Guide DNA for enhancing cleavage activity of argonaute protein and its application in target detection

Abstract

This invention discloses guide DNA that enhances the cleavage activity of Argonaute protein and its application in target detection, belonging to the field of biochemical analysis technology. This invention constructs gDNA by combining a metal-dependent DNA zyme fragment with gDNA. zyme It can significantly improve the cleavage efficiency of CbAgo, while exhibiting a significant synergistic effect and maintaining the targeting specificity of CbAgo. Further utilization of gDNA... zyme The activated CbAgo-mediated aptamer sensor enables highly sensitive simultaneous detection of three pathogenic bacteria without DNA extraction and amplification. Its sensitivity and detection limit are significantly superior to other methods. Furthermore, the sensor's detection results for clinical samples are consistent with the gold standard microbial culture method, demonstrating the effectiveness of the gDNA design of this invention. zyme It has broad applicability and practicality.

Description

TECHNICAL FIELD

[0001] The present application relates to guide DNA for enhancing the cleavage activity of Argonaute protein and its application in target detection, and belongs to the technical field of biochemical analysis. BACKGROUND

[0002] Clustered Regularly Interspaced Short Palindromic Repeat and its associated system (CRISPR) / Cas is a gene editing and biological analysis tool, which has been widely used in detection of various targets such as biomarkers, bacteria and viruses due to its trans-cleavage ability. However, its action requires a proximal protospacer motif (PAM) or a protospacer motif flanking site within the target sequence. So far, it is still a technical problem to achieve one-pot detection of multiple targets with a Cas enzyme. Argonaute (Ago) is another new generation of gene editing tool with programmable endonuclease activity, mainly derived from prokaryotes and eukaryotes. Ago protein cleaves complementary invading targets under the guidance of guide RNA (gRNA) or DNA (gDNA), effectively acting as an intrinsic immune system against foreign genetic material. It is worth noting that Ago cleavage has the characteristics of precise targeting, programmability and PAM sequence-independent guide DNA (gDNA). Therefore, its application in the field of molecular diagnosis has gradually been recognized. The more prominent Ago variants at present are Pyrococcus furiosus Argonaute (PfAgo), Thermus thermophilus Argonaute (TtAgo) and the like, which have been widely used in nucleic acid detection. PfAgo (87-99.9℃) and TtAgo (65-85℃) are thermophilic Ago with dynamic fluctuation structure, which has a partially melted surface at physiological temperature. This feature has been proved to be beneficial to obtain higher DNA cleavage activity. However, the high temperature condition limits their application scenarios.

[0003] In contrast to the thermophilic Ago, mesophilic Ago such as Clostridium perfringens Argonaute (CpAgo) and CbAgo have attracted the attention of researchers. CbAgo has lower temperature requirements and is currently widely used in scientific research. However, mesophilic Ago is limited in its enzymatic activity due to the compactness of its structure. Most applications involving mesophilic Ago currently rely on various signal amplification strategies, such as polymerase chain reaction, loop-mediated isothermal amplification, recombinase polymerase amplification technology, to meet the sensitivity requirements. This cumbersome amplification process inevitably increases the economic and time costs, reduces the operational convenience, and greatly limits the application of mesophilic Ago. Therefore, studying the key factors affecting the protease activity of mesophilic Ago can greatly improve its cleavage efficiency and greatly promote the application of mesophilic Ago protein in multiple target detection.

[0004] There are mainly two methods in the prior art to enhance the cleavage activity of CbAgo. One is to modify the structure of CbAgo, and the other is to design more efficient gDNA. Modifying the structure of CbAgo is challenging, difficult to predict, and has limited effect. Therefore, designing gDNA with a specific structure to enhance the cleavage activity of CbAgo has a wider application scenario. However, the influence of multiple base mismatches and the spatial structure of DNA on the cleavage efficiency of CbAgo has not been fully studied. SUMMARY

[0005] [TECHNICAL PROBLEM]

[0006] The technical problem to be solved by the present application is that the Argonaute protein in the prior art has limited cleavage efficiency, and the detection application is complicated and has low detection sensitivity.

