A detection method of circular RNA and application thereof in regulating chicken muscle development

By detecting and overexpressing the chicken circular RNA circCLASP2, the proliferation and differentiation of myoblasts were promoted, filling the research gap in the regulation of muscle growth by the chicken CLASP2 gene and improving the meat yield and quality of broilers.

CN118638782BActive Publication Date: 2025-11-04CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410693141.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-30
Publication Date
2025-11-04
Estimated Expiration
2044-05-30

AI Technical Summary

Technical Problem

Current technologies lack research on the role of circular RNA of the chicken CLASP2 gene in muscle growth regulation, which affects the improvement of broiler meat quality and yield.

Method used

Primers for detecting chicken circular RNA circCLASP2 and its application in regulating muscle development were provided. By constructing a recombinant overexpression vector of circCLASP2 and transfecting it into myoblasts, the proliferation and differentiation of myoblasts were promoted.

Benefits of technology

It significantly improved the expression of myoblast proliferation and differentiation marker genes, promoted chicken muscle development, provided a new direction for molecular breeding of broilers, and improved the meat yield and quality of broilers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118638782B_ABST
    Figure CN118638782B_ABST
Patent Text Reader

Abstract

The application discloses a circular RNA circCLASP2 of chicken, a nucleotide sequence of which is shown as SEQ ID NO: 1, and provides detection primers thereof, nucleotide sequences of which are shown as SEQ ID NO: 2-3. The application verifies the existence of a circular transcript circCLASP2 of a CLASP2 gene, proves that the circular transcript is resistant to RNase, and clones the full length of the circular transcript. The application determines through experiments that the circCLASP2 is highly expressed in breast muscle and leg muscle of white-feathered broilers, and is lowly expressed in Dawei mountain chickens; the circCLASP2 is time-sequentially expressed in white-feathered broiler muscle in the embryonic period, and has no obvious change in Dawei mountain chickens. The application verifies that the circCLASP2 mainly exists in cytoplasm through nucleocytoplasmic quantification. The application constructs an overexpression vector of the circCLASP2 and transfects myoblasts, and proves that overexpression of the circCLASP2 can improve the expression of proliferation marker genes and differentiation marker genes, and promote proliferation and differentiation of the myoblasts.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of livestock and poultry molecular breeding, and particularly relates to a detection method of a circular RNA circCLASP2 involved in muscle growth and development and application of the circular RNA circCLASP2 in regulating muscle development. BACKGROUND

[0002] Circular RNA (circRNA) is a special type of RNA molecule that exists widely in organisms and plays an important role in gene expression regulation. Compared with linear RNA molecules, circRNA is more stable and less susceptible to degradation by RNase. Generally, circRNA can competitively bind miRNA through sponge adsorption to regulate gene expression. In addition, some circRNA has an open reading frame and can translate small peptides and polypeptides to participate in the regulation of life activities. Some circRNA stays in the nucleus and participates in the transcriptional regulation of genes.

[0003] China is a large country in broiler industry. In recent years, the consumption level of broiler in China has significantly improved, and the output has increased substantially. High-quality chicken meat is in short supply. How to improve the quality of chicken meat, increase the meat yield and enhance the self-sufficiency of high-quality chicken meat has become a difficult problem to be solved in China's poultry breeding industry. Skeletal muscle of animals is the main source of meat for humans. Skeletal muscle is formed by connecting muscle tissue to bone through tendon, and the embryonic period is a key period for the development of chicken meat, and the number of muscle fibers is determined during the embryonic period. The development status of skeletal muscle directly affects the meat quality of broiler, and further affects the economic benefits of broiler breeding industry. The proliferation, differentiation and apoptosis of myoblasts are the basis of muscle growth and development, and this process is regulated by a series of complex factors. Recent studies have shown that circRNA plays an important role in the growth and development of the body, and the function of circRNA in muscle growth has also been reported. For example, circLOM7 can promote the proliferation of bovine primary myoblasts, circFUT10 can induce the differentiation of bovine primary myoblasts, and circZBTB10 promotes the proliferation and differentiation of chicken myoblasts.

