DNA template silver nanocluster label-free fluorescent logic circuit, biosensor and construction method thereof

Abstract

The present invention relates to a DNA template silver nanocluster label-free fluorescent logic circuit, a biosensor and a construction method thereof, belonging to the field of biotechnology. The present invention proposes a screened silver nanocluster DNA template sequence S n / m (C n ATATAC m ), in situ synthesis of S n / m ‑AgNC. Through complementary hybridization reaction, the G-rich base sequence is brought together with S n / m The spatial position of S-AgNC is close, and its fluorescence emission signal is significantly enhanced. The probe has the advantages of high signal-to-noise ratio, fast response kinetics and excellent stability. n / m AgNC probes were applied to Boolean logic circuits, and high-performance basic DNA and serial-parallel advanced logic circuits (DLCs) were developed. The computational reliability of different DLCs and the processing efficiency of signal conversion were significantly improved. Therefore, the present invention constructed a biosensor based on the DLC, which achieved high-performance and resolvable detection of two targets such as miRNA-21 and miRNA-141 at the same fluorescence emission wavelength.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a DNA template silver nanocluster label-free fluorescent logic circuit, a biosensor and a construction method thereof. Background Art

[0002] Programmable DNA logic circuits (DLCs) use DNA molecules as reaction substrates to perform data processing or signal transduction, thereby achieving the expected information processing. DLCs can not only construct molecular computing, but also realize purposeful analysis of biological systems through complex algorithmic instructions. Thanks to the solution of the Hamiltonian path problem, DLCs have been widely used to develop a variety of possible applications, such as digital circuit computing, molecular modular recognition, logical nanodevices, and cell signal regulation. At present, a variety of basic Boolean logic circuits (such as OR, AND, NAND, and XOR) have been constructed through toehold-mediated chain migration or enzyme-catalyzed reactions to meet different signal processing needs. Different basic logic gates can be used to construct multi-layer digital circuits through series or parallel stages to perform complex signal processing, such as adders / subtractors and parity checkers. However, traditional fluorescent-labeled signal probes have uncontrollable circuit leakage risks, enzyme-mediated circuit design may have nonspecific interference, and the calculation process of input conversion is cumbersome and time-consuming. These deficiencies seriously restrict the further development of DLC. Therefore, it is of great practical significance to explore enzyme-free reaction routes with low circuit leakage, screen efficient label-free signal probes, and construct high-performance DLCs.

[0003] Silver nanoclusters (DNA / AgNCs) synthesized with DNA templates of specific base sequences are label-free fluorescent signal probes with great application prospects. Due to their unique advantages such as significant photophysical properties, good biocompatibility, simple preparation and low cost, they have attracted widespread attention in many fields. The spectral behavior and fluorescence properties of DNA / AgNCs can be adjusted by specific base sequences and their secondary structures. These unique advantages of DNA / AgNCs provide great possibilities for solving the inherent deficiencies of quantum dots and fluorescent groups. Studies have shown that when a guanine (G)-rich DNA sequence is close to a non-fluorescent DNA / AgNC, its fluorescence emission can be significantly enhanced (i.e., "signal-on" type). Through DNA conformational transformation, chain migration or DNA complementary hybridization, it is easy to adjust the spatial distance between AgNC and the G-rich base sequence, customize the control of AgNC fluorescence emission "on" or "off", and achieve highly specific response signal output to specific inputs. Therefore, the flexible programmability of DNA / AgNCs has given them a wide range of application potentials in the fields of bioanalysis, transient dissipation, living cell imaging, environmental and food monitoring. However, there are few reports on the construction of enzyme-free, label-free, fast-operating integrated and advanced DLC Boolean logic circuits using the fluorescence signal output mode of G-rich in situ enhanced DNA / AgNCs. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a template sequence S of a new silver nanocluster. n / m (C n ATATAC m )S 5 / 4 -AgNC fluorescent signal probe. The probe exhibits advantages such as high signal-to-noise ratio, fast kinetics and high stability. 5 / 4 After combining with -AgNC, we developed high-performance basic DLC. Even if the computational complexity is increased by series or parallel connection, the reliability of their calculations and the efficiency of signal processing are significantly improved. Therefore, we proposed a biosensor based on the DLC, which realizes the detection of dual targets at only one fluorescence emission wavelength.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a silver nanocluster fluorescent signal probe, wherein the silver nanocluster fluorescent signal probe is formed by incubating a template signal chain of a silver nanocluster with AgNO3 and NaBH4, wherein the silver nanocluster template sequence in the template signal chain is C n ATATAC m, n / m=3 / 4, 4 / 4, 4 / 3, 3 / 3, 2 / 4, 4 / 2, 4 / 5 or 5 / 4, as a preferred embodiment, n / m=5 / 4.

