An RTA1 gene for enhancing plant resistance to aphids and its application

Abstract

The present invention discloses an RTA1 gene for enhancing plant resistance to aphids and its application, and relates to the technical field of plant genetic engineering. The RTA1 gene has a nucleotide sequence as shown in SEQ ID NO.1 in corn, and its encoded amino acid sequence is shown in SEQ ID NO.2. The gene belongs to a transcription factor gene, and knocking out the gene can effectively inhibit the growth and development of aphids. In addition, the RTA1 gene has good colinearity with homologous genes of other crops, and has high research and application value. The present invention provides important gene resources for developing natural insect-resistant strains of crops such as rice and wheat.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to an RTA1 gene for enhancing plant resistance to aphids and an application thereof. Background Art

[0002] Maize is one of the main food and cash crops. Throughout the growth period of maize, from the vegetative stage to the maturity stage, the development and production of maize are seriously threatened by pests. Among them, the corn leaf aphid (Rhopalosiphum maidis) is one of the most destructive pests of the maize phloem, which not only causes serious losses in maize yields, but also causes significant damage to the ecosystem. When feeding, aphids tentatively and continuously pierce the plant surface with their probes to find a suitable feeding position. The entire feeding process is then completed by sucking phloem sap to obtain nutrients. Phenotypically, aphid pests are relatively small and not particularly obvious in the early stages, but once an outbreak occurs, they can cause serious damage.

[0003] At present, in field management, aphid control mainly relies on pesticides, which is not only costly but also causes great damage to the environment. In ecology, the long-term and large-scale use of pesticides may kill the natural enemies of aphids and affect the ecological balance. Bacillus thuringiensis (Bt) products and genetically modified plants have a good killing effect on lepidopteran pests, but have been proven to be ineffective against aphids. Therefore, there is an urgent need to develop new natural insect-resistant corn, which is an effective and environmentally friendly way to resist aphids in crops and has important theoretical and practical significance. Summary of the invention

[0004] The purpose of the present invention is to provide an RTA1 gene for enhancing plant resistance to aphids and its application, to provide new materials for biological control of aphids, and to provide a theoretical basis and gene resources for developing aphid-resistant crop lines.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The first object of the present invention is to provide an RTA1 gene for enhancing plant resistance to aphids, wherein the nucleotide sequence of the RTA1 gene is any one of the following:

[0007] (I) the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3; or

[0008] (II) a complementary sequence of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3; or

[0009] (III) a sequence encoding the same protein as the nucleotide sequence of (I) or (II) but differing from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or

[0010] (IV) A nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences of the nucleotide sequence of (I) or (II), and a homologous gene sequence with the same or similar function as the nucleotide sequence of (I) or (II).

[0011] As a further optimization scheme of the present invention, the RTA1 gene is derived from corn, and its nucleotide sequence is shown in SEQ ID NO.1. The CDS is 1200 bp in length. The gene can be directly cloned from crops or obtained by artificial synthesis. The encoded amino acid sequence is shown in SEQ ID NO.2, encoding a total of 399 amino acids.

[0012] As a further optimization scheme of the present invention, the RTA1 gene is derived from Arabidopsis thaliana, and its nucleotide sequence is shown in SEQ ID NO.3. The CDS is 1002 bp in length. The gene can be directly cloned from crops or obtained by artificial synthesis. The encoded amino acid sequence is shown in SEQ ID NO.4, encoding a total of 333 amino acids.

[0013] The second object of the present invention is to provide a use of any of the above RTA1 genes for enhancing plant resistance to aphids in breeding aphid-resistant plant varieties.

[0014] A further improvement is that the application is to use CRISPR knockout technology or screen homozygous plant varieties with RTA1 gene function deficiency from natural ecotypes during plant breeding to obtain aphid-resistant plant varieties.

[0015] A further improvement is that the plant includes at least one of corn, Arabidopsis, rice, wheat, rapeseed or sorghum, aiming to promote the testing and development of new insect-resistant strains in these important food crops and provide new insect-resistant materials.

[0016] The present invention has the following beneficial effects:

[0017] (1) The present invention provides an RTA1 gene that enhances plant resistance to aphids, and the gene RTA1 encodes a transcription factor protein. The present invention tested the insect resistance of mutants obtained by knocking out the corn RTA1 gene through CRISPR, and detected the survival rate, fecundity and honeydew excretion of aphids. The results showed that they were significantly lower than those of aphids grown on wild-type 707M. In addition, the present invention also conducted physiological and biochemical assays on the overexpression material RTA1-OE, and the results showed that RTA1-OE showed sensitivity to aphids. In addition, Arabidopsis mutants with mutant RTA1 homologs also showed consistent strong resistance to aphids.

[0018] (2) The present invention has developed a new type of aphid-resistant material based on the new function of the corn RTA1 gene, providing a genetic basis for the breeding of aphid-resistant corn varieties. The RTA1 mutation confers resistance to aphids on corn, making it possible to produce various types of aphid-resistant germplasms using CRISPR-mediated corn breeding genome editing technology.