[0004] circCLASP2 is derived from chicken CLASP2 gene, which is located on chromosome 2 and is a member of the cytoplasmic linker protein family. CLASP2 gene is involved in various biological processes, mainly by affecting the assembly and disassembly of microtubules, thereby playing a role in various cell development processes, such as cell migration and cell division. In addition, studies have shown that CLASP2 plays a role in maintaining the characteristics of hematopoietic stem cells (HSCs), preventing premature differentiation of HSCs and maintaining self-renewal of HSCs. There is no report on the regulation of chicken CLASP2 on muscle growth. SUMMARY

[0005] The application aims to provide a detection primer of chicken circular RNA circCLASP2 and application of the circular RNA in regulating muscle development.

[0006] The first object of the application is to provide a detection primer of chicken circular RNA circCLASP2.

[0007] The second object of the application is to provide application of the detection primer in detecting the circRNA.

[0008] The third object of the application is to provide application of a product or method for overexpressing the circular RNA circCLASP2 in regulating proliferation and differentiation of chicken myoblasts.

[0009] The fourth object of the application is to provide application of the chicken circular RNA circCLASP2 in promoting proliferation and differentiation of chicken myoblasts.

[0010] The fifth object of the application is to provide application of the chicken circular RNA circCLASP2 in regulating chicken muscle development.

[0011] The above objects of the application are achieved by the following technical solutions.

[0012] The application takes various breeds of chickens in current industrial breeding as research objects, and specifically takes fast-growing broilers and slow-growing broilers as research objects, and here takes commercial white-feathered broilers (fast-growing, high meat yield) and local breed Daweishan miniature chicken (slow-growing, low meat yield) as experimental objects. The application provides a circular RNA-circCLASP2, wherein the circCLASP2 is derived from a CLASP2 gene of a chicken, the circCLASP2 is composed of six exons and has a length of 588 nt, and the nucleotide sequence thereof is shown as SEQ ID NO:1. Compared with universal primers, random primers have higher reverse transcription efficiency on the circCLASP2, and after using RNase digestion, the level of the circCLASP2 does not change obviously, indicating that the circCLASP2 is a circular structure molecule without poly(A).

[0013] The base sequence of the circCLASP2 (SEQ ID NO:1) is as follows:

[0014] TTCTCCTGCCTTTGATAGATCGTATGGGAGATGCCAAAGATCAAGTTCGA

[0015] GAGCAAGCACAGAATCTCATATTGAAGTTGATGGATGAGGCAGCACCGC

[0016] CCATGTACATTGGGAACGCCTTGCTGTTGGTTTTAAACACAAGAATTAC

[0017] CGATCCCGAGAAGGAGTTGTGTTTGTGTCTTATTGCAACCTTAAACATTTA

[0018] TGGTGCCCAGCCGTTAAGTCTCAGCAAGTTGGTACCACATCTGTGTGCA

[0019] GCATTTGGTGACTCAAATAGTCAGGTGAGAGATGCTGCTATACTAGCCAT

[0020] TGTGGAGGTTTATAGACATGTGGGGGAGAAAGTACGACTAGACCTTACA

[0021] AAAAGAGGAATTCCTCCTGCAAGGTTGCAAACAATCTTTACAAAATTTG

[0022] ATGAAGTGAGAGACTCTGGAAATATGATTTTAAGTAACATCAGTGACAA

[0023] AAGCTTCGATGATGAAGAGTCGGTGGATGGAAATAGGCCATCGTCAGCA

[0024] GCTTCAGCCTTCAAGATTCCTGCACCTAAAAAGCCAGGAAATCCTTCCA

[0025] ACAGTGCAAGGAAGCCGGGTTCTGCTGGTGGGCCAAAGGTTGGAG

[0026] This invention found that circCLASP2, produced by the CLASP2 gene, is expressed in all tissues of different breeds of chickens at 4 weeks of age, with high expression in the muscle tissue of broiler chickens and low expression in the muscle tissue of Daweishan chickens. In the embryonic muscle tissue of broiler chickens, circCLASP2 shows a trend of increasing expression level over time, which decreases slightly after birth; while in Daweishan chickens, the change in the expression level of circCLASP2 over time is not obvious.