[0007] In a further embodiment, the template signal chain of the silver nanocluster contains a silver nanocluster template sequence and a hybridization sequence.

[0008] The preparation method of the silver nanocluster fluorescent signal probe is as follows: incubate the prepared AgNO3 and the silver nanocluster template signal chain in a dark environment at 4°C. Quickly add the newly prepared NaBH4 solution to the incubated mixture and shake it quickly. Then place it in a dark environment for generating S n / m -AgNC.

[0009] The present invention also provides an application of the silver nanocluster fluorescent signal probe in constructing a programmable DNA logic circuit.

[0010] The present invention also provides a programmable DNA logic circuit constructed based on a silver nanocluster fluorescent signal probe. The logic circuit comprises a silver nanocluster fluorescent signal probe and a fluorescent signal enhancement chain;

[0011] The logic circuit uses whether the fluorescence signal enhancement chain can be complementary paired with the template signal chain of the silver nanocluster to perform logic operations and signal output.

[0012] If the fluorescence signal enhancement chain in the logic circuit can complementally pair with the template signal chain of the silver nanocluster and the fluorescence enhancement is higher than the threshold, the output signal is true, otherwise it is false.

[0013] In a further embodiment, the template signal chain of the silver nanocluster contains a silver nanocluster template sequence and a hybridization sequence one connected in sequence by 5'-3', and the fluorescence signal enhancement chain contains a hybridization sequence two and a guanine-rich sequence (G-rich sequence) connected in sequence by 5'-3', and the hybridization sequence two is complementary to the hybridization sequence one.

[0014] In a further embodiment, the logic circuit is an OR logic circuit, an AND logic circuit, an AND and INH logic circuit, or an AND-INH / AND logic circuit, etc.

[0015] The method for constructing the above logic circuit is: adding the fluorescent signal enhancement chain to the previously synthesized S n / m -AgNC solution and incubated at 37° C. The basic elements of the logic circuit adopt existing technology.

[0016] The present invention further provides an application of a silver nanocluster fluorescent signal probe in constructing a biosensor, and a biosensor constructed based on the silver nanocluster fluorescent signal probe. Specifically, the biosensor is constructed using the above logic circuit, and the biosensor can be used to detect dual-target miRNA. The logic circuit is an AND-INH / AND logic circuit, etc.

[0017] In a further optimized scheme, the biosensor contains silver nanocluster fluorescent signal probe 1, fluorescent signal enhancement chain 1, silver nanocluster fluorescent signal probe 2, fluorescent signal enhancement chain 2, and target miRNA 1 (such as miR-21) and target miRNA 2 (such as miR-141);

[0018] The silver nanocluster fluorescent signal probe 1 includes a silver nanocluster template sequence (C-rich sequence) and a hybridization sequence A connected in sequence from 5' to 3', and the fluorescent signal enhancement chain 1 includes a hybridization sequence B, a hybridization sequence C and a G-rich sequence connected in sequence from 5' to 3', the hybridization sequence A is complementary to the 5' end portion of miRNA1, and the hybridization sequence C is complementary to the 3' end portion of miRNA1;

[0019] The silver nanocluster fluorescent signal probe 2 includes a C-rich sequence, a hybridization sequence D, a hybridization sequence E and a hybridization sequence F connected in sequence from 5' to 3', and the fluorescent signal enhancement chain 2 includes a hybridization sequence G and a G-rich sequence connected in sequence from 5' to 3'. The hybridization sequence D is complementary to the 5' end portion of miRNA2, the hybridization sequence G is complementary to the 3' end portion of miRNA2, the hybridization sequence B is complementary to the hybridization sequence F, and the hybridization sequence C is complementary to the hybridization sequence E.

