Molecular marker for identifying pumpkin affinity strength of rootstock and primer and application thereof

Abstract

The application discloses a molecular marker for identifying the affinity of pumpkin rootstocks, a primer thereof and application of the molecular marker. The promoter region of CalS1 gene is cloned, and it is found through comparison that an inserted base difference exists at a base 298 bp away from a start codon; the inserted base of a good affinity rootstock material is a CC base, and the inserted base of a poor affinity rootstock material is an AC base. After the inserted base at the position is formed, an Mnll enzyme cutting site (recognition site CCTC N7) is formed, specific primers are designed before and after the sequence at the site, and PCR amplification is carried out; the number and size of bands are observed through electrophoresis after enzyme cutting, a new and dominant CAPS marker capable of distinguishing the rootstock materials with different affinities is established, and the established enzyme cutting molecular marker is preliminarily applied to identification and screening of the affinities of pumpkin rootstock germplasm resources, thereby laying a foundation for future pumpkin rootstock dominant breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of crop trait information and molecular genetic marker analysis, in particular to a molecular marker for identifying the grafting affinity of pumpkin. BACKGROUND

[0002] Cucumber is one of the important facility vegetables in the world, and also the main melon vegetables in China, which has high nutritional value and economic value. The low temperature and weak light in winter, high humidity, and soil-borne diseases caused by continuous cropping in the sunlight greenhouse are the main factors limiting the current cucumber production. Pumpkin (Cucurbita moschata) is often used as a rootstock for grafting with cucumber to improve the stress resistance of cucumber and effectively improve the commodity nature and nutritional quality of cucumber fruit. However, there are many types of rootstock varieties used in production, but there is a lack of specialized varieties, and the effects of different varieties after grafting with cucumber are different, which is reflected in the difference in grafting affinity between the rootstock and the scion. Grafting cucumber with pumpkin as a rootstock has extremely important significance for improving the non-biological stress resistance of cucumber and reducing the occurrence of soil-borne diseases.

[0003] The existing methods for improving the grafting affinity of horticultural products mostly control the external conditions of the grafting combination of rootstock and scion after grafting, such as controlling the temperature and humidity, light, nutrient supply, and pathogen control of the environment after grafting. However, grafting affinity is not limited to external environmental factors, and the main factor affecting plant grafting affinity is genetic factor. The grafting affinity of plants shows diversity and complexity. When grafting involves two different species, the closer the biological taxonomy of the rootstock and the scion, the higher the degree of physiological and biochemical similarity, and the higher the survival rate of grafting, the more grafting affinity. Grafting technology is a widely used method of plant asexual reproduction, but current research on grafting affinity mainly focuses on physiological mechanisms, and research on molecular mechanisms is relatively less. In the identification of grafting affinity of rootstock, artificial grafting test has a long process, is labor-intensive, has multiple determination indicators, and is low in efficiency. Moreover, the external environment affecting the growth and development of grafting symbiont is variable and uncontrollable, which requires maintaining the reliability of the test and the experience of the test personnel. DNA molecular genetic marker technology uses the difference in DNA fragments in the genome to achieve screening and identification, which is a direct reflection of DNA-level genetic polymorphism, and can accurately determine the differences between individuals. It is an accurate, efficient, and rapid marker that is currently superior to morphological markers and biochemical markers. With the popularization and development of modern plant production theory and technology, molecular marker technology is widely used in crop trait identification and molecular marker-assisted breeding in the process of horticultural crop production.