[0027] This invention constructs a recombinant overexpression vector of circCLASP2 using the pLO5-ciR plasmid and transfects it into myoblasts. Overexpression of circCLASP2 in myoblasts is then performed, and the expression levels of related proliferation and differentiation marker genes are detected. The results show that overexpression of circCLASP2 can promote myoblast proliferation and myoblast differentiation.

[0028] This invention is the first to discover the existence of the circular transcript circCLASP2 of the chicken CLASP2 gene and find that it is closely related to muscle development. Therefore, this invention claims protection for the following:

[0029] This invention seeks protection for the above-mentioned fluorescent quantitative PCR primers for the circular RNA circCLASP2, characterized in that their nucleotide sequences are as shown in SEQ ID NO:2-3.

[0030] This invention seeks protection for the use of circular RNA circCLASP2 in promoting myoblast proliferation and differentiation, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0031] This invention claims protection for the use of a recombinant vector containing chicken circular RNA circCLASP2 in promoting myoblast proliferation and differentiation, the nucleotide sequence of which is shown in SEQ ID NO:1. This invention also claims protection for the use of products or methods for overexpressing the circular RNA circCLASP2 in promoting myoblast proliferation and differentiation.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] This invention verifies the existence of the circular transcript circCLASP2 of the CLASP2 gene and clones the full-length transcript to determine the circular structure. This invention provides a pair of fluorescent quantitative primers for detecting circCLASP2. This invention experimentally confirms that circCLASP2 is expressed in various tissues of different chicken breeds, and its expression level in the muscle of broiler chickens is higher than that of the Daweishan local chicken. This invention constructs an overexpression vector of circCLASP2 and transfects it into myoblasts, finding that overexpression of circCLASP2 significantly increases the expression of proliferation and differentiation marker genes, promoting myoblast proliferation and differentiation. The circular RNA circCLASP2 discovered in this invention has significant application value in molecular breeding of chickens related to muscle traits, providing a new research direction for improving chicken muscle traits and selecting high-yielding broiler chickens. Attached Figure Description

[0034] Figure 1To validate the circularization of the circular RNA circCLASP2 and to clone its full length. Figure 1 A is a schematic diagram of the formation of circCLASP2 and a schematic diagram of its full length structure; Figure 1 B shows the amplification electrophoresis results using the reverse primer and the confluence primer, respectively; Figure 1 C represents the sequencing results of the circular regions of exons 3 and 8 of circCLASP2; Figure 1 D represents the qPCR detection results of reverse transcription of muscle tissue RNA using random primers and universal primers, respectively; Figure 1 E represents the effect of RNase treatment on the expression of CLASP2 and circCLASP2. Data are expressed as mean ± standard error, n = 3, *** indicates p < 0.001 (t test);

[0035] Figure 2 The spatiotemporal expression patterns of the circular RNA circCLASP2; Figure 2 A and Figure 2 B represents the expression of circCLASP2 in various tissues of 4-week-old white-feathered broiler chickens and Daweishan chickens. Figure 2 C and Figure 2 D represents the temporal expression pattern of circCLASP2 in muscle tissue of broiler chickens and Daweishan chickens at 11, 16, and 18 days of embryonic development and 1 day after birth.