[0020] The silver nanocluster fluorescent signal probe 1 is: CCCCCATATACCCCCTGATAAGCTA; C-rich sequence: CCCCCATATACCCC, hybridization sequence A: CTGATAAGCTA;

[0021] Fluorescence signal enhancement chain 1: CAAGAGTCTCAACATCAGTGGGTGGGGTGGGGTGGGG; G-rich sequence: GGGTGGGGTGGGGTGGGG, hybridization sequence B: CAAGAGTC, hybridization sequence C: TCAACATCAGT.

[0022] Silver nanocluster fluorescent signal probe 2:

[0023] CCCCCATATACCCCAGACAGTGTTAACTGATGTTGAGACTCTTG; C-rich sequence: CCCCCATATACCCC, hybridization sequence D: AGACAGTGTTA, hybridization sequence E: ACTGATGTTGA, hybridization sequence F: GACTCTTG;

[0024] Fluorescence signal enhancement chain 2: CCATCTTTACCGGGTGGGGTGGGGTGGGG, G-rich sequence: GGGTGGGGTGGGGTGGGG, hybridization sequence G: CCATCTTTACC.

[0025] miRNA1: UAGCUUAUCAGACUGAUGUUGA;

[0026] miRNA2:UAACACUGUCUGGUAAAGAUGG.

[0027] The construction method of the biosensor is as follows: silver nanocluster fluorescent signal probe 1 is mixed with fluorescent signal enhancement chain 1. Then, miRNA 1 and miRNA 2 are introduced into the mixture for reaction. Then, silver nanocluster fluorescent signal probe 2 and fluorescent signal enhancement chain 2 are added to the above solution and incubated.

[0028] The beneficial effects of the present invention are:

[0029] The present invention has prepared S with multiple excellent properties for the first time. n / m -AgNC and cleverly integrate it into DLC to achieve low circuit leakage and efficient signal processing.

[0030] The present invention also uses the DLC-based biosensor for detecting different biomolecules, such as dual-target detection of miR-21 and miR-141, thereby improving the detection efficiency.

[0031] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0033] Figure 1 .S n / m -Schematic diagram of the hybridization reaction between AgNC fluorescent signal probe and GS.

[0034] Figure 2 .(AH)S 3 / 4 , S 4 / 4 , S 4 / 3 , S 3 / 3 , S 2 / 4 , S 4 / 2, S 4 / 5 , S 5 / 4 (I) Fluorescence intensity graph before and after the introduction of GS; (J) Corresponding signal-to-noise ratio bar graph.

[0035] Figure 3 .(A)S 5 / 4 -AgNC OR logic gate schematic; (B) Corresponding logic circuit and truth table. (C) IN2, IN3, S 5 / 4 、IN2 / S 5 / 4 、IN3 / S 5 / 4 、IN2 / IN3 / S 5 / 4 and PAGE image of DNA marker; (D) fluorescence emission spectrum, (E) corresponding normalized fluorescence intensity, (F) real-time fluorescence of OR logic gate; (G) TIRFM image.

[0036] Figure 4 .(A)S 5 / 4 -AgNC AND-INH logic circuit diagram; (B) corresponding logic circuit symbol and truth table; (C) IN4, S 5 / 4 、IN10、IN9、IN4 / IN10、S 5 / 4 / IN10、IN4 / S 5 / 4 / IN10, IN4 / IN9 / S 5 / 4 PAGE images of / IN10 and DNA marker; (D) fluorescence emission spectrum, (E) corresponding normalized fluorescence intensity and (F) corresponding real-time fluorescence.

[0037] Figure 5 (A) Schematic diagram of the miRNA-specific dual-response AND-AND-INH gate; (B) The corresponding logic circuit symbol, a modular switch for fluorescence switching (red and gray represent S 5 / 4 -AgNCs) reaction route and circuit diagram.