[0019] (3) The RTA1 gene provided by the present invention has good colinearity with homologous genes of other crops and has high research and application value, providing important gene resources for developing natural insect-resistant strains of crops such as rice, Arabidopsis, wheat, rapeseed, and sorghum. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The electrophoresis diagram of the full-length amplification of RTA1 CDS (in the figure, lane 1 is a DNA marker (250bp-10000bp), lanes 2 and 3 are RTA1 gene fragments, and lane 4 is a negative control);

[0021] Figure 2 Results for the mutation sites in wild-type 707M and rta1 mutants;

[0022] Figure 3 shows the survival rate of aphids on wild-type 707M and rta1 mutant ( Figure 3a ),weight( Figure 3b ), reproductive rate( Figure 3c ) and honeydew secretion ( Figure 3d ) Statistical results;

[0023] Figure 4 shows the survival rate of aphids on wild-type B104 and overexpression material RTA1-OE ( Figure 4a ),weight( Figure 4b ), reproductive rate( Figure 4c ) and honeydew secretion ( Figure 4d ) Statistical results;

[0024] Figure 5 shows the phylogenetic tree analysis of maize ZmRTA1 and its Arabidopsis homolog AtRTA1 (5a), identification of mutant Atrta1 ( Figure 5b) and the statistical results of the dual-host selection of mutant Atrta1 ( Figure 5c ). DETAILED DESCRIPTION

[0025] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0026] 1. Materials and reagents

[0027] Unless otherwise specified, the materials and reagents used in this example can be obtained through commercial channels.

[0028] 2. Methods

[0029] No specific experimental method is specified in this example, and all experimental methods can be performed according to conventional methods.

[0030] 2.1 Cloning of the Maize RTA1 Gene

[0031] 2.1.1. Using wild-type corn B73 as material, RNA was extracted, and the extracted total RNA was reverse transcribed to synthesize the first-chain cDNA as a template for PCR amplification.

[0032] 2.2.2. According to the nucleotide sequence of the maize RTA1 gene shown in SEQ ID NO.1, specific amplification primers were designed, and amplification was performed using the designed specific primers to obtain the maize RTA1 gene fragment (the electrophoresis result is shown in FIG. Figure 1 The gene fragment was connected to the T cloning vector PEASY-T3 to obtain T3-RTA1 and transformed into Escherichia coli. The positive clones were picked and sequenced. The sequencing results were consistent with the predicted results. The amino acid sequence encoded by the corn RTA1 gene is shown in SEQ ID NO.2.

[0033] The primer sequences are shown in SEQ ID NO.5 and SEQ ID NO.6:

[0034] SEQ ID NO.5: RTA1-F: (5'>ATGATGAACCTATCGGCTGCCG<3');

[0035] SEQ ID NO.6: RTA1-R: (5'>CTAGTGATCGAAGTCGAGATCAAACA<3').

[0036] 2.2 Identification of maize mutant genes and their functions

[0037] 2.2.1. CRISPR / Cas9 technology was used for gene editing to knock out the RTA1 gene, and the aphid-resistant mutant rta1 was obtained. The oligonucleotide sequence of sgRNA (SEQ ID NO.7) was 5'>GCGGAGACTAAGTGGGCTGTA<3'. The sequence was introduced into the knockout vector by PCR amplification, and transformed into the wild-type 707M background by Agrobacterium infection. The obtained transgenic strains were amplified and sequenced for identification. The amplification primers were designed in the same way as 2.1.2. The results showed that in the rta1 mutant, there were 4 base deletions in the first exon, resulting in protein inactivation ( Figure 2 ).

[0038] 2.2.2. Aphids were inoculated into the wild-type 707M and rta1 mutants at the four-leaf stage, and the survival rate, fecundity, body weight and honeydew excretion of aphids were calculated. The specific method is:

[0039] For the survival experiment, rta1 mutants and wild-type 707M were planted in separate pots. At the four-leaf stage, 20 wingless adult aphids were placed on the pulvinus of the second leaf of each plant, and the number of aphids on each plant was counted every day for one week.

[0040] For fecundity assays, aphid inoculation was performed in a similar manner to the survival experiment, except that only one day-old aphid was placed on the pulvinus of the second leaf of each plant. The number of days from birth to first reproduction, the number of aphids per day for 10 consecutive days of reproduction, and the total number of aphids after 30 days were recorded.

[0041] For the body weight weighing experiment, the aphid inoculation method was similar to the survival rate. The aphids that had grown for 7 days were taken out, and 5 aphids were randomly selected and weighed, and the average value was taken to obtain the weight of a single aphid.