[0036] Figure 3 To detect the distribution ratio of circCLASP2 in primary myoblasts after isolating the nucleus and cytoplasm, RT-qPCR was used. GAPDH was used as the internal reference gene in the cytoplasm, and U6 was used as the internal reference gene in the nucleus. Data are expressed as mean ± standard error, n = 3 (t test);

[0037] Figure 4 The effect of circCLASP2 on the proliferation and differentiation of primary chicken myoblasts; Figure 4 A represents the sequencing results at the junction of the vector and circCLASP2; Figure 4 B represents the overexpression efficiency of the constructed overexpression vector transfected into myoblasts; Figure 4 C represents the changes in mRNA expression levels of a series of proliferation marker genes, CDK2, CCND1, and PCNA, after overexpression of circCLASP2. Figure 4 D represents the changes in mRNA expression levels of a series of differentiation marker genes, MyoD and MyHC, after overexpression of circCLASP2. Data are expressed as mean ± standard error, n = 3, *** indicates p < 0.001 (t test). Detailed Implementation

[0038] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and do not constitute any limitation on the invention. Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.

[0039] Laboratory animal materials:

[0040] Broiler chickens and hatching eggs were provided by the National Key Laboratory of Animal Biology and Breeding at China Agricultural University. The hatching eggs were incubated using a standard procedure (temperature: 37.5℃±0.5℃, relative humidity: 60%-70%). Muscle tissue was extracted from the hatching eggs at 11, 16, and 18 days of embryonic development. Tissues from the heart, liver, lungs, ovaries, stomach, pectoral muscles, and leg muscles of 4-week-old broiler chickens were collected, and the tissues were flash-frozen in liquid nitrogen and stored at -80℃.

[0041] Experimental reagents:

[0042] The 2×PCRMix, 2× real-time PCRMix, nucleic acid dyes, DNA markers, loading buffer, reverse transcriptase, RNase inhibitors, restriction endonucleases, and T4 DNA ligase used in the experiment were all purchased from Takara Bio Engineering (Dalian) Co., Ltd. The tryptone, yeast extract, and NaCl used for bacterial culture were purchased from Thermo Fisher Scientific. Isopropanol, chloroform, ethanol, and DMSO were purchased from Sinopharm Chemical Reagent Co., Ltd. OligodT primers and random primers were purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd. DMEM medium, fetal bovine serum, and PBS used for cell culture were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0043] Main instruments and equipment:

[0044] 4℃ refrigerator, -80℃ ultra-low temperature freezer (Zhongke Meiling Low Temperature Technology Co., Ltd.); -20℃ freezer (Haier Smart Home Co., Ltd.); agarose gel electrophoresis system (Beijing Baijing Biotechnology Co., Ltd.); micropipette, nucleic acid quantification instrument, centrifuge (Eppendorf, Germany); clean bench (Suzhou Purification Equipment Co., Ltd.); PCR amplification instrument (Bio-Ray Biomedical Products Co., Ltd.); real-time PCR instrument (Hoffmann-La Roche GmbH); CO2 cell culture incubator (Panasonic, Japan); constant temperature water bath (Hangzhou Aosheng Instrument Co., Ltd.); ice maker (Sanyo, Japan).

[0045] Statistical analysis:

[0046] The data from the real-time fluorescence quantitative PCR results were saved and organized using Microsoft Excel, and t-test analysis and graphing were performed using GraphPadPrism8.

[0047] Example 1: Circularization Verification and Full-Length Cloning of Circular RNA circCLASP2

[0048] I. Experimental Procedure

[0049] (1) Tissue RNA extraction

[0050] Remove the tissue stored at -80℃, cut it into small pieces, place it in a new enzyme-free centrifuge tube, and quickly immerse it in liquid nitrogen. Remove the tissue from the liquid nitrogen and extract RNA using the TRIzol method.

[0051] ① Cut the tissue to an appropriate size and place it in a 1.5 mL Eppendorf tube containing 1 mL Trizol treated with DEPC water. Use a tissue disperser to disperse and cut the tissue evenly.