[0004] Therefore, in order to explore more effective molecular biology methods to quickly identify the grafting seedling production test of stock affinity, improve the identification accuracy and efficiency, the different affinity stock materials are used as test materials, the CalS1 closely related to the affinity traits is used as the research subject, the coding region of CalS1 gene of 30 pumpkin core germplasm is cloned and resequenced, the SNP site is found, the specific primer of site marker sequence is designed for PCR amplification, the amplification fragment is sequenced and analyzed to find the enzyme digestion site, so as to establish a new, can distinguish the size of the grafting seedling production test of stock affinity, and the established enzyme digestion molecular marker is applied to the identification and screening of the affinity of pumpkin germplasm resources, and lays a foundation for the future pumpkin advantage breeding. SUMMARY

[0005] The application develops a molecular marker for identifying the affinity of pumpkin stock, the method of the application combines modern plant production theory and technology, uses the difference of DNA fragments in the genome to achieve the screening purpose, is suitable for grafting identification of stock affinity test, and realizes efficient and rapid detection of the identification of grafting stock material.

[0006] In order to achieve the above object, on the basis of the previous experiment, it is found that when the pumpkin / cucumber grafting healing body enters the symbiotic affinity period, the callose synthase in the callose metabolism process in the grafting combination shows a significant negative correlation with the symbiotic affinity of the stock, and the subsequent further grafting test is used to verify the above experimental results. On the basis of a large number of physiological experiments, the regular difference of callose synthase CalS1 gene DNA is explored. After cloning and multiple sequence alignment of callose synthase CalS1 gene, it is found that there are some regular base differences.

[0007] The promoter region of the CalSl gene (Cp4.1 LG20g07750, Cucurbit Genomics Database http: / / cucurbitgenomics.org / ) was cloned (1459 bp before the CDS region) with the sequence information: gactgaagaactgaggcatcgtccatggtgggtgagtgccgccatttcccgcttccacctttctcgtcttttacctgtgactaaaatactactgactttctatttcaataaaattgaatcgtggttagtactagaatagtatcctgcctagacctgggttcgatctccggctgatgcatgttttttttttataaaattgttttccattttcgttaaaatttataattttagaagattatgtttttatatggctgactttagacccttacgatcggatgcacctgcgccgaatgccctaattagccatcgtcgctgctcgttccgattcgagaatgaacgcatcgttgaattcaggaatggttttctctgaaggtacatacaaagatggtttttctgttttctgttctttcaagtgattcaattttcttgagttctttggtcacgatgttcctcgcagacatagccgacggaagtgattcggatacgaattccgctgaaggatcggattactacgagccgatctcggccattgatggtgaagaatccgatgaagctggatcagatgacgaaacttacagctccgatactcatttgcaccatttacccaacggttgccgtgtagagaatgcagtttcgtctcttagcctgaacgacgatgtggagagaagatgcagtgatgaggaagaggaggagagcatgagagaggcttctgattcagcgattagaatggcgtttagagaggatgagactcggagaaatgcgccgctgtcgccggagaatgcgacgaggatcatggaggccatgcgcggcatctcatttggcggctctgctccagattggactcggattgtatctgaggatcgttggattgatcaacttcgaaggcttaggcaaacccctacctctcccaataatttcggaaattgagagatggaactctcatcatttcaaaattcagatcccagtcttaattcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttccaatcatagaattgtcatatgactctccgattatcctcttgaataaagatccttctgggttttggtttgcgaacagttcatccatttcccaatcacatgtgctctcttcgatctcataattaagtgtcat t caacttatgcttgaaagaaaaccgaagtcgtgactttcaagggagctgcttgcttcaagcttaagcttaagcttcttcaagccagaatatgatgtctgcacttttgtctaatggctcaaagctcaaaatagagaattgaattggtgatatgttagatcgaatgtttctcggttcttgaattcaaactctctgccttccttcccctttgtgttttctttgttacttgtatcctatggggcagaagtcatctgtaatatttgatgaaattgaagggactgatggaagtttccattatca (SEQ ID NO.3, insertion site is underlined bases)

[0008] By comparison, we found that there were 2bp insertion base differences at 298bp from the start codon (i.e. between 1161 and 1162bp of SEQ ID NO. 3), the good affinity stock material inserted base was CC base, and the poor affinity stock material inserted base was AC base. After the insertion base occurred at this position, an Mnll enzyme cutting site (recognition site CCTC N7) was formed. In this experiment, SnapGene (Version 6.0.2) software was used to screen primer design parameters for the CalS1-SNP mutation site which had been sequenced and completed sequence alignment: the amplification product fragment size was 400-500bp, the primer length was not more than 28bp, the annealing temperature was 50-65℃, and after the primer design was completed, it was sent to Nanjing Qikexi Biological Technology Co., Ltd. for primer synthesis. The primer name, sequence and enzyme cutting site are shown in Table 1 below.

