulated drought treatment; wherein, Figure a is the drought treatment phenotype of wild type plant (WT) and overexpression line OE-2; Figure b is the survival rate statistical result diagram of wild type plant (WT) and overexpression line OE-2 after drought treatment;

[0027] Figure 2 Figure 2 is the performance of overexpression of OsSTRL12 under drought treatment in nutrient soil culture; wherein, Figure a is the drought treatment phenotype of wild type plant (WT) and overexpression line OE-2; Figure b is the survival rate statistical result diagram of wild type plant (WT) and overexpression line OE-2 after drought treatment;

[0028] Figure 3 Figure 3 is the detection of physiological indexes of overexpression of OsSTRL12 after simulated drought treatment; wherein, Figure a is proline content, Figure b is soluble sugar content, Figure c is malondialdehyde content, and Figure d is antioxidant enzyme activity.

[0029] Figure 4 Figure 5 is the statistical analysis of yield traits of overexpression of OsSTRL12. Figure a is the seed kernel length phenotype of wild type WT and overexpression of OsSTRL12 rice. Figure b is the seed kernel width phenotype of wild type and overexpression of OsSTRL12 rice. Figure c is the single plant yield phenotype of wild type and overexpression of OsSTRL12 rice. Figure d is the statistical analysis of kernel length. Figure e is the statistical analysis of kernel width. Figure f is the statistical analysis of seed setting rate. Figure g is the statistical analysis of thousand kernel weight. Figure h is the statistical analysis of single plant yield. WT: wild type rice; OE-2, OE-3: overexpression of OsSTRL12 rice (n = 60, the data in the figure is mean ± standard deviation. *p < 0.05, **p < 0.01, ***p < 0.001 indicates significant difference compared with WT.

[0030] Figure 5Figure a is the phenotype of agronomic traits of wild type WT and OsSTRL12 overexpression rice. Figure b is the plant height statistics of wild type and OsSTRL12 overexpression rice in autumn 2023. Figure c is the tiller number statistics of wild type and OsSTRL12 overexpression rice in autumn 2023. Figure d is the plant height statistics of wild type and OsSTRL12 overexpression rice in autumn 2022. Figure e is the tiller number statistics of wild type and OsSTRL12 overexpression rice in autumn 2022. Figure f is the plant height statistics of wild type and OsSTRL12 overexpression rice in spring 2022. Figure g is the tiller number statistics of wild type and OsSTRL12 overexpression rice in spring 2022; WT: wild type rice; OE-2, OE-3: OsSTRL12 overexpression rice (n = 60, **P < 0.01, ***P < 0.001 indicates significant difference compared with WT. DETAILED DESCRIPTION

[0031] Preferred embodiments of the present application will be described in more detail with reference to the drawings. Although the preferred embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present application is more thorough and complete, and the scope of the present application is fully conveyed to those skilled in the art.

[0032] Plant material: The test material of this study is japonica rice background (Oryza sativa L.). Wild type (WT) is Zhonghua 11 (ZH11) (publicly available rice variety, commercially available). The plant overexpression vector pRHV was provided by the Wang Guoliang group of the Chinese Academy of Agricultural Sciences (the plant overexpression vector pRHVcGFP has been disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.); the genetic transformation of the above genetic material was constructed by Baige Gene Technology (Jiangsu) Co., Ltd. Strains and plasmids: The strain Escherichia coli DH5α used in the experiment was purchased from Guangzhou Chunni Co., Ltd.

[0033] Chemical reagents: Restriction endonuclease Kpnl, Spel, purchased from New England Biolabs Co.; high-fidelity enzyme KOD FX purchased from TOYOBO Co.; abm reverse transcription kit purchased from abm Biotechnology Co., Ltd.; gel recovery kit and plasmid extraction kit purchased from Jifan Biotechnology (Beijing) Co., Ltd.; 2x Taq PCR StarMix purchased from Beijing Kangruncheng Biological Technology Co., Ltd. PCR product purification kit purchased from Shenguo Bioengineering (Shanghai) Co., Ltd.