[0052] ② Add 200 μL of chloroform, shake vigorously to mix for 15 seconds, and let stand at room temperature for 2–3 minutes;

[0053] ③ Centrifuge at 4℃ and 12000rpm for 15min, and transfer the upper aqueous phase into a new Rnase-Free centrifuge tube;

[0054] ④ Add an equal volume of isopropanol (pre-cooled), mix well, and let stand at room temperature for 10 minutes;

[0055] ⑤ Centrifuge at 4℃ and 12000rpm for 10min, then discard the supernatant;

[0056] ⑥ Wash the precipitate with 1 mL of 75% ethanol, centrifuge at 12000 rpm for 5 min at 4℃; repeat once.

[0057] ⑦ Carefully discard the supernatant and invert the centrifuge tube onto the clean bench to air dry for about 5 minutes.

[0058] ⑧ Finally, add an appropriate amount of DEPC water according to the amount of precipitate, shake to dissolve the RNA precipitate, and place on ice;

[0059] ⑨ Total RNA concentration is measured using a nucleic acid testing instrument.

[0060] (2) Reverse transcription

[0061] The following steps were taken to reverse transcribe RNA using TAKARA's M-MLV reverse transcriptase:

[0062] Table 1. Systems for digesting DNA in tissues using DNase.

[0063]

[0064] After mixing, place the mixture in a PCR instrument at 37°C for 30 min, and add 1 μL of EDTA to terminate the reaction.

[0065] Table 2 Reverse transcription system of total RNA from tissues

[0066]

[0067] After mixing, place at 42℃ for 1.5 hours, 95℃ for 5 minutes, and store at 4℃. Add appropriate amount of DEPC water and store at -80℃.

[0068] (3) Primer design and amplification

[0069] The nucleotide sequence of chicken circSLC2A13 is shown in SEQ ID NO: 1. Primers were designed using SnapGene, and GAPDH was selected as the internal reference gene. Specific primer information is shown in Table 3. The conventional Taq enzyme PCR and real-time quantitative PCR systems and procedures are shown in Tables 4-7.

[0070] Table 3 Primer sequences

[0071]

[0072]

[0073] Table 4 PCR amplification system of common Taq enzyme

[0074]

[0075] Table 5 PCR amplification program for common Taq enzyme

[0076]

[0077] Real-time quantitative PCR (RT-qPCR)

[0078] Table 6 RT-qPCR loading system

[0079]

[0080] Table 7 RT-qPCR Amplification Program

[0081]

[0082] (4) Analysis of the ring-like properties of chicken circCLASP2

[0083] RNase R can digest almost all linear RNA, but circular RNA is not easily digested by RNase R due to its unique circular structure. To investigate the tolerance of circCLASP2 to RNase R, total RNA from muscle tissue was digested with RNase R under the following conditions: 37℃ for 10 min, then 70℃ for 10 min. The reaction system is shown in Table 8. The expression levels of circCLASP2 and CLASP2 mRNA in RNase R-treated and untreated samples were detected using the quantitative real-time PCR method described above.

[0084] Table 8 RNase R digestion system

[0085]

[0086] The RNase R system was incubated in a 37°C metal bath for 30 min, followed by reverse transcription.

[0087] II. Experimental Results

[0088] The circular RNA circCLASP2 is produced by the CLASP2 gene, located on chromosome 2, and is formed by the circularization of six exons (exons 3-8), with a length of 588 nt. Figure 1 A), whose nucleotide sequence is shown in SEQ ID NO:1. Using reverse-transcribed cDNA and gDNA as templates, amplification was performed using back-confluence primers and confluence primers, respectively, with the results shown below. Figure 1 As shown in Figure B, the reverse primer can only amplify fragments of the corresponding size in the cDNA template, while the confluence primer can amplify fragments of the corresponding size in both cDNA and gDNA, indicating that circCLASP2 has a reverse splicing site; sequencing results show that the circular position of circCLASP2 contains the sequences of exon 3 and exon 8 of CLASP2. Figure 1 C).