[0038] Figure 6 .AND-INH / AND logic circuit design. (A) Based on S 5 / 4 -Dual-pathway logic gate of AgNC signal probe; (B) Possible situations of AND-INH / AND logic circuit; (C) Truth table; AND-INH / AND is used to analyze (D) miR-21 and (E) miR-141 fluorescence kinetic data; AND-INH / AND is used to analyze (F) miR-21 and (G) miR-141 fluorescence emission spectra and (H) corresponding normalized fluorescence intensities. DETAILED DESCRIPTION

[0039] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0040] Drugs and reagents used in this example: silver nitrate (AgNO3, 99.98%), sodium borohydride (NaBH4, 98%), disodium phosphate (Na2HPO4, 99%), potassium dihydrogen phosphate (KH2PO4, 99.5%) and magnesium nitrate hexahydrate (Mg(NO3)2·6H2O, 99%) (McLean Biochemical Co., Ltd.); HPLC-purified DNA chains and microRNAs (Table 1) were purchased from Shanghai Shenggong Biotechnology Co., Ltd.; DNA powder was diluted with phosphate buffer (PBS, pH 7.4) containing 20mM Na2HPO4, 20mM KH2PO4 and 5mM Mg(NO3)2·6H2O; DNA loading buffer (Beijing Dingguo Changsheng Biotechnology Co., Ltd.); polyacrylamide gel staining used GelRed dye (Shanghai Biyuntian Biotechnology Co., Ltd.). Ultrapure deionized water (18.2MΩ) was obtained from ATsrese ultrapure water machine.

[0041] In this embodiment, the fluorescence test is as follows: the excitation slit width is set to 5 nm and the emission slit width is set to 10 nm, the voltage is set to 900 V, the excitation wavelength is set to 550 nm, and the two-dimensional emission spectrum of the wavelength is collected at 580-700 nm. The real-time fluorescence is continuously monitored for 60 min, and the S 5 / 4 -AgNC (synthesized using 5'-C5ATATAC4CATATCAAATTTATTATACTTCTT-3' as a template) had a maximum fluorescence intensity at 600 nm, and the real-time fluorescence intensities of all samples were normalized.

[0042] Fluorescence test The fluorescence emission spectra were measured using a Hitachi F-7100 fluorescence spectrophotometer (Tokyo, Japan) and a BioTek Synergy H1 (California, USA), with the setting parameters of 900 V photomultiplier voltage, 5 nm excitation slit, and 10 nm emission slit.

[0043] In the embodiment, all logic circuits are in PBS buffer using S 5 / 4 -AgNC as a fluorescent signal probe to achieve the establishment of a general platform. Unless otherwise specified, in all logic circuits, input and S 5 / 4 The final concentration of -AgNC is 1.0 μM. The basic elements of each basic logic gate in the embodiment are all based on the existing technology.

[0044] Example 1 Construction of logic circuit

[0045] 1. Optimization of template sequence of S-AgNC

[0046] like Figure 1 As shown, the template signal chain S used to generate silver nanoclusters consists of a silver nanocluster template sequence at the 5' end and a hybridization sequence 1 at the 3' end. The template sequence contains a cytosine-rich sequence (C-rich sequence) and an AT linker (ATATA). The template signal chain S is incubated with AgNO3 and NaBH4 to form S-AgNC. Then, a guanine-rich signal enhancement chain GS chain is added. After the GS chain is hybridized with the S chain in the S-AgNC, an obvious fluorescence emission peak can be observed at 600nm through 555nm fluorescence excitation. The GS used in this embodiment consists of a hybridization sequence 2 at the 5' end and a guanine-rich sequence (G-rich sequence, GGGTGGGGTGGGGTGGGG) at the 3' end. The hybridization sequence 2 is complementary to the hybridization sequence 1 in the template signal chain S.

[0047] In order to obtain the best fluorescence performance, we optimized the template sequence in S-AgNC. n / m (C n ATATAC m ).

[0048] In this embodiment, S n / m The GS sequences are shown in Table 1.

[0049] Table 1 Oligonucleotide base sequences used in the examples

[0050]

[0051] like Figure 2 As shown, in the test S n / m -AgNC (n / m = 3 / 4, 4 / 4, 4 / 3, 3 / 3, 2 / 4, 4 / 2, 4 / 5 or 5 / 4), S 5 / 4 -AgNCs exhibited superior fluorescence properties and have the potential to be used in the construction of logic circuits.