[0007] [TECHNICAL SCHEME]

[0008] To solve the above technical problems, the present application provides the following technical scheme:

[0009] In a first aspect, the present application provides a guide DNA for enhancing the cleavage activity of Argonaute protein, the guide DNA comprising:

[0010] (a) a DNA enzyme;

[0011] (b) a single-stranded DNA capable of binding to the Argonaute protein;

[0012] The DNA enzyme is connected to the 5' end of the single-stranded DNA.

[0013] In one embodiment, the 3' end of the DNA enzyme is connected to the 5' end of the single-stranded DNA through a phosphodiester bond.

[0014] In one embodiment, the DNA enzyme is an 8-17 DNAzyme.

[0015] In one embodiment, the 8-17 DNAzyme has a nucleotide sequence as shown in 5' TCCGAGCCGGTCGAA 3'.

[0016] In one embodiment, the guide DNA has a length of 25-40 nt.

[0017] In one embodiment, the 5' end of the guide DNA is modified with a phosphate group.

[0018] In one embodiment, the Argonaute protein is a mesophilic Argonaute protein.

[0019] In one embodiment, the Argonaute protein is derived from Clostridium butyrium. Alternatively, the Argonaute protein has an amino acid sequence as shown in NCBI Accession No. WP_058142162.1.

[0020] In a second aspect, the present application provides a method for detecting a target nucleic acid, the method comprising:

[0021] (a) providing the guide DNA of the first aspect;

[0022] (b) providing the Argonaute protein;

[0023] (c) providing the target nucleic acid; the target nucleic acid is modified with a fluorescent group and a quencher group; the target nucleic acid is at least partially reverse complementary to the guide DNA;

[0024] mixing (a), (b) and (c) to allow the guide DNA to guide the Argonaute protein to target and cleave the target nucleic acid, and determining the amount of the cleaved target nucleic acid in the sample by measuring the fluorescent signal released from the fluorescent group.

[0025] In a third aspect, the present application provides a method for determining a target substance in a sample, the method comprising:

[0026] (1) providing a system, the system having:

[0027] a nucleic acid aptamer,

[0028] a cDNA,

[0029] a first single-stranded DNA and a second single-stranded DNA; wherein:

[0030] The nucleic acid aptamer contains a third complementary fragment complementary to the cDNA;

[0031] The first ssDNA contains a first complementary fragment complementary to the cDNA;

[0032] The second ssDNA contains a second complementary fragment complementary to the cDNA;

[0033] The first ssDNA and the second ssDNA are at least partially reverse complementary;

[0034] (2) contacting the sample with the system, when the target substance exists in the sample, the nucleic acid aptamer specifically binds to the target substance, releasing the cDNA, and the cDNA is complementary to the first ssDNA and the second ssDNA to form a complex;

[0035] (3) mixing the hairpin probe HP, the hairpin probe cHP, the endonuclease, and the signal probe with the complex, wherein:

[0036] The hairpin probe HP comprises a fragment complementary to the first ssDNA, a fragment complementary to the second ssDNA, an endonuclease recognition site, and the guide DNA of the first aspect;

[0037] The hairpin probe HP comprises a loop region and a stem region, the loop region contains the endonuclease recognition site, and the stem region contains a nucleotide fragment complementary to the hairpin probe cHP;

[0038] The hairpin probe HP is contacted with the complex and complementary hybridizes to form a double-stranded region, exposing the endonuclease recognition site, and the endonuclease cuts the hairpin probe HP at the endonuclease recognition site, so that the hairpin probe HP releases the guide DNA;

[0039] (4) mixing the Argonaute protein, Zn 2+ and the guide DNA of step (3), so that the guide DNA guides the Argonaute protein to target and cut the signal probe, wherein:

[0040] The signal probe is connected with a fluorescent group and a quenching group;

[0041] The guide DNA is at least partially reverse complementary to the signal probe.

[0042] In an embodiment, the third complementary fragment has a length greater than the sum of the lengths of the first complementary fragment and the second complementary fragment.

[0043] In an embodiment, the third complementary fragment has a length of 20 nt, the first complementary fragment has a length of 8 nt, and the second complementary fragment has a length of 8 nt.

[0044] In one embodiment, the nucleic acid aptamer comprises an oligonucleotide sequence, optionally single-stranded DNA or RNA, that binds to a target substance and is capable of specifically binding to the target substance.