[0089] Reverse transcription was performed using random primers and universal primers, and the expression levels of CLASP2 and circCLASP2 were detected by qPCR. The results are as follows: Figure 1 As shown in Figure D, compared with random primers, the relative expression level of circCLASP2 was significantly reduced when using universal primers, while the relative expression level of CLASP2 remained unchanged. RNase digestion results indicate that circCLASP2 possesses the general characteristics of a cyclic molecule and is not easily degraded by RNases. The qPCR results of circCLASP2 after RNase digestion are shown in Figure D. Figure 1 As shown in E. Figure 1E shows that the abundance of circCLASP2 decreased to some extent, but the abundance of linear CLASP2 decreased significantly. The difference between the two is significant, indicating that circCLASP2 is an inverse cyclic circumference and actually exists.

[0090] Example 2: Spatiotemporal Expression and Nucleocytoplasmic Quantitative Analysis of Circular RNA circCLASP2

[0091] I. Experimental Procedure

[0092] (1) Total RNA was extracted from the pectoral and leg muscles of broiler chickens at 11, 16, and 18 embryonic ages, as well as from the heart, liver, spleen, lungs, kidneys, stomach, ovary, brain, pectoral and leg muscles at 4 weeks of age. cDNA was obtained by reverse transcription. The expression level of circCLASP2 in different tissues and at different time points was detected by quantitative real-time PCR using the primers in Table 3.

[0093] (2) Isolation of nuclear RNA from primary chicken myoblasts

[0094] ① Myoblasts were digested with trypsin, centrifuged at 500g for 5 min, and the cell pellet was resuspended in PBS to wash the cells.

[0095] ② Approximately 10 6 Transfer each cell to a 1.5ml centrifuge tube, centrifuge at 500g for 2 minutes to precipitate, discard the supernatant, and allow the precipitate to dry as much as possible;

[0096] ③ Add ice-cold CERⅠ to the cell pellet, vortex vigorously for 15 seconds to completely suspend the cell pellet, and incubate the centrifuge tube on ice for 10 minutes;

[0097] ④ Add the cold CERⅡ to the tube, vortex vigorously for 5 seconds, and place the centrifuge tube on ice to incubate for 1 minute;

[0098] ⑤ Vortex for 5 seconds, then centrifuge at 16000g for 5 minutes in a refrigerated centrifuge at 4℃; immediately transfer the supernatant (cytoplasmic extract) to a pre-cooled sterile centrifuge tube and store at -20℃.

[0099] ⑥ Suspend the insoluble particulate components generated in ② in a pre-cooled NER, vortex for 15 seconds, and then place the sample on ice. Vortex for 15 seconds every 10 minutes for a total of 40 minutes.

[0100] ⑦ Centrifuge at 16000g for 10 min at 4℃, and immediately transfer the supernatant (nuclear extract) to a pre-cooled sterile centrifuge tube and store at -20℃;

[0101] RNA was extracted from the nucleoplasm and reverse transcribed before RT-qPCR was performed using the method described above.

[0102] II. Experimental Results

[0103] (1) Spatiotemporal Representation Rules of circCLASP2

[0104] circRNA expression levels exhibit tissue and time specificity. circCLASP2 is expressed in different tissues of broiler chickens and Daweishan chickens. In muscle tissue, it is highly expressed in the breast and leg muscles of 4-week-old broiler chickens, while its expression is low in Daweishan chickens. Figure 2 AB). Experimental results on the temporal expression pattern of circCLASP2 showed that circCLASP2 had a high expression level in the muscle of broiler chickens during the embryonic period, and the expression level continued to increase from E11 to E18, and then decreased slightly after birth. Figure 2 C), while in the embryonic stage of the Daweishan chicken, the temporal expression of circCLASP2 did not show significant differences. Figure 2 D).