[0052] In this embodiment, the steps of hybridization of unlabeled S-AgNC silver nanoclusters with GS for fluorescence testing are as follows:

[0053] 10 μL of AgNO3 (60 μM) prepared with ultrapure water and 10 μL of S chain (10 μM) were incubated in a dark environment at 4°C for 30 minutes. 10 μL of NaBH4 solution (60 μM) prepared with ultrapure water was quickly added to the incubated mixture and rapidly shaken for 60 seconds. After that, it was placed in a dark environment for 1.0 h to generate S-AgNC. 10 μL of 10 μM GS was added to the previously synthesized S-AgNC solution and fluorescence test was performed after incubation at 37°C for 1.0 h.

[0054] Example 2 Based on S 5 / 4 - Construction of logic gates of AgNC

[0055] Thanks to S 5 / 4 -AgNC has excellent performance. We use it to construct various basic logic gates. This embodiment takes OR logic gate and AND and INH logic circuits as examples.

[0056] 1. OR logic gate

[0057] The OR logic gate construction process is as follows:

[0058] In PBS buffer, use S 5 / 4 -AgNC (final concentration 1.0 μM) was used as a fluorescent signal probe to realize the establishment of OR logic gate. Specifically, 10 μL of AgNO3 (60 μM) prepared with ultrapure water was mixed with S 5 / 4 The chain (10 μM, 10 μL) was incubated in a dark environment at 4°C for 30 minutes. 10 μL of NaBH4 solution (60 μM) prepared with ultrapure water was quickly added to the incubated mixture and rapidly shaken for 60 seconds. After that, it was placed in a dark environment for 1.0 h to generate S 5 / 4 The input containing the G-rich fragment was added to the previously synthesized S-AgNC solution and incubated at 37°C for 1.0 h. The final concentration of the input was 1.0 μM.

[0059] The inputs of the OR logic gate in this embodiment are: IN2 and IN3. IN2 consists of a hybridization sequence three at the 5' end and a G-rich sequence (GGGTGGGGTGGGGTGGGG) at the 3' end, and IN3 consists of a hybridization sequence four at the 5' end and a G-rich sequence at the 3' end. Both the hybridization sequence three and the hybridization sequence four can react with S 5 / 4 The sequences of IN2 and IN3 are shown in Table 1.

[0060] The OR logic gate outputs a high signal when any input is present. The working principle, truth table and logic circuit symbol of the OR logic gate of this embodiment are shown in FIG. Figure 3 A and Figure 3 As shown in B. Figure 3 It can be seen from the PAGE images of different DNAs in C that IN2, IN3 and S 5 / 4 The lanes showed a single DNA band, IN2, S 5 / 4 Mixed lanes and IN3, S 5 / 4 The mixed lanes showed a difference between IN2, IN3 and S 5 / 4 A single band at a higher position on the single strand indicates IN2 / S 5 / 4 and IN3 / S 5 / 4 Double-stranded formation. 5 / 4 , IN2 and IN3 mixed lanes showed the same 5 / 4 Mixed lanes and IN3, S 5 / 4 Similar bands in mixed lanes indicate IN2 / S 5 / 4 and IN3 / S 5 / 4 Exist at the same time.

[0061] Fluorescence detection results showed that the input IN2 and / or IN3 containing G-rich fragments could be combined with S 5 / 4 -AgNC hybridization, forming S 5 / 4 / IN2 double strand and / or S 5 / 4 / IN3 double stranded, making the G-rich fragments 5 / 4 -AgNCs are brought close together, thereby enhancing fluorescence ( Figure 3 D and E). This characterization result is consistent with the PAGE result. In addition, real-time fluorescence showed fast reaction kinetics ( Figure 3 F). Corresponding to different input conditions, S 5 / 4 The corresponding results can be observed in the TIRFM images of -AgNCs ( Figure 3 G).

[0062] The above results demonstrate the successful construction of the OR logic gate.