[0045] In one embodiment, the hairpin probe HP comprises, in order from 5' end to 3' end, a segment complementary to the first ssDNA, a segment complementary to the second ssDNA, and the guide DNA of the first aspect; the endonuclease recognition site is located on the segment complementary to the second ssDNA, and the endonuclease recognition site is adjacent to the guide DNA of the first aspect without a spacer sequence.

[0046] In one embodiment, the hairpin probe cHP is a single-stranded DNA segment that is partially complementary to the stem region of the hairpin probe HP. The hairpin probe cHP stabilizes the structure of the hairpin probe HP by complementary binding to the stem region of the hairpin probe HP.

[0047] In one embodiment, the guide DNA of the first aspect is located in the stem region of the hairpin probe HP, and the hairpin probe cHP is complementary to the 3' end of the guide DNA of the first aspect by base pairing.

[0048] In one embodiment, the target substance comprises a microorganism. The microorganism can further be optionally a pathogenic microorganism, including but not limited to a virus, a bacterium, a fungus, a chlamydia, a mycoplasma. As an optional example, the pathogenic microorganism can be at least one of Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli.

[0049] In one embodiment, the fluorescent group and the quencher group are each independently located at the 5' end or the 3' end of the signal probe.

[0050] In one embodiment, the fluorescent group comprises but is not limited to FAM, Alexa fluor 405, HEX, CY3, CY5, ROX, VIC, JOE, TET, Texas Red, or a combination thereof.

[0051] In one embodiment, the quencher group comprises but is not limited to TAMARA, BHQ, DABSYL, or a combination thereof.

[0052] In one embodiment, the guide DNA is a single-stranded DNA molecule.

[0053] In one embodiment, the signal probe is a single-stranded DNA molecule.

[0054] In one embodiment, the 3' terminal nucleotide of the signal probe is 5' rAG 3'.

[0055] In one embodiment, the nucleic acid aptamer, cDNA, first single-stranded DNA, second single-stranded DNA, hairpin probe HP, hairpin probe cHP and signal probe are selected from at least one group of (a)-(c) below:

[0056] (a):

[0057] Nucleic acid aptamer: 5' GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3';

[0058] cDNA: 5' GGGATGACCAGCGAGCGCTA 3';

[0059] First single-stranded DNA: 5' GCGCTCGCCGTCTGTGATCCCCATTCT 3';

[0060] Second single-stranded DNA: 5' CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3';

[0061] Hairpin probe HP: 5' AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT 3';

[0062] Hairpin probe cHP: 5' ACTATGCT 3';

[0063] Signal probe: 5' Fluorescent group-ACTATGCTGGTTrAG-Quenching group 3';

[0064] (b):

[0065] Nucleic acid aptamer: 5' CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 3';

[0066] cDNA: 5' GCTCTGTAGATGGCAAGGCA 3';

[0067] First single-stranded DNA: 5' CCTTGCCACAATGTGACTGTTGCATGA 3';

[0068] Second single-stranded DNA: 5' CCGGCTCGGAAGTGGACTCTCCGAGCCGGACATTGTCTACAGA 3';

[0069] Hairpin probe HP: 5' TCATGCAACAGTCCCGGCTCGGAGAGTCCACTTCCGAGCCGGTCGAACCTTCAACGTCT 3';

[0070] Hairpin probe cHP: 5' AGACGTTG 3';

[0071] Signal probe: 5' Fluorescent group-AGACGTTGAAGGrAG-Quenching group 3';

[0072] (c):

[0073] Nucleic acid aptamer: 5' TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT 3';

[0074] cDNA: 5' CACACATCTCCTCTGCTATA 3';

[0075] First single-stranded DNA: 5' TAGCAGAGAGGACAGAGCTAAGCATCT 3';

[0076] Second single-stranded DNA: 5' CCGGCTCGGAAGTGGACTCAAGCTACCGGTGTCCTGAGATGTG 3';

[0077] Hairpin probe HP: 5' AGATGCTTAGCTCCCGGTAGCTTGAGTCCACTTCCGAGCCGGTCGAACCTCTCGAGTAG 3';

[0078] Hairpin probe cHP: 5' CTACTCGA 3';

[0079] Signal probe: 5' Fluorescent group-CTACTCGAGAGGrAG-Quenching group 3'.