[0105] (2) Quantitative analysis of nuclei and cytoplasm

[0106] Primary myoblasts were isolated from their nucleus and cytoplasm. The distribution ratio of circCLASP2 in myoblasts was detected by RT-qPCR. GAPDH was used as a cytoplasmic internal reference gene, and U6 was used as a nuclear internal reference gene. The results are as follows: Figure 3 As shown, circCLASP2 is mainly distributed in the cytoplasm.

[0107] Example 3: Effects of chicken circCLASP2 on the proliferation and differentiation of primary myoblasts

[0108] I. Experimental Procedure

[0109] (1) Isolation and culture of primary myoblasts

[0110] ① Take fertilized eggs with an embryo age of 11 days (E11 days), disinfect them with 70% ethanol, and use tweezers to crack open the eggshell at the air cell end in a clean bench. Use small tweezers to remove the chicken embryo and place it in a petri dish.

[0111] ② Use small forceps to hold the foot, scrape off the skin with a scalpel, then place the leg in a sterile culture dish containing 20% ​​FBSDMEM. Finally, carefully separate the muscles, remove the bones and cartilage, and then use scissors to cut the muscle tissue into small pieces as much as possible.

[0112] ③ Transfer the shredded leg muscle tissue to a 50mL centrifuge tube and vortex for 1 minute; let stand until the muscle tissue settles to the bottom of the centrifuge tube, then transfer the supernatant through a 40μm filter to a 50mL centrifuge tube.

[0113] ④ Add the remaining precipitate to DMEM medium, vortex, and then filter; centrifuge at 700g for 5 min.

[0114] ⑤ Discard the supernatant, add DMEM containing 20% ​​FBS to resuspend the cells, transfer to a new culture dish, and culture at 37°C in a 5% CO2 cell incubator;

[0115] ⑥ After culturing the isolated cells in a cell culture incubator for 40 minutes, remove them and transfer the supernatant to another new culture dish for continued culture to remove fibroblasts; repeat the above steps, this time the adherent cells are endothelial cells, and the upper cell suspension is the primary myoblasts.

[0116] (2) Construction of circCLASP2 overexpression vector

[0117] The circular RNA overexpression empty vector was PLO5-ciR. Using cDNA from broiler muscle tissue reverse-transcribed in Example 1 as a template, circularization-mediated sequences and XholI and XbarI restriction sites were added to both ends of the full-length circCLASP2 amplification primers (see Table 9 for details). The full-length circCLASP2 sequence was then amplified by PCR according to the method in Example 1. After purifying the PCR amplification product using a gel extraction kit, it was ligated into the PLO5-ciR vector. The vector was double-digested, and the ligation was performed using a seamless cloning method (Tables 10-11). The ligation system was then transformed into competent E. coli cells, and single colonies were picked the next day for PCR positive identification.

[0118] Table 9 Primer construction information for the circCLASP2 overexpression vector

[0119]

[0120] Table 10. Double enzyme digestion system for plasmids

[0121]

[0122] Table 11 Seamless Clonal Recombination Reaction System

[0123]

[0124] Ligation product transformation and colony identification

[0125] ① Place competent Escherichia coli DH5α cells on ice and allow them to thaw;

[0126] ② Take an appropriate volume of plasmid or DNA ligation product and place it into competent cells, then incubate for 30 minutes;

[0127] ③ After heat shock (temperature 42℃) for 40-90 seconds, follow with an ice bath for 3-5 minutes;

[0128] ④ Add 0.5 mL of LB medium stored at room temperature to the heat-shocked competent cells, and incubate at 37°C, 160 g, on a shaker for 1 h.

[0129] ⑤ Centrifuge for 5 minutes, 2000g; discard the supernatant, resuspend the bacterial solution with an appropriate amount of LB broth, and spread it evenly on LB solid culture plates containing ampicillin or kanamycin. Incubate overnight in a bacterial culture incubator at 37°C until colonies of suitable size are formed.