[0063] 2. AND and INH logic circuits with three inputs

[0064] The construction process of AND and INH logic circuits is as follows:

[0065] In PBS buffer, use S 5 / 4 -AgNC (final concentration 1.0 μM) was used as a fluorescent signal probe to construct an AND and INH logic circuit with three inputs. The circuit consisted of two basic logic gates, AND and INH, connected in series. Specifically, 10 μL of AgNO3 (60 μM) prepared in ultrapure water was mixed with S 5 / 4The chain (10 μM, 10 μL) was incubated in a dark environment at 4°C for 30 minutes. 10 μL of NaBH4 solution (60 μM) prepared with ultrapure water was quickly added to the incubated mixture and rapidly shaken for 60 seconds. It was placed in a dark environment for 1.0 hour to generate S 5 / 4 The three inputs were added to the previously synthesized S-AgNC solution and incubated at 37°C for 1.0 h. The final concentration of the inputs was 1.0 μM.

[0066] The inputs of the AND logic gate are IN4 and IN10; the inputs of the INH logic gate are IN9 and the output of the AND logic gate. IN4 consists of a hybridization sequence V at the 5' end and a G-rich sequence at the 3' end; the hybridization sequence V of IN4 can complementarily hybridize with a partial sequence of IN10, and IN9 can complementarily hybridize with a partial sequence of IN10. 5 / 4 The hybridization sequence of IN4, IN9 and IN10 can partially hybridize with IN10. The specific sequences of IN4, IN9 and IN10 are shown in Table 1.

[0067] like Figure 4 As shown in A, in the absence or presence of only one input, IN9 / IN10 and S are not formed. 5 / 4 The hybrid complex makes S 5 / 4 -AgNC cannot approach the G-rich sequence. Therefore, no obvious signal change is observed. When two inputs (IN4 / IN9, IN4 / IN10, or IN9 / IN10) are present, only the IN4 / IN10 group can observe fluorescence. However, when three inputs (IN4 / IN9 / IN10) are input together, due to the presence of IN9 and S 5 / 4 -AgNC chain migration will inhibit fluorescence. The corresponding logic circuit symbol and truth table are shown in Figure 4 B. In addition, PAGE was used to verify the mutual hybridization of the logic circuit DNA chains ( Figure 4 C) IN4, S 5 / 4 , IN9 and IN10 have their own unique stripes. IN4 / IN10, S 5 / 4 / IN10 respectively, a higher band appeared in the mixture, IN4, IN10 and S 5 / 4 The position of the stripe after the three are mixed is higher than that after the two of them are mixed, indicating that the assembly of the AND logic gate is successful. Then, IN9 is introduced into IN4, IN10 and S 5 / 4 In the middle and later parts, a brighter and taller band appears, as well as a line with S 5 / 4 Similar bands in separate lanes indicate that IN9 can replace S 5 / 4 .

[0068] The fluorescence detection results showed that the fluorescence emission spectrum and the corresponding emission intensity were consistent with the expected results of the designed AND-INH ( Figure 4 D, E and F), its real-time fluorescence spectrum shows a fast response process and the corresponding results are similar to the emission spectrum.

[0069] The above results demonstrate the successful construction of AND and INH logic circuits with three inputs.

[0070] Example 3 Construction of miRNA Biosensor

[0071] The biosensor of this embodiment contains a series / parallel circuit (AND-INH / AND) combining three logic circuit elements. The circuit is composed of two basic logic gates, AND and INH, connected in series and connected in parallel with another AND logic gate. It only needs one fluorescence wavelength to excite and analyze two targets (miR-21 and miR-141, which are overexpressed in malignant tumors). Figure 5 ).

[0072] The logic circuit of the biosensor of this embodiment is in PBS buffer, using S 5 / 4 -AgNC (final concentration 1.0 μM) was constructed as a fluorescent signal probe. miR-21 and GS1, miR-141 and GS2 are the inputs of two AND logic gates, respectively. Specifically, the silver nanocluster solution (30 μL, 3.33 μM) synthesized with the S1 chain as the template signal chain was mixed with 10 μL of the guanine-rich signal enhancement chain GS1 (10 μM). After that, 10 μL of the mixture of miR-21 (10 μM) and miR-141 (10 μM) was introduced and reacted for 1.0 h, and then the fluorescence was measured. Next, the silver nanocluster solution (30 μL, 3.33 μM) synthesized with the S2 chain as the template signal chain and 10 μL of the guanine-rich signal enhancement chain GS2 (10 μM) were added to the above solution, and the fluorescence was measured after incubation for 1.0 h. The synthesis method of the silver nanocluster solution is the same as that in Example 1.