[0080] In one embodiment, the fluorescent groups modified on each group of signal probes are different, and the quenching groups modified on each group of nucleic acid probes are the same or different.

[0081] In one embodiment, the molar concentration ratio of the nucleic acid aptamer and the cDNA is not limited, and can be (10-1):1, and further can be 1:1. The molar concentration of the nucleic acid aptamer can be not less than 0.05 μM, not less than 0.1 μM, not less than 0.2 μM, not less than 0.5 μM, or not less than 1 μM. Preferably, it is not less than 0.2 μM.

[0082] In an embodiment, the molar concentration ratio of the hairpin probe HP and the hairpin probe cHP is not limited, and can be (10-1):1, and further can be 1:1. The molar concentration of the hairpin probe HP can be not less than 0.05 μM, not less than 0.1 μM, not less than 0.2 μM, not less than 0.5 μM or not less than 1 μM. Preferably, the molar concentration of the hairpin probe HP is not less than 0.2 μM.

[0083] In an embodiment, the method does not involve diagnosis and / or treatment of a disease.

[0084] In a fourth aspect, the present application provides a reaction system, which comprises the guide DNA of the first aspect, a signal probe and an Argonaute protein; the guide DNA and the signal probe are at least partially reverse complementary; the signal probe is connected with a fluorescent group and a quenching group; and the 3' end nucleotide of the signal probe is 5' rAG 3'.

[0085] In a fifth aspect, the present application provides a kit, which comprises the guide DNA of the first aspect or the reaction system of the fourth aspect.

[0086] It should be understood that, within the scope of the present application, the above technical features of the present application and the technical features specifically described in the following (such as the examples) can be combined with each other to form new or preferred technical solutions. Due to the limited space, they will not be listed one by one here.

[0087] Compared with the prior art, the present application has the following beneficial effects:

[0088] 1. The nonlinear gDNA provided by the present application can significantly enhance the cleavage efficiency of CbAgo. By exploring the length of gDNA, the conformation of gDNA and the position of the conformation, the present application screens out the best gDNA zyme (a gDNA comprising a DNAzyme fragment). The DNAzyme fragment is located at the 5' end of the gDNA zyme When the DNAzyme fragment is located at the 5' end of the gDNA, the DNAzyme fragment has a synergistic effect of enhancing the cleavage efficiency of CbAgo, which expands the cleavage site of CbAgo, and the cleavage efficiency of CbAgo is significantly enhanced.

[0089] 2、The application breaks the traditional thinking of the middle-temperature type Ago needing to combine various amplification reactions to realize high-sensitivity detection. In the past, detection based on the middle-temperature type Ago combined, such as polymerase chain reaction, loop-mediated isothermal amplification, recombinase polymerase amplification technology, etc., to meet the sensitivity requirements. The application can realize high-sensitivity detection of target objects without amplification, avoid the cumbersome amplification process, save economic and time costs, improve the convenience of operation, and greatly broaden the application of the middle-temperature type Ago.

[0090] 3、The application is based on gDNA zyme Enhancing the mechanism of CbAgo, a gDNA zyme mediated CbAgo aptamer sensor without amplification is developed. First, based on the fact that pathogenic bacteria can recognize and bind to their corresponding aptamer DNA, a hairpin probe containing a cleavage enzyme recognition site and a gDNA zyme fragment is designed as a structure conversion element; finally, with the help of the cutting effect of endonuclease, gDNA zyme acts together with CbAgo on the signal probe. This design fully utilizes the gDNA zyme enhances the mechanism of CbAgo, and realizes detection in a homogeneous environment, avoiding cumbersome operation steps such as solid-phase separation. In the quantitative detection of single Staphylococcus aureus, the detection limit reached 35 CFU / mL, which is much higher than that of the direct use of gDNA zyme group (detection limit 587 CFU / mL) and linear gDNA group guided CbAgo (detection limit 1.06 x 10 5 CFU / mL). In addition, the method described in the application can simultaneously detect a variety of pathogenic bacteria, and the sensitivity can reach 46 CFU / mL. It widens the application of CbAgo in the detection field, and provides technical support for multiple detection of target objects. BRIEF DESCRIPTION OF DRAWINGS

[0091] Figure 1 is the whole process flowchart of the application, wherein A represents the exploration of the influence of nonlinear gDNA on the cleavage activity of CbAgo; B represents the mechanism exploration of gDNA zyme enhancing the cleavage activity of CbAgo; C represents the application of gDNA zyme enhancing the multiple detection of CbAgo.