[0130] ⑥ Pick out the colonies of appropriate size with a 10μL sterile pipette tip and place them into a 1.5mL sterile EP tube containing 20μL sterile ddH2O, and mix well;

[0131] ⑦ Take 2 μL of the colonies from the 1.5 mL sterile EP tube as a template for conventional PCR amplification, and perform PCR amplification using the aforementioned PCR amplification system;

[0132] ⑧ After performing agarose gel electrophoresis on the PCR products, select the cloned colonies that meet the expected fragments, expand the culture, and perform Sanger sequencing.

[0133] For bacterial cultures with correct sequencing, plasmids were extracted using an endotoxin-free plasmid extraction kit, collected in sterile EP tubes, and after determining the plasmid concentration, stored at -80°C.

[0134] (3) Detection of expression of proliferation marker genes

[0135] Primary myoblasts were transfected with plasmids using liposomes (Lipofectamine 3000). Primary myoblasts were seeded into 12-well plates, with 1 mL of cell suspension added to each well. The plates were then incubated in a cell culture incubator, and transfection was performed when the confluence reached 70-90%.

[0136] Table 12 Transfection System

[0137]

[0138] After standing for 25 min, add component B to component A and let stand at room temperature for 25 min. Transfect cells, and replace with complete culture medium after 6 h. Extract cellular RNA as described above, perform reverse transcription, and detect proliferation marker genes by quantitative real-time PCR. Detection primers are shown in Table 13.

[0139] Table 13 Primers for proliferation marker genes

[0140]

[0141]

[0142] (4) Detection of the expression of differentiation marker genes

[0143] Plasmid transfection was performed using the same method as described above. Differentiation was induced using complete culture medium containing 2% horse serum. Total RNA was extracted from cells, and the expression of differentiation marker genes was detected by reverse transcription and quantitative real-time PCR. Detection primers are shown in Table 14.

[0144] Table 14 Primers for differentiation marker genes

[0145]

[0146] II. Experimental Results

[0147] (1) Construction of overexpression vector for circCLASP2 and detection of transfection efficiency

[0148] Sequencing results showed that circCLASP2 was successfully ligated into the PLO5-ciR vector, and PCR quantification results showed that circCLASP2 was significantly overexpressed in chicken primary myoblasts. Figure 4 AB).

[0149] (2) Effects of overexpression of circCLASP2 on myoblast proliferation and differentiation

[0150] Compared to the control group, overexpression of circCLASP2 increased the mRNA expression levels of CDK2, CCND1, and PCNA. Figure 4 C).

[0151] Compared to the control group, overexpression of circCLASP2 increased the mRNA expression levels of differentiation marker genes MyoD and MyHC. Figure 4 D).

[0152] Finally, it should be noted that the above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention should be considered equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. A chicken circular RNA, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The fluorescent quantitative detection primers for circular RNA according to claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:2-3.

3. The use of the primers of claim 2 in detecting the circular RNA of claim 1.

4. The application of the circular RNA of claim 1 in promoting the proliferation and differentiation of chicken myoblasts.

5. The application of the circular RNA of claim 1 in promoting chicken muscle development.

6. The use of a recombinant vector containing the circular RNA of claim 1 in promoting the proliferation and differentiation of chicken myoblasts.

7. The use of a recombinant vector containing the circular RNA of claim 1 in promoting chicken muscle development.

8. The use of a product or method for overexpressing the circular RNA of claim 1 in promoting chicken muscle development.

Citation Information

Patent Citations

  • Primers, method and application for detecting chicken circrna CHR26:2670958|2679178

    AU2020103630A4

  • Application of reagent for inhibiting circ_CLASP2 (Cytoplasmic Linker Associated Protein 2) in preparation of preparation for treating nasopharyngeal darcinoma and preparation

    CN108721319A