[0034] The analysis of the whole genome by the basic structure of STR1 showed that rice contained at least 21 OsSTRL genes. So far, only two genes have been reported to have functions. OsSTRL2 was reported to play an important role in anther development and pollen wall formation. OsSTRL7 controls the length of endosperm and is also indirectly involved in carbohydrate transport from source to sink. There is no relevant research on drought stress for rice SSL genes at present.

[0035] Example 1: Construction of OsSTRL12 overexpression plant

[0036] The plant overexpression vector pRHVcGFP was provided by the Wang Guoliang group of Chinese Academy of Agricultural Sciences (the plant overexpression vector pRHVcGFP was disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.).

[0037] 1. Construction of pRHVcGFP-OsSTRL12 overexpression vector

[0038] (1) Amplification of target gene

[0039] The cDNA of WT leaf was taken as the template (according to the operation manual of abm reverse transcription kit), and the primers were designed according to the target gene (Table 1). The target gene was obtained by PCR amplification, and the PCR system was as shown in Table 2:

[0040] Table 1: Primers for PCR amplification of target fragments

[0041]

[0042] Table 2: PCR reaction system of target gene

[0043] Reaction solution Volume (μL) Template 2 μL 2× KOD FX buffer 25 μL Primer OsSTRL12-OE-F / R (10 μM) 1.5 μL 2 mM dNTPs 10 μL High-fidelity enzyme KOD FX 1 μL ddH2O 9 μL Total volume 50 μL

[0044] The amplification program was as follows: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 68℃ extension for 60 s, 32 cycles; 68℃ final extension for 5 min, 16℃ hold for 1 min. After the reaction, 50 μL of the amplification product was added to a 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was imaged under UV light to check if the bands were amplified. If the target band was amplified, it indicated that the amplified fragment might contain the target gene. The target band was then cut, and the product was purified by gel extraction (following the instructions of the gel extraction kit) and its concentration was determined.

[0045] (2) Preparation of linearized carriers

[0046] Take 3 μg each of the overexpression vector pRHVcGFP and the target gene (according to the instructions of the plasmid extraction kit). Add the corresponding restriction endonuclease to both reaction systems and double-digest at 37℃ for 20 min. The reaction systems for the overexpression vector pRHVcGFP and the target gene are shown in Table 3.

[0047] Table 3: Enzyme digestion reaction system

[0048] Reaction solution Amount 10× CutSmart buffer 5 μL Kpn I endonuclease 1 μL Spe I endonuclease 1 μL Overexpression vector pRHVcGFP / target gene 3 μg Total volume make up to 50 μL with ddH2O

[0049] 50 μL of the reaction product was added to a 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was irradiated with a UV imager. After the target band was separated, it was cut off and the product was recovered and purified by gel electrophoresis and the concentration was determined.

[0050] (3) Recombination reaction

[0051] use MultiS Enzyme Premix (from a multi-fragment one-step rapid cloning kit, purchased from Shanghai Yisheng Biotechnology Co., Ltd.) homologous recombinase was used to recombine the insert fragment and vector in a specific ratio to obtain the pRHVcGFP-OsSTRL12 overexpression vector. The optimal molar ratio of vector to insert fragment was 1:(2-3). The DNA mass corresponding to these molar numbers can be roughly calculated using the following formulas: Optimal vector usage X = [0.02 × number of vector base pairs] ng (0.03 pmol). Optimal insert fragment usage Y = [0.04 × number of insert fragment base pairs] ng (0.06 pmol) or = [0.06 × number of insert fragment base pairs] ng (0.09 pmol). The recombination reaction system is shown in Table 4.

[0052] Table 4: Recombination Reaction System

[0053]

[0054] After the system is prepared, use a pipette to gently pipette the mixed components, and briefly centrifuge to collect the reaction solution at the bottom of the tube. Place it at 50°C for 20 min. The reaction product can be directly converted or stored at -20°C for future use.