[0092] Figure 2 The application is the schematic diagram of the influence of linear gDNA mutation on the cleavage activity of CbAgo in Example 1. Wherein A represents the process schematic diagram of linear gDNA and CbAgo pre-assembled cutting tDNA; B represents the sequence of mutant gDNA; C represents the comparison of gDNA+tDNA and CbAgo+gDNA+tDNA signal values.

[0093] Figure 3 The is a schematic diagram of the effect of nonlinear gDNA on CbAgo cleavage activity in Example 1, wherein A represents the schematic diagram of pre-assembly of CbAgo and cutting of tDNA; B represents the sequence of nonlinear gDNA; C represents CbAgo + nonlinear gDNA C-M + tDNA signal value.

[0094] Figure 4 The is a schematic diagram of the effect of nonlinear gDNA on CbAgo cleavage activity in Example 1, wherein A represents the schematic diagram of pre-assembly of CbAgo and cutting of tDNA; B represents the sequence of nonlinear gDNA; C represents CbAgo + nonlinear gDNA zyme on CbAgo, wherein A represents CbAgo + nonlinear gDNA C-M14 + tDNA, gDNA zyme + tDNA, and gDNA zyme + tDNA + CbAgo schematic diagram; B represents the comparison of signal values of the three in A.

[0095] Figure 5 The is a schematic diagram of the effect of nonlinear gDNA on CbAgo cleavage activity in Example 1, wherein A represents the schematic diagram of pre-assembly of CbAgo and cutting of tDNA; B represents the sequence of nonlinear gDNA; C represents CbAgo + nonlinear gDNA zyme mechanism of DNAzyme at different positions in gDNA to improve the cleavage efficiency of CbAgo, A represents gDNA zyme schematic diagram of the movement of rA (DNAzyme cleavage site) of DNAzyme fragment and tDNA in gDNA; B represents gDNA of DNAzyme at different positions zyme and tDNA at different positions, and the corresponding gDNA of different positions zyme + tDNA and CbAgo + gDNA zyme comparison of signal values of tDNA and CbAgo + gDNA.

[0096] Figure 6 The is a schematic diagram of the effect of nonlinear gDNA on CbAgo cleavage activity in Example 1, wherein A represents the schematic diagram of pre-assembly of CbAgo and cutting of tDNA; B represents the sequence of nonlinear gDNA; C represents CbAgo + nonlinear gDNA zyme to enhance the utility of CbAgo, wherein gDNA is represented in the figure 1zyme + tDNA and CbAgo + gDNA 1zyme comparison of signal values of tDNA and linear gDNA + tDNA with two base mismatches with tDNA.

[0097] Figure 7 The is a schematic diagram of the effect of nonlinear gDNA on CbAgo cleavage activity in Example 1, wherein A represents the schematic diagram of pre-assembly of CbAgo and cutting of tDNA; B represents the sequence of nonlinear gDNA; C represents CbAgo + nonlinear gDNA zyme mechanism of gDNA to enhance the cleavage activity of CbAgo, wherein A represents the movement of the PIWI domain of CbAgo; B represents the rotation of the CbAgo structure shown in A by 90°; C represents an enlarged schematic diagram of the residues in B; D represents the comparison of Δ values with and without DNAzyme; E represents the density distribution of catalytic residues when there is DNAzyme; F represents the density distribution of catalytic residues when there is no DNAzyme.

[0098] Figure 8The fluorescence experiment in Example 3 explores gDNA zyme The guide CbAgo cleavage site, where A represents the modification of the tDNA at different positions to quench the group; B represents the signal ratio with or without CbAgo; C represents linear gDNA and nonlinear gDNA 1zyme Comparison of CbAgo cleavage sites.