[0073] In the above logic circuit, the template signal chain S1 is composed of a C-rich sequence (CCCCCATATACCCC) and a hybridization sequence A (CTGATAAGCTA) (5'-3'), and its hybridization sequence A is complementary to the 5' end of miR-21, and the signal enhancement chain GS1 is composed of a hybridization sequence B (CAAGAGTC), a hybridization sequence C (TCAACATCAGT), and a G-rich sequence (GGGTGGGGTGGGGTGGGG) (5'-3'), and its hybridization sequence C is complementary to the 3' end of miR-21;

[0074] Template signal chain S2 consists of a C-rich sequence, a hybridization sequence D (AGACAGTGTTA), a hybridization sequence E (ACTGATGTTGA) and a hybridization sequence F (GACTCTTG) (5'-3'), wherein the hybridization sequence D is complementary to the 5' end of miR-141, and signal enhancement chain GS2 consists of a hybridization sequence G (CCATCTTTACC) and a G-rich sequence (5'-3'), wherein the hybridization sequence G is complementary to the 3' end of miR-141, the hybridization sequence B of GS1 is complementary to the hybridization sequence F of S2, and the hybridization sequence C of GS1 is complementary to the hybridization sequence E of S2. The sequences of miR-21, miR-141, S1, GS1, S2 and GS2 are shown in Table 1.

[0075] In the above biosensors, when miR-21 is present, miR-21 can interact with the generated S 5 / 4 -AgNC's template signal chain S1 (S1) and signal enhancement chain 1 (GS1) complement each other to generate miR-21 / S1 / GS1, and obtain enhanced fluorescence signal A. When miR-141 is present, miR-141, template signal chain 2 (S2) and signal enhancement chain 2 (GS2) are hybridized to obtain similar enhanced fluorescence (signal B). At the same time, since the introduction of S2 can replace GS1 from the hybridization product of miR-21 / S1 / GS1, S 5 / 4 -AgNC separates from the G-rich fragment and the A signal disappears. From the corresponding logic circuit symbol, the AND logic gate (miR-21 and GS1) is connected in series to the INH logic gate, and the INH logic gate is connected in parallel to the AND logic gate (miR-141 and S2).

[0076] In addition, we simplified the reaction route through two modular schematic diagrams, including four reaction results and circuit diagrams ( Figure 5 ) to better illustrate the dual-response AND-INH / AND logic gate suitable for miRNAs analysis.

[0077] like Figure 6 As shown in A, GS1 and S1 that can output signal A are first added to the initial system (miR-21 or miR-141), and then S2 and GS2 are introduced to monitor the corresponding output signal B by enhancing fluorescence. Therefore, there are four possible signal output situations ( Figure 6 B) Finally, the corresponding S 5 / 4 -Signal readout of AgNC signal probe, logic "0" or "1" indicates that the fluorescence intensity is lower or higher than the threshold. When the input miR-21 is "1", A is true; if the input miR-141 is "1", B is true, otherwise it is false. The truth table is as follows Figure 6 C. The fluorescence kinetics showed that the signal readout time was very short (t < 30 min) ( Figure 6 D and 6E), indicating its rapid response ability. From the fluorescence spectrum ( Figure 6 F and 6G) ​​and the corresponding intensity histograms ( Figure 6 H) It can be found that the double input (1,1) can produce obvious double-response fluorescence signals, and the single input ((0,1) or (1,0)) can produce independent strong fluorescence signals. Without input (0,0), there is no obvious fluorescence signal, which shows that based on S 5 / 4 -AgNC series / parallel circuits can handle different input conditions well and output the expected results. 5 / 4 -AgNC series / parallel circuits were used to prepare biosensors for detecting miRNA.

[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. A silver nanocluster fluorescent signal probe, characterized in that: The silver nanocluster fluorescent signal probe is formed by incubating the template signal chain of the silver nanocluster with AgNO3 and NaBH4, wherein the template signal chain contains a silver nanocluster template sequence and a hybridization sequence 1; the silver nanocluster template sequence in the template signal chain is C n ATATAC m , n / m=5 / 4.