[0042] For the honeydew experiment, aphid inoculation was performed in a similar manner to the survival experiment. Twenty wingless adult aphids were placed on each plant. To collect the honeydew secreted by aphids, a filter paper was placed horizontally on the stem of each corn plant. Two days later, the filter paper was collected, treated with 0.1% (w / v) ninhydrin in acetone solution (to stain the honeydew spots purple), and dried at 60°C for 30 min. The purple spots were counted using Image J software.

[0043] The results are as follows Figure 3a , 3b As shown in 3c and 3d, the experimental results show that the survival rate, fecundity, body weight and honeydew secretion of aphids grown on the rta1 mutant are significantly lower than those grown on the wild-type 707M. Therefore, it is shown that the corn rta1 mutant can significantly inhibit the growth and development of aphids.

[0044] 2.2.3. The Ubi promoter was used to drive the 3×Flag tag and the DNA sequence of the target gene RTA1 to construct the RTA1-OE overexpression vector. The RTA1-OE overexpression vector was introduced into the wild-type corn B104, and positive transgenic seedlings were screened and amplified using specific primers for verification.

[0045] The specific primer sequences for amplification verification are shown in SEQ ID NO.8 and SEQ ID NO.9:

[0046] SEQ ID NO.8: RTA1-F: (5'>ATGATGAACCTATCGG CTGCCG<3');

[0047] SEQ ID NO.9: NOS-R: (5'>ATCGGGGAAATTCGAGCT<3');

[0048] The next step of the experiment was to inoculate aphids on the four-leaf stage wild-type B104 and overexpression material RTA1-OE, and the survival rate, fecundity, body weight and honeydew secretion of aphids were calculated in the same way as in 2.2.2. The results are as follows: Figure 4a , 4b , 4c and 4d, it can be seen from the experimental results that RTA1-OE is sensitive to aphids.

[0049] 2.3. RTA1 phylogenetic tree analysis

[0050] The phylogenetic tree analysis of maize ZmRTA1 was performed using Mega.7 software. The results are as follows: Figure 5a The results showed that the maize ZmRTA1 gene was very closely homologous to the Arabidopsis RTA1 gene, and it was speculated that the functions of the RTA1 gene in maize and Arabidopsis might be relatively conservative. The nucleotide sequence of the Arabidopsis RTA1 gene is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4.

[0051] 2.4 Functional verification of Arabidopsis RTA1 gene

[0052] Arabidopsis thaliana Atrta1 (SAIL_816_E01.v1) mutants were ordered from NASC and identified as homozygous mutants ( Figure 5b ), aphids were inoculated on wild-type Col-0 and mutant Atrta1, and double-host selection was performed. Atrta1 and Col-0 were planted in the same pot in a greenhouse at 22°C, 16h light / 8h dark, and then an equal number of aphids were inoculated in the contact area between the two plants. The number of aphids was counted after 48h of free selection. The results are shown in Figure 5cAs shown, it can be seen from the test results that after 48 hours, there were almost no aphids on the mutant Atrta1, and almost all aphids were freely transferred to the wild type Col-0.

[0053] 3. Conclusion

[0054] The mutants obtained by knocking out the corn RTA1 gene through CRISPR showed significantly lower survival rate, fecundity and honeydew excretion than the wild type 707M in aphids. In addition, the overexpression material RTA1-OE showed sensitivity to aphids. This shows that the RTA1 gene mutant material can significantly inhibit the growth and development of aphids. It is worth noting that Arabidopsis mutants with mutant RTA1 homologs also showed consistent strong resistance to aphids, indicating that the RTA1 gene has good colinearity with homologous genes of other crops, has high research and application value, and provides important gene resources for the development of natural insect-resistant strains of crops such as rice and wheat.

[0055] The specific embodiments described herein are merely examples of the present invention. Those skilled in the art may make various modifications to the specific embodiments described. For example, methods for obtaining insect-resistant strains of Arabidopsis thaliana RTA1 gene mutant materials by knocking out RTA1 homologous genes in economic crops such as rapeseed, corn, rice and sorghum using CRISPR and other technical means are all within the scope of protection of the present invention.

Claims

1. A RTA1 The use of a gene in breeding aphid-resistant plant varieties is characterized in that: The application is to use CRISPR knockout technology to obtain RTA1 A homozygous plant variety with a missing gene function, thereby obtaining an aphid-resistant plant variety, wherein the aphid-resistant plant variety is corn or Arabidopsis; When the plant is corn, the RTA1 A gene having a nucleotide sequence as shown in SEQ ID NO.1 or a complementary sequence, or a sequence encoding the same protein as the nucleotide sequence as shown in SEQ ID NO.1 but different from the nucleotide sequence as shown in SEQ ID NO.1 due to the degeneracy of the genetic code; When the plant is Arabidopsis thaliana, the RTA1 The gene has a nucleotide sequence as shown in SEQ ID NO.3 or a complementary sequence, or a sequence that encodes the same protein as the nucleotide sequence as shown in SEQ ID NO.3 but is different from the nucleotide sequence as shown in SEQ ID NO.3 due to the degeneracy of the genetic code.

Images