[0099] Figure 9 Whether the remaining DNAzyme in Example 4 enhances the CbAgo cleavage activity, where A represents the schematic diagram of DNAzyme+tDNA and DNAzyme+tDNA+CbAgo; B represents the signal value comparison of DNAzyme+tDNA and DNAzyme+tDNA+CbAgo.

[0100] Figure 10 The design principle and feasibility verification diagram for quantitative detection of Staphylococcus aureus in Example 5, where A represents the flowchart of the sensor constructed for detecting Staphylococcus aureus; B represents the polyacrylamide gel electrophoresis diagram for verifying the binding of Staphylococcus aureus and aptamer; C represents the polyacrylamide gel electrophoresis diagram for verifying the structure conversion in the sensor; D represents the comparison of detection signals with and without Staphylococcus aureus.

[0101] Figure 11 The condition optimization of the sensor for quantitative detection of Staphylococcus aureus in Example 5, where A represents the concentration optimization of aptamer and cDNA; B represents the concentration optimization of HP and cHP.

[0102] Figure 12 Performance evaluation of the sensor for quantitative detection of Staphylococcus aureus in Example 5, where A represents the detection signal value of negative and different concentrations of Staphylococcus aureus concentration; B represents the linear relationship between the logarithmic value of Staphylococcus aureus concentration and the fluorescence intensity difference; C represents the specificity analysis of the sensor.

[0103] Figure 13 Sensitivity of the sensor for quantitative detection of Staphylococcus aureus in Example 5 by other methods, where A represents the detection performance of the sensor based on gDNA zyme ; B represents the detection performance of the sensor guided by linear gDNA CbAgo.

[0104] Figure 14 Performance evaluation of the sensor for quantitative detection of gradient dilution of mixed Staphylococcus aureus, Escherichia coli and Salmonella in Example 6, where A represents the detection performance of the sensor for detecting Staphylococcus aureus in multiple targets; B represents the detection performance of the sensor for detecting Escherichia coli in multiple targets; C represents the detection performance of the sensor for detecting Salmonella in multiple targets; D represents the schematic diagram of the detection process.

[0105] Figure 15 gDNA in Example 6 zyme The performance evaluation of the constructed sensor for simultaneously detecting mixed Staphylococcus aureus, Escherichia coli, and Salmonella was conducted. Here, A represents the sensor's detection performance for Staphylococcus aureus among multiple targets; B represents the sensor's detection performance for Escherichia coli among multiple targets; and C represents the sensor's detection performance for Salmonella among multiple targets.

[0106] Figure 16 This is a performance evaluation of the sensor constructed using linear gDNA-guided CbAgo in Example 6, which simultaneously detects mixed Staphylococcus aureus, Escherichia coli, and Salmonella. Here, A represents the sensor's detection performance in detecting Staphylococcus aureus among multiple targets; B represents the sensor's detection performance in detecting Escherichia coli among multiple targets; and C represents the sensor's detection performance in detecting Salmonella among multiple targets.

[0107] Figure 17 This is an analysis of the sensitivity of the real-time quantitative polymerase chain reaction (qPCR) method used in Example 6 to detect Staphylococcus aureus, Escherichia coli, and Salmonella. In this analysis, A represents the detection performance of qPCR for Staphylococcus aureus; B represents the detection performance of qPCR for Escherichia coli; and C represents the detection performance of the sensor for Salmonella among multiple targets.

[0108] Figure 18 gDNA in Example 6 zyme Evaluation of cross-interference performance of enhanced CbAgo-mediated sensors, where A represents the specificity analysis of the E. coli system and B represents the specificity analysis of the Salmonella system.

[0109] Figure 19 gDNA in Experiment Example 7 zyme Performance evaluation of enhanced CbAgo-mediated sensors in clinical sample detection, where A represents gDNA. zyme A comparison of enhanced CbAgo sensor and plate counting method for clinical sample detection; B indicates gDNA. zyme Enhance the detection results of clinical samples using CbAgo sensors; C represents the significance analysis of the clinical sample detection results. Detailed Implementation

[0110] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation of the invention in any way.

[0111] In the present application, the term "cDNA" means a single-stranded DNA fragment capable of base-pairing with an aptamer.