[0009] Table 1 Primer name, mutation site and enzyme cutting amplification polymorphism primer sequence

[0010]

[0011] Subsequently, the genomic DNA of 30 pumpkin rootstocks was extracted by using a conventional CTAB method, and a primer in Table 1 was used for system optimization and comparison, and a 25-mL reaction system was used, in which 12.5 mL of GoTaq DNA Polymerase, 0.5 mL of template DNA, 0.5 mL of upstream and downstream primers, and sterile water were added to complete the reaction system.

[0012] After the optimal PCR system was selected, the total DNA of 30 pumpkin rootstocks was used as a template, and a primer was used for PCR cloning detection. The PCR procedure was as follows: pre-denaturation at 94℃ for 5 min (denaturation at 94℃ for 30 s, annealing at Tm-2℃ for 30 s, and extension at 72℃ for 40 s) for 35 cycles, final extension at 72℃ for 10 min, and 4℃. The PCR product was added to the corresponding enzyme cutting reagent components, 37℃ water bath heating was performed for 15 min, and then agarose gel electrophoresis was used for detection.

[0013] The technical scheme of the present application can be implemented by the following technical scheme:

[0014] A molecular marker primer for identifying the affinity strength of pumpkin rootstocks, wherein the upstream primer is shown in SEQ ID NO. 1, and the downstream primer is shown in SEQ ID NO. 2.

[0015] The molecular marker primer is used for identifying the affinity strength of pumpkin rootstocks.

[0016] A method for identifying the affinity strength of pumpkin rootstocks, wherein the genomic DNA of pumpkin rootstocks is amplified by using the molecular marker primer, the amplification product is cut by Mnll, different materials present enzyme cutting polymorphism, the enzyme cutting product is subjected to agarose gel electrophoresis, the high-affinity variety only presents two bands with sizes of 98 and 292 bp, the medium-affinity variety presents two bands with sizes of 98 and 292 bp, or presents three bands with sizes of 98, 292 and 390 bp, and the low-affinity variety is not successfully cut and presents a single band with a size of 390 bp.

[0017] As a preferred embodiment of the present application, the PCR amplification system is a 25-mL reaction system, in which 12.5 mL of GoTaq DNA Polymerase, 0.5 mL of template DNA, 0.5 mL of upstream and downstream primers, and sterile water are added to complete the reaction system.

[0018] As a preferred embodiment of the present application, the PCR reaction procedure is as follows: pre-denaturation at 94℃ for 5 min (denaturation at 94℃ for 30 s, annealing at Tm-2℃ for 30 s, and extension at 72℃ for 40 s) for 35 cycles, final extension at 72℃ for 10 min, and 4℃.

[0019] As a preferred embodiment of the present application, the enzyme digestion system of the Mnll enzyme digestion is: LightNingTM Mnll 1 μL, PCR product 10 μL, buffer 3 μL, ddH2O 16 μL, and the enzyme digestion reaction temperature is 37°C, and the enzyme digestion is incubated for 30 min by using a constant temperature water bath.

[0020] As a preferred embodiment of the present application, the enzyme digestion product is detected by using a 1.5% agarose gel, electrophoresis is performed at 175V for 25 min, and the results are observed and saved by using a gel imaging instrument.

[0021] Compared with the existing identification technology, the test method has the following advantages and beneficial effects:

[0022] (1) The specific primer designed in the present application can accurately identify the strength of the late symbiotic affinity between the pumpkin used as a stock and the scion in grafting production from the DNA level. The primer has high specificity, the enzyme digestion site is located in the promoter region, and the DNA identification is more rapid and accurate;

[0023] (2) The primer designed in the present application can greatly shorten the identification time. The pumpkin material used as a stock only needs to be simply germinated to obtain a DNA extraction sample material, and the specific operation can be completed within one day, which is rapid and accurate.