[0055] (4) Recombination product conversion and plating

[0056] Refrigerate the clonal competent cells DH5α on ice. Take 10 μL of the cooled recombination product (pRHVcGFP-OsSTRL12 overexpression vector) and add it to 100 μL of the competent cells, mix gently by flicking the tube wall, and place it on ice for 30 min; heat shock at 42°C for 60 s, incubate in an ice bath for 2 min, add 900 μL of LB medium, shake at 37°C and 200 rpm for 30 min, centrifuge at 5000 rpm for 3 min, and discard the supernatant. Resuspend the bacterial cells with the remaining medium, and gently spread them on a plate containing kan resistance using a sterile spreader. After the bacterial solution is absorbed, invert the plate and incubate it at 37°C overnight.

[0057] (5) Clonal identification

[0058] The most convenient and fastest method is colony PCR. Use a sterile gun or toothpick to pick a single colony into 500 μL of LB medium and mix it, and directly take 1 μL as the PCR template. The remaining bacterial solution is used for subsequent sequencing identification. The PCR reaction system is shown in Table 5.

[0059] Table 5: Colony PCR reaction system

[0060]

[0061]

[0062] The amplification program is as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 25 cycles; 72°C total extension for 5 min, and 16°C for 1 min. After the reaction is completed, take 20 μL of the amplified product and add it to a 1% agarose gel containing nucleic acid dye for electrophoresis; after electrophoresis, take a photo of the gel on an ultraviolet imaging instrument to detect whether a band is amplified. If a band is amplified, the clone is sent to a sequencing company for sequencing (sequencing is completed by Guangzhou Ruibo Biotechnology Co., Ltd.), and the sequencing primer is:

[0063] UbiP-seq: TTTTAGCCCTGCCTTCATACGC;

[0064] GFP-seqR: AACTTGTGGCCGTTTACGTCG.

[0065] 2. Genetic transformation and identification of transgenic plants

[0066] The constructed pRHVcGFP-OsSTRL12 overexpression vector is sent to Jiangsu BGI- Tech Co., Ltd. for genetic transformation to obtain T0 generation plants. The obtained transgenic plants are identified. Since the pRHVcGFP-OsSTRL12 overexpression vector carries a HYG hygromycin marker, it is only necessary to determine whether the transgenic plants are by identifying whether there is a hygromycin marker. The total genomic DNA of the plant to be tested is extracted, and the primer HYG (Table 6) is used for PCR amplification. The band size of the PCR product is determined by running agarose gel electrophoresis. If it is consistent, it is a transgenic plant containing the target gene (i.e. OsSTRL12 gene overexpression plant). The PCR amplification method refers to the PCR reaction system and PCR amplification procedure in step (1) of the plant pRHVcGFP-OsSTRL12 overexpression vector construction method. After the reaction is completed, 5 μL of the amplification product is added to a 1% agarose gel containing a nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on a UV imager to observe whether there is a target band. The T0 generation plants are selfed to obtain T1 generation plants, and the T1 generation plants are selfed to obtain T2 generation homozygous OsSTRL12 gene overexpression plants (OsSTRL12-OE).

[0067] Table 6: HYG identification primer

[0068]

[0069] In this embodiment, the OsSTRL12 gene is cloned from rice by PCR method. The OsSTRL12 gene is of great significance to improve the drought resistance of rice and can be used as a new target for improving the drought resistance of rice. The OsSTRL12 gene is introduced into rice by genetic transformation, and overexpression lines OE-2 and OE-3 are screened. The phenotype of the overexpression lines OE-2 and OE-3 is analyzed in detail.

[0070] Example 2: Phenotype analysis of OsSTRL12 under PEG drought stress

[0071] In this embodiment, the phenotype of wild type (WT) and OsSTRL12 overexpression plants (OE-2) under PEG6000 simulated drought stress is analyzed.

[0072] Tested rice: wild type (WT) and OsSTRL12 overexpression plants (OE-2).