[0112] In the present application, the term "DNAzyme" or "DNA enzyme" means the same and are used interchangeably, both of which refer to a catalytic molecule composed of deoxyribonucleic acid (DNA). A DNAzyme forms a catalytic core through its specific nucleotide sequence, binds to a target substrate and catalyzes the hydrolysis of a phosphodiester bond.

[0113] In the present application, the term "signal probe" refers to a nucleic acid sequence labeled with a fluorescent group and a quencher group, used to detect the occurrence of a specific nucleic acid reaction. The signal probe is designed such that when it is not cleaved, the fluorescent group interacts with the quencher group, causing the fluorescence signal to be quenched. When the signal probe is cleaved, the fluorescent group and the quencher group are separated, releasing a detectable fluorescence signal.

[0114] In the present application, the term "Argonaute protein cleavage activity" refers to the efficiency of cleavage of a target nucleic acid or a signal probe by an Argonaute protein. Example:

[0115] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials and reagents used in the following examples are commercially available, unless otherwise specified.

[0116] The CbAgo used in the following examples is a mesophilic Argonaute protein derived from Clostridium butyrium, which has an amino acid sequence shown in NCBI accession number WP_058142162.1.

[0117] Example 1: Effect of gDNA length and conformation on CbAgo cleavage efficiency

[0118] In this example, the length and conformation of gDNA were optimized step by step based on traditional linear gDNA.

[0119] 1. Effect of linear mutant gDNA sequence on CbAgo cleavage efficiency

[0120] (1) Design linear mutant gDNA for reporter DNA

[0121] Reporter DNA: tDNA M : FAM-ACTATGCTGGAGTT-BHQ1;

[0122] Mutant gDNA and its sequence are shown in Table 1 below:

[0123] Table 1 Mutant gDNA and its sequence

[0124]

[0125]

[0126] (2) Verify the effect of linear mutant gDNA on CbAgo cleavage efficiency

[0127] First, 100 μg / mL CbAgo and 2 μM gDNA were mixed in 1 × BB buffer, and 100 μM Zn(Ac)2was added, and incubated at 37°C for 20 min. Then add tDNA to a final concentration of 200 nM, and then add 1 μL of ultrapure water to a final volume of 10 μL of reaction solution, and incubate at 37°C for 1 h. Finally, the fluorescence signal was detected by SpectraMax i3.

[0128] In the presence of gDNA, CbAgo and tDNA, gDNA is loaded on CbAgo, and then guides CbAgo to cut tDNA, thereby generating a fluorescence signal Figure 2 ). As the number of bases on gDNA hybridized with tDNA decreases, the CbAgo cleavage efficiency gradually decreases.

[0129] 2, Effect of non-linear gDNA structure on CbAgo cleavage efficiency

[0130] (1) Design non-linear gDNA for reporter DNA

[0131] The non-linear gDNA and its sequence are shown in Table 2 as follows:

[0132] Table 2 Non-linear gDNA and its sequence

[0133] gDNA Sequence gDNA C-M0 ]]> AACTCCAGCATAGT gDNA C-M1 ]]> AACCCCAGCATAGT gDNA C-M3 ]]> AACCGACCAGCATAGT gDNA C-M6 ]] AACCGACAGCCAGCATAGT gDNA C-M9 ]] AACCGACAGCACCCAGCATAGT gDNA C-M12 ]]> AACCGACAGCACGACCCAGCATAGT gDNA C-M14 ]]> AACCGACAGCACGACACCCAGCATAGT gDNA C-M15 ]]> AACCGACAGCACGACACGCCAGCATAGT

[0134] (2) Verify the effect of non-linear gDNA on CbAgo cleavage efficiency

[0135] The reaction system is shown in 1(2) above, and the results are shown in Figure 3 , which shows that the structure of non-linear gDNA has a significant effect on CbAgo cleavage efficiency, and the non-complementary sequence Figure 3 The circular protruding part in the 3-9 nt range significantly reduces the cleavage efficiency, and as the non-complementary sequence continues to increase, the CbAgo cleavage efficiency rises, and when the non-complementary sequence increases to 12-15 nt, the CbAgo cleavage efficiency rises to the level of gDNA C-M0 .