[0024] (3) Compared with traditional physiological and biochemical identification and other molecular identification technologies, enzyme digestion electrophoresis observation is more intuitive and practical, and has stronger application in actual production, and is more economical than gene sequencing. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Callose metabolism of 10 stocks of pumpkin (a: callose synthase activity; b: callose degrading enzyme activity; c: callose content);

[0026] Figure 2 Callose metabolism and correlation analysis of symbiotic affinity of pumpkin stocks;

[0027] Figure 3 Enzyme activity analysis of different affinity grafting combinations;

[0028] Figure 4 Callose staining section of stem of grafted seedlings;

[0029] Figure 5 Electrophoretogram of specific primer amplification sequence (390 bp);

[0030] Figure 6 Schematic diagram of enzyme digestion site;

[0031] Figure 7 Electrophoretogram of PCR product enzyme digestion of 10 stocks of pumpkin with different affinities;

[0032] Figure 8Figure 1 shows the electrophoretic map of the PCR products of 20 pumpkin rootstocks with different affinities;

[0033] Nos. 1 to 30 are varieties 18C0161, 18C0030, 18C0090, 18C0100, 18C0024, 18C0110, 18C0051, 18C0170, 18C0147, 18C0145, 18C0160, 18C0151, 18C0178, 18C0198, 18C0194, 18C0165, 18C0003, 18C0062, 18C0131, 18C0059, 18C0035, 18C0124, 18C0193, 18C0203, 18C0074, 18C0200, 18C0114, 18C0158, 18C0070, 18C0053 (the numbers are applicable to PCR amplification electrophoresis and subsequent enzyme digestion electrophoresis). DETAILED DESCRIPTION

[0034] The application will be further described in detail below with reference to the accompanying drawings:

[0035] Example 1

[0036] The specific experimental steps are as follows:

[0037] 1. Test materials and culture

[0038] The 30 pumpkin core germplasms with different symbiotic affinities were used as materials. The D values of the symbiotic affinities of the 30 pumpkin core germplasms are shown in Table 2. The greater the D value, the stronger the symbiotic affinity, and vice versa.

[0039] The material culture and management were carried out in an artificial climate chamber. First, 25 seeds of each of the 30 core germplasms were selected, soaked in water at 55°C for about 20 min, soaked at room temperature for 12 h, and then soaked in water after wrapping the seeds with gauze, and germinated in a biochemical incubator at 28°C. After the pumpkin seeds germinated and sprouted, they were sown in 15-hole plug trays, with 1 seed per hole, and 1 tray for each germplasm, a total of 15 plants. After sowing, water was poured to moisten the substrate. The seedling substrate was a special seedling substrate for gardening vegetables. After the rootstock pumpkin seedlings emerged, the average temperature in the climate chamber during the day was 12-25°C, the average humidity was 89-92%, and the light duration was 10-14 h; the average temperature at night was 11-16°C, and the average humidity was 93-94%. When the rootstock seedlings grew to one leaf and one heart, the grafting joint parts (stem segments) were mixed and sampled on ice, and the callose synthase activity, callose degrading enzyme activity and callose content were determined; fresh leaves were mixed and sampled on ice, and used as subsequent DNA extraction samples, and stored in a -80°C freezer.

[0040] Table 2 Pumpkin core germplasms

[0041]

[0042]

[0043] The high-affinity inbred line 18C0161, the medium-affinity inbred line 18C0024 and the low-affinity inbred line 18C0145 were used as rootstocks, and 'Jin Chun No. 4' was used as scion. The pre-sowing treatment and management of the rootstocks were the same as above. After the rootstocks germinated, full seeds of cucumber were selected, soaked for 8 h, and then placed in a centrifuge tube containing distilled water in a 30℃ shaker for 48 h to accelerate germination. The scion seeds were sown in seedling trays (40 x 40 cm) filled with 1.5 cm thick vermiculite.