[0073] The specific steps are as follows: just after the emergence of rice (Zhonghua 11) and OsSTRL12 overexpression plants (OE-2) are placed in a 96-well plate with holes at the bottom, one seed is placed in each well, and each of the two strains is placed in six columns, and then placed in a culture box containing rice nutrient solution, and cultured at 28°C under light (16 hours of light / 8 hours of darkness), and after the rice seedlings grow to 2 weeks old, 20% concentration of polyethylene glycol 6000 (PEG6000) is used to simulate drought stress for 5 days, and then rice nutrient solution is added to recover for 7 days. The survival and death of the seedlings of each strain are counted, and the survival rate is calculated. Each rice variety is repeated three times. The test method, preparation method and drought resistance principle of the OE-2 type overexpression plant and the OE-3 type overexpression plant are the same.

[0074] The results are shown in Figure 1 Figure 1 The scale is 10 cm. Each rice variety is repeated three times, and ** indicates that compared with the wild type (WT), * indicates that it is significant, ** indicates that it is extremely significant, n=3. Phenotypic analysis found that the growth state of the OsSTRL12 overexpression plant (OE-2) and the wild type (WT) before treatment was consistent, and after treatment and recovery, the wild type (WT) and the OsSTRL12 overexpression plant (OE-2) all showed different degrees of damage, and nearly half of the seedlings wilted and died, but the damage to the OsSTRL12 overexpression plant (OE-2) was lighter Figure 1 a). The survival rate is counted Figure 1 b), the survival rate of the wild type (WT) is 10%, and the survival rate of the OsSTRL12 overexpression plant (OE-2) is 30.1%, which is significantly higher than that of the wild type (WT), indicating that the overexpression of OsSTRL12 can improve the drought resistance of rice under drought stress.

[0075] The results of this example verify that the survival rate of the OsSTRL12 gene overexpression plant (OE-2, OE-3) is significantly higher than that of the wild type plant (WT). It is inferred that OsSTRL12 positively regulates the drought response of rice.

[0076] Example 3: OsSTRL12 nutrient soil drought stress phenotype analysis.

[0077] The present application sows wild type (WT) and OsSTRL12 overexpression plant (OsSTRL12-OE) in Guangzhou, Guangdong Province, South China Agricultural University Farm, and performs phenotype under nutrient soil drought stress after harvesting.

[0078] The tested rice is wild type (WT) and OsSTRL12 overexpression plant (OE-2).

[0079] ​The specific steps are as follows: the seeds of rice (Zhonghua 11) and OsSTRL12 overexpression plants (OE-2) are soaked in water at 28-30℃ for 2 days, and then the germinated seedlings with similar vigor are planted in boxes containing a mixture of nutrient soil and vermiculite and grown for 2 weeks. Then, the seedlings are subjected to drought stress without water supply until the leaves and stems wither, and then watered for 5 days. The survival and dead seedlings of each strain are counted, and the survival rate is calculated. Each rice variety is repeated twice. The test mode, preparation method and drought resistance principle of the OE-2 type overexpression plant and the OE-3 type overexpression plant are the same.

[0080] The results are shown in Figure 2 Figure 2 The scale is 10 cm. Each rice variety is repeated twice, and ** indicates that compared with the wild type (WT), * indicates significant, ** indicates extremely significant, n=3. Phenotypic analysis found that the growth state of the OsSTRL12 overexpression plant (OE-2) before treatment and the wild type (WT) was consistent, and after treatment and rehydration, the wild type (WT) and the OsSTRL12 overexpression plant (OE-2) all showed different degrees of damage, and nearly half of the seedlings withered and died, but the damage of the OsSTRL12 overexpression plant (OE-2) was lighter Figure 2 a). The survival rate is counted Figure 2 b), the survival rate of the wild type (WT) is about 19%, and the survival rate of the OsSTRL12 overexpression plant (OE-2) is about 36%, which is significantly higher than that of the wild type (WT), indicating that the overexpression of OsSTRL12 can improve the drought resistance of rice under drought stress.

[0081] The results of this example verify that the survival rate of the OsSTRL12 gene overexpression plant (OE-2, OE-3) is significantly higher than that of the wild type plant (WT). It is inferred that OsSTRL12 positively regulates the drought response of rice.