2. Use of the silver nanocluster fluorescent signal probe according to claim 1 in constructing a programmable DNA logic circuit.

3. A programmable DNA logic circuit constructed using the silver nanocluster fluorescent signal probe according to claim 1, characterized in that: The logic circuit includes a silver nanocluster fluorescent signal probe and a fluorescent signal enhancement chain; the logic circuit uses whether the fluorescent signal enhancement chain can be complementary paired with the template signal chain of the silver nanocluster to perform logical operations and signal output; If the fluorescence signal enhancement chain in the logic circuit can complementarily pair with the template signal chain of the silver nanoclusters and the fluorescence enhancement is higher than the threshold, the output signal is true; otherwise, it is false.

4. The programmable DNA logic circuit according to claim 3, characterized in that: The template signal chain of the silver nanocluster contains a silver nanocluster template sequence and a hybridization sequence 1 connected in sequence from 5' to 3', and the fluorescent signal enhancement chain contains a hybridization sequence 2 and a guanine-rich sequence connected in sequence from 5' to 3', and the hybridization sequence 2 is complementary to the hybridization sequence 1.

5. Use of the silver nanocluster fluorescent signal probe according to claim 1 in constructing a biosensor for detecting miRNA.

6. A biosensor constructed based on silver nanocluster fluorescent signal probe, characterized in that: The biosensor is constructed by using the logic circuit described in claim 3 or 4, and is used to detect dual-target miRNAs, and the logic circuit is an AND-INH / AND logic circuit; the biosensor contains a silver nanocluster fluorescent signal probe 1, a fluorescent signal enhancement chain 1, a silver nanocluster fluorescent signal probe 2, a fluorescent signal enhancement chain 2, and target miRNA1 and target miRNA2; The silver nanocluster fluorescent signal probe 1 includes a silver nanocluster template sequence and a hybridization sequence A connected in sequence from 5' to 3', and the fluorescent signal enhancement chain 1 includes a hybridization sequence B, a hybridization sequence C and a guanine-rich sequence connected in sequence from 5' to 3', the hybridization sequence A is complementary to the 5' end portion of miRNA1, and the hybridization sequence C is complementary to the 3' end portion of miRNA1; The silver nanocluster fluorescent signal probe 2 includes a silver nanocluster template sequence, a hybridization sequence D, a hybridization sequence E and a hybridization sequence F connected in sequence from 5' to 3', and the fluorescent signal enhancement chain 2 includes a hybridization sequence G and a G-rich sequence connected in sequence from 5' to 3'. The hybridization sequence D is complementary to the 5' end portion of miRNA2, the hybridization sequence G is complementary to the 3' end portion of miRNA2, the hybridization sequence B is complementary to the hybridization sequence F, and the hybridization sequence C is complementary to the hybridization sequence E.

7. The biosensor constructed based on silver nanocluster fluorescent signal probe according to claim 6, characterized in that: The silver nanocluster fluorescent signal probe 1 is: CCCCCATATACCCCCTGATAAGCTA; hybridization sequence A: CTGATAAGCTA; Fluorescence signal enhancement chain 1: CAAGAGTCTCAACATCAGTGGGTGGGGTGGGGTGGGG; hybridization sequence B: CAAGAGTC, hybridization sequence C: TCAACATCAGT; Silver nanocluster fluorescent signal probe 2: CCCCCATATACCCCAGACAGTGTTAACTGATGTTGAGACTCTTG; Hybridizing sequence D: AGACAGTGTTA, hybridization sequence E: ACTGATGTTGA, hybridization sequence F: GACTCTTG; Fluorescence signal enhancement chain 2: CCATCTTTACCGGGTGGGGTGGGGTGGGG, hybridization sequence G: CCATCTTTACC; C-rich sequence: CCCCCATATACCCC, G-rich sequence: GGGTGGGGTGGGGTGGGG; miRNA1: UAGCUUAUCAGACUGAUGUUGA; miRNA2:UAACACUGUCUGGUAAAGAUGG.

Images