[0044] The rootstock had two leaves in the center, and the scion had two cotyledons unfolded. The grafting was performed when the true leaves were not unfolded. The rootstock and scion were watered the day before grafting. The grafting was performed by the wedge grafting method (Tang et al., 2011). After grafting, the plants were placed in a grafting healing greenhouse for survival culture. The indoor humidity was maintained at 90%-100%, the daytime temperature was maintained at 24-27℃, and the nighttime temperature was maintained at 18-22℃. For the first 3 days after grafting, the plants were not ventilated and were cultured in the dark for healing. From the 4th day after grafting, the plants were ventilated, and the humidity was gradually reduced and the light time was gradually increased. After 9 days, the plants were moved out of the healing greenhouse and were managed normally. On the 25th day after grafting, 20 healthy and vigorous grafted seedlings with basically consistent growth potential were randomly selected from each treatment. The plant height, stem diameter, leaf color index, aboveground dry and fresh weight, and belowground dry and fresh weight were measured, respectively. The activities of phenylalanine ammonia lyase, polyphenol oxidase, callose synthase, and callose degrading enzyme, and the callose content were analyzed. The freeze sections were observed to observe the callose deposition at the grafting healing site. The 'Jin Chun No. 4' cucumber was designated as AG. The high-affinity rootstock 18C0161 grafted with 'Jin Chun No. 4' was designated as CG. The medium-affinity rootstock 18C0024 grafted with 'Jin Chun No. 4' was designated as MG. The low-affinity rootstock 18C0145 grafted with 'Jin Chun No. 4' was designated as IG.

[0045] 2. Primer design

[0046] In this experiment, the SNP mutation site of the sequenced and aligned CalS1 gene (Cp4.1LG20g07750) was designed by SnapGene (Version 6.0.2) software. The standard parameters of the primer were as follows: the size of the amplified product was 400-500 bp, the length of the primer was not more than 28 bp, and the annealing temperature was 50-65℃. After the primer design was completed, the primer was synthesized by Nanjing Qikexi Biological Technology Co., Ltd.

[0047] 3. Development of CAPS markers for rootstocks and selection of endonucleases

[0048] The information on restriction enzyme sites of variant sites was analyzed using the dCAPS Finder 2.0 website (http: / / helix.wustl.edu / dcaps / dcaps.html). The main steps were: (1) selecting the 40bp sequence before and after the product sequence of the variant site; (2) inputting the product sequence into dCAPS Finder 2.0 to screen for restriction endonucleases that can be cleaved. The screened endonucleases are the CAPS markers based on SNPs. The SNP sites were then converted into CAPS markers using this endonuclease.

[0049] 4. SNP-PCR amplification of rootstock pumpkin

[0050] After extracting genomic DNA from 30 rootstock pumpkins using the traditional CTAB method, PCR amplification was performed using primers listed in Table 2, with a reaction volume of 25 μL. The mixture included 12.5 μL of GoTaq DNA Polymerase, 0.5 μL of template DNA, and 0.5 μL each of forward and reverse primers, with sterile water added to make up the reaction volume. The PCR program was as follows: pre-denaturation at 95℃ for 5 min (denaturation at 95℃ for 30 s, annealing at Tm-2℃ for 30 s, extension at 72℃ for 40 s) × 35 cycles, followed by a final extension at 72℃ for 10 min, and then a final extension at 4℃.