[0082] Example 4: Physiological index determination of OsSTRL12 overexpression plant after PEG treatment

[0083] The wild type (WT) and OsSTRL12 overexpression plant (OsSTRL12-OE) are sown in the farm of South China Agricultural University in Guangzhou, Guangdong Province, and the phenotype under the simulated drought stress of polyethylene glycol 6000 (PEG6000) is observed after harvesting.

[0084] The rice to be tested: wild type (WT) and OsSTRL12 overexpression plant (OE-2 and OE-3).

[0085] ​The specific steps are as follows: Newly sprouting rice (Zhonghua 11) and OsSTRL12 overexpressing plants (OE-2 and OE-3) were placed in 96-well plates with holes at the bottom, one seed in each well. The plates were then placed in culture boxes containing rice nutrient solution and cultured at 28°C under light (16 hours light / 8 hours dark). After the rice seedlings had grown for two weeks, they were treated with 20% polyethylene glycol 6000 (PEG6000) to simulate drought for 6 hours before sampling. Proline (PRO) assay kits, plant malondialdehyde (MDA) assay kits, plant soluble sugar kits, and SOD detection kits were used for detection (proline (PRO) assay kit (catalog number A107-1-1), plant malondialdehyde (MDA) assay kit (catalog number A003-3-1), and plant soluble sugar kit (catalog number A145-1-1) were all purchased from Nanjing Jiancheng Biotechnology Research Institute). Each rice variety was tested three times.

[0086] The results are as follows Figure 3 As shown, each rice variety was replicated three times. Significance was determined using a letter-based method after multiple comparisons. The largest mean was labeled with the letter 'a', and all insignificant differences were labeled with the same letter 'a' until a significantly different mean was encountered, which was then labeled with the letter 'b'. The comparison continued downwards, and so on. Under drought conditions, proline and soluble sugars can protect plants from drought and salt stress and slow the decline in water potential. In OsSTRL12 overexpressing plants (OE-2 and OE-3) after drought treatment, the contents of proline and soluble sugars were significantly upregulated. Malondialdehyde (MDA) can be used to measure the degree of damage to plant cell membranes caused by abiotic stress. This indicator is related to membrane damage; a higher MDA value indicates greater damage to the cell membrane. Compared to wild-type (WT), OsSTRL12-overexpressing plants (OE-2 and OE-3) showed lower malondialdehyde (MDA) accumulation levels after drought treatment, while exhibiting higher superoxide dismutase (SOD) activity. SOD activity is associated with reactive oxygen species (ROS) scavenging capacity; higher SOD activity indicates a stronger ability to scavenge ROS and lower plant damage. The lower the damage experienced by OsSTRL12-overexpressing plants under drought conditions compared to WT suggests that OsSTRL12-overexpressing plants enhance drought tolerance in rice by increasing antioxidant enzyme activity and reducing MDA content.

[0087] Table 7: Comparison of proline content, soluble sugar content, and MDA

[0088]

[0089] Proline (Pro) is one of the components of plant proteins and widely exists in plant body in free state. Under stress conditions such as drought and salinity, a large amount of proline accumulates in many plants. In addition to being an osmotic regulator in plant cytoplasm, the accumulated proline plays an important role in stabilizing the structure of biological macromolecules, reducing cell acidity, relieving ammonia toxicity, and regulating cell oxidation-reduction potential as an energy reservoir. Under adverse conditions such as drought, salinity, heat, cold, and freezing, the content of proline in plants increases significantly. The content of proline in plants to some extent reflects the resistance of plants, and the drought-resistant varieties tend to accumulate more proline. Therefore, the determination of proline content can be used as a physiological index for drought-resistant breeding. Similarly, the content of soluble sugar is also the same.

[0090] MDA can be used to measure the degree of damage of plant cell membrane caused by abiotic stress. After drought treatment, the accumulation of MDA in OE-2 and OE-3 is lower than that in WT, indicating that the damage is less. High SOD (superoxide dismutase) activity indicates strong repair ability under drought stress.

[0091] The above results show that the high proline content and soluble sugar content and low MDA accumulation in OsSTRL12 overexpression plants confirm that OsSTRL12 positively affects the drought response of rice at the physiological level.