[0136] 3, gDNA containing DNAzyme structure (gDNA zymeEffect on CbAgo cleavage efficiency

[0137] (1) Design gDNA for reporter DNA zyme

[0138] gDNA zyme : 5' AATCCGAGCCGGTCGAACCAGCATAGT 3';

[0139] (2) Verify nonlinear gDNA zyme Effect on CbAgo

[0140] The experimental schematic diagram is shown in Figure 4 A.

[0141] Set up gDNA zyme group (replace gDNA with equal amount of gDNA zyme ), DNAzyme group (replace gDNA with equal amount of gDNA zyme ) and gDNA C-M14 group (use gDNA C-M14 as gDNA), the reaction system is shown in 1(2) above, the difference is that the DNAzyme group does not add CbAgo (replaced with equal amount of ddH2O).

[0142] The results show that the gDNA zyme guided CbAgo cleavage effect is higher than that of gDNA C-M14 and DNAzyme group Figure 4 B).

[0143] Example 2: Effect of different positions of DNAzyme in gDNA zyme on CbAgo cleavage efficiency

[0144] 1. Effect of different positions of DNAzyme in gDNA zyme on CbAgo cleavage efficiency

[0145] The experimental schematic diagram is shown in Figure 5 A.

[0146] (1) Design corresponding nonlinear gDNA for reporter DNA with different catalytic sites zyme , the reporter DNA (tDNA) and the corresponding gDNA zyme sequences are shown in Table 3. Among them, "rA" in tDNA represents ribonucleotide adenosine, and the underlined part in gDNA zyme represents the DNAzyme catalytic core.

[0147] Table 3. Reporter DNA (tDNA) and corresponding gDNAzyme sequences

[0148]

[0149]

[0150] (2) Verification of nonlinear gDNA zyme Effect on CbAgo cleavage efficiency

[0151] The reaction system is shown in Example 1, and the results are shown in Figure 5 B, gDNA 1zyme has the best effect.

[0152] 2. Verification of optimal gDNA zyme Enhancement effect on CbAgo cleavage efficiency

[0153] Three experimental groups were designed, including gDNA 1zyme and tDNA (i.e. DNAzyme cleavage), tDNA and linear gDNA with two base mismatches to tDNA M2 , and tDNA, CbAgo and nonlinear gDNA with two base mismatches to tDNA 1zyme , the sequences of which are as follows:

[0154] gDNA 1zyme : 5'-TCCGAGCCGGTCGAAAACCAGCATAGT-3';

[0155] tDNA: 5'-FAM-ACTATGCTGGTTrAG-BHQ1-3';

[0156] gDNA M2 : 5'-TAAACCAGCATAGT-3'.

[0157] The reaction system is shown in Example 1, and the results are shown in Figure 6 . The results show that the fluorescence signal of gDNA 1zyme + CbAgo + tDNA group (F) is higher than that of gDNA 1zyme + tDNA group (F1) and linear gDNA M2 + CbAgo + tDNA group (F2), i.e. F > F1 + F2. The above results show that gDNA 1zyme guided CbAgo cleavage is not a simple superposition of CbAgo and DNAzyme cleavage effect, and gDNA 1zyme guided CbAgo cleavage has obvious synergistic effect. The spatial structure of nonlinear gDNA 1zyme is more likely to form a useful binary complex with CbAgo, or the interaction of nonlinear gDNA 1zyme with CbAgo may increase the cleavage site, thereby improving the cleavage efficiency of CbAgo.

[0158] Example 3: Verification of gDNA zyme Mechanism of enhancing the cleavage activity of CbAgo

[0159] 1. Molecular dynamics simulation

[0160] The structure of CbAgo (PDB ID: 6QZK) is shown in Figure 7 A, and the structure after docking with the substrate is shown in Figure 7 B, 7C.

[0161] CbAgo contains four domains N, PAZ, MID, PIWI, among which the PIWI domain contains four catalytic residues (i.e. D541, E577, D611, D727) Figure 7 B and C, red amino acid sites), which have the activity of catalytic endonuclease and are crucial for the cleavage activity of CbAgo, and the movement of gDNA zyme relative to CbAgo will affect the cleavage efficiency of CbAgo. Therefore, this embodiment performs molecular dynamics (MD) simulation on CbAgo guided by gDNA containing DNAzyme and