[0051] 5. Enzyme digestion reaction and gel electrophoresis

[0052] Enzyme digestion system (30 μL): LightNing TM 1 μL MnI, 10 μL PCR product, 3 μL buffer, 16 μL ddH2O. Incubate at 37℃ for 30 min for enzyme digestion. Detect PCR amplification products and enzyme digestion products using a 1.5% agarose gel. Electrophoresis at 175V for 25 min, observe and save the results using a gel imaging system. Experimental results and analysis:

[0053] (1) Analysis of callose metabolism enzyme activity in 30 core germplasms of rootstock pumpkin

[0054] Depend on Figure 1 (a) It can be seen that the callose synthase activity of the 30 rootstock-based pumpkin core germplasm seedlings differed significantly, and the callose synthase activity showed an increasing trend with decreasing symbiotic affinity. Figure 1 (b) It can be seen that the callose-degrading enzyme activities of the 30 rootstock-based pumpkin core germplasm seedlings differed significantly, and the callose-degrading enzyme activities showed a decreasing trend with decreasing symbiotic affinity. Figure 1 (c) It can be seen that the callose content of the 30 core germplasm seedlings of pumpkin rootstocks differed significantly, and the callose content showed a decreasing trend as the symbiotic affinity decreased.

[0055] like Figure 2As shown, the correlation analysis found that callose synthase activity was significantly negatively correlated with the symbiotic affinity of grafted seedlings (r = -0.602 ** ), that is, the higher the callose synthase activity, the lower the symbiotic affinity, the less compatible; the callose degrading enzyme was significantly positively correlated with the symbiotic affinity (r = 0.519 ** ), that is, the lower the callose degrading enzyme activity, the less compatible; and the correlation between the callose content and the symbiotic affinity was not significant (r = -0.203). These results prove that the symbiotic affinity of the pumpkin used as a rootstock is closely related to the activities of callose synthase and degrading enzyme, and the correlation between the symbiotic affinity and the callose synthase is higher.

[0056] (2) Verification analysis of the correlation between callose metabolism and symbiotic affinity of cucumber / pumpkin grafted seedlings

[0057] As shown in Table 3, there were significant differences in the plant height, stem diameter, fresh weight of aboveground and underground parts, dry weight of aboveground part, and SPAD between different grafting combinations, but there was no significant difference in the dry weight of underground part. Analysis of the growth indexes of different grafting combinations showed that the grafted seedlings of the incompatible combination were lower than those of the compatible combination in the plant height, stem diameter, fresh weight of aboveground and underground parts, and SPAD.

[0058] Table 3 Growth indexes of different cucumber / pumpkin grafted combinations with different symbiotic affinity

[0059]

[0060]

[0061] PAL activity, PPO activity, callose synthase activity, callose degrading enzyme activity, and callose content of the grafting healing part of the cucumber grafted seedlings with different rootstocks were analyzed, and the grafting healing part was dyed with aniline blue, which showed that Figure 3 there were significant differences in PPO activity, PAL activity, and callose-related enzyme activity between different symbiotic grafting combinations, and compared with the self-grafting combination, the higher the symbiotic affinity, the higher the PPO enzyme activity, PAL enzyme activity, callose synthase activity, and callose content of the grafting healing part, and the lower the callose degrading enzyme activity.

[0062] Through observation by upright fluorescence microscope Figure 4 and image data processing by ImageJ software (such as Figure 3 ), we found that there were significant differences in the callose deposition area of the grafting healing part in different grafting combinations, and the more incompatible the symbiosis, the larger the callose deposition area of a single vascular bundle.

[0063] (3) PCR amplification of pumpkin used as a rootstock

[0064] Using 30 core germplasm DNA samples as templates, the CalS1 gene fragment of the tested materials was amplified using this specific primer. The PCR amplification results of primer P298 are as follows: Figure 5 As shown, the amplified band size is 390 bp, consistent with the expected size.

[0065] (4) Enzyme cleavage site analysis

[0066] The amplified fragment from primer P298 was cloned and sequenced. The sequence was analyzed using SnapGene software, as follows: Figure 6 As shown, it was found that when a C base is inserted at this site in the CalS1 gene of high-affinity varieties, a recognition site CCT C for the restriction endonuclease Mnll is formed, while the Mnll restriction site is not present in incompatible varieties.

[0067] (5) Validation of CAPS molecular markers in rootstock pumpkin

[0068] After digestion with Mnll enzyme, the amplified product of primer P298 exhibited enzyme polymorphism in different materials. For example... Figure 7 As shown, after agarose gel electrophoresis, the high-affinity varieties '18C0161', '18C0030', and '18C00110' and the medium-affinity varieties '18C0024', '18C0090', and '18C0100' were successfully digested. The low-affinity varieties '18C0051', '18C0170', '18C0147', and '18C0145' showed a single band of 390 bp and were not successfully digested. Among them, the four materials '18C0161', '18C0030', '18C0024', and '18C0110' amplified two bands with sizes of 98 and 292 bp; the two materials '18C0090' and '18C0100' amplified 98, 292, and 390 bp.

[0069] (6) Revalidation of CAPS molecular markers in rootstock pumpkin

[0070] The remaining 20 rootstock materials were identified and validated using CAPS markers. The previously cloned products were also digested with enzymes. The results showed that after enzyme digestion, the polymorphic bands of rootstock materials with different affinity levels reached 65%. Among the high-affinity varieties, '18C0160', '18C0178', '18C0194', '18C0165', '18C0131', '18C0059', '18C0124', and '18C0193' were successfully digested. Among the medium-affinity varieties, '18C0035', '18C0074', '18C0200', '18C0114', and '18C0158' were successfully digested. The less compatible variety '18C0053' showed a single band and was not successfully digested.

[0071] The above embodiments describe some embodiments of the present application, but do not limit the protection scope of the present application. Those skilled in the art should understand that various modifications or changes can be made to the present application without any creative labor, and still fall within the protection scope of the present application.

Claims

1. The application of molecular marker primer for identifying the strength of pumpkin affinity to rootstock in identifying the strength of pumpkin affinity to rootstock, characterized in that, The upstream primer of the molecular marker primer is shown as SEQ ID NO. 1, and the downstream primer is shown as SEQ ID NO. 2; the genomic DNA of the stock pumpkin is amplified by PCR using the molecular marker primer, the amplification product is subjected to Mnll enzyme digestion, different materials present enzyme digestion polymorphism, the enzyme digestion product is subjected to agarose gel electrophoresis, the high-affinity variety presents two bands with sizes of 98 and 292 bp or three bands with sizes of 98, 292 and 390 bp, and the low-affinity variety presents a single band with a size of 390 bp.

2. A method for identifying the strength of the affinity of a squash rootstock, characterized by, The genomic DNA of the stock pumpkin is amplified by PCR using the molecular marker primer in claim 1, the amplification product is subjected to Mnll enzyme digestion, different materials present enzyme digestion polymorphism, the enzyme digestion product is subjected to agarose gel electrophoresis, the high-affinity variety presents two bands with sizes of 98 and 292 bp or three bands with sizes of 98, 292 and 390 bp, and the low-affinity variety presents a single band with a size of 390 bp.

3. The method of claim 2, wherein The PCR amplification system is 25 μL of reaction system, wherein GoTaq DNA Polymerase is 12.5 μL, the template DNA is 0.5 μL, the upstream and downstream primers are each 0.5 μL, and the reaction system is supplemented with sterile water.

4. The method of claim 3, wherein The PCR reaction program is as follows: pre-denaturation at 95 ℃ for 5 min, (denaturation at 95 ℃ for 30 s, annealing at Tm-2 ℃ for 30 s, extension at 72 ℃ for 40 s) × 35 cycles, final extension at 72 ℃ for 10 min, and 4 ℃.

5. The method of claim 2, wherein Mnll enzyme digestion system is: LightNing TM Mnll 1 μL, PCR product 10 μL, buffer 3 μL, ddH2O 16 μL, enzyme digestion reaction temperature is 37℃, and the enzyme digestion is incubated for 30 min by using a constant temperature water bath.

6. The method of claim 2, wherein The enzyme digestion product is detected by 1.5% agarose gel, electrophoresis is performed at 175 V for 25 min, and the results are observed and saved by a gel imaging instrument.

Images