[0092] The results of the present embodiment verify that the OsSTRL12 gene can improve the resistance of plants, especially rice, to drought stress caused by PEG, increase the content of proline, soluble sugar, superoxide dismutase activity, and reduce the accumulation of MDA content.

[0093] Example 5: Statistics of yield traits of OsSTRL12 overexpression plants

[0094] The present application sowed japonica rice varieties wild type (WT) and OsSTRL12 overexpression plants (OsSTRL12-OE) in Guangdong Province, Guangzhou, South China Agricultural University Farm, and conducted yield trait statistics at the mature stage and after seed collection.

[0095] Tested rice: wild type (WT) and OsSTRL12 overexpression plants (OE-2 and OE-3).

[0096] The specific steps are as follows: The rice planted in the experimental materials in the Wushan campus of South China Agricultural University Research Base was counted for plant height and tiller number at the mature stage for three seasons. The grain length and width of rice were measured using a digital rice sorting machine (Guangfeng Optoelectronics, China), with a measurement repetition number of greater than or equal to 20 plants, and more than 500 grains per repetition. The thousand-grain weight was repeatedly measured more than 20 times, with more than 500 grains per repetition.

[0097] The results are as follows:Figure 4 and 5 The results showed that the grain length of wild type and overexpression lines were 8.01 mm, 7.99 mm, 8.19 mm, respectively, the grain width of wild type and overexpression lines were 3.52 mm, 3.41 mm, 3.51 mm, respectively, and the length-width ratio were 2.27, 2.33, 2.33, respectively. Figure 4 a, d, e). The grain length of OE-3 was longer than that of WT, while the grain width of OE-3 had no significant change. The grain width of OE-2 was narrower, while the grain length of OE-2 had no significant change. The seeds of two overexpression lines showed the phenotype of elongated. There was no significant difference in seed setting rate between wild type and overexpression lines Figure 4 f). For the thousand-grain weight, the thousand-grain weight of OE-3 was significantly higher than that of wild type, while there was no significant difference for OE-2. The change of the thousand-grain weight of OE-3 might be due to the elongation of grain length, which led to the enlargement of seeds. Finally, the yield per plant was calculated, and there was no significant difference between OE-2 and OE-3 and wild type. The agronomic traits of plant height and effective tiller number of OsSTRL12 were calculated in three seasons. The results showed that Figure 5 ), under the same season and growth conditions, there was no significant difference in plant height and tiller number between OE-2 and OE-3 and wild type.

[0098] The foregoing description of various embodiments of the application has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the application to the precise form disclosed, and various modifications and variations are possible in light of the above teachings. It is intended that the scope of the application be limited not with this detailed description, but rather by the claims appended hereto.

[0099] The above description is only preferred embodiments of the application and is not intended to limit the application. The application can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the application shall be included in the protection scope of the application.

Claims

1. OsSTRL12 The application of genes in improving drought resistance of rice, characterized in that, The nucleotide sequence of the OsSTRL12 gene is shown as SEQ ID NO:

1.

2. The method of claim 1, OsSTRL12 The application of the gene in improving drought resistance of rice, characterized in that, The OsSTRL12 The amino acid sequence of the encoded protein of the gene is set forth in SEQ ID NO:

2.

3. The method of claim 1, OsSTRL12 The application of the gene in improving drought resistance of rice, characterized in that, OsSTRL12 4. The method of claim 1, The improvement of drought resistance of the rice is to improve the survival rate of the rice under the drought stress caused by PEG. The application of the gene in improving drought resistance of rice, characterized in that, OsSTRL12 5. The method of claim 1, The improvement of drought resistance of the rice is to improve the survival rate of the rice under the drought stress caused by PEG. The application of the gene in improving drought resistance of rice, characterized in that, OsSTRL12 6. Use according to any one of claims 1 to 5, characterized in that, The improvement of drought resistance of the rice is to improve the survival rate of the rice under the drought stress caused by PEG.

7. Use according to claim 6, characterized in that, The rice is japonica rice. The japonica rice is Zhonghua 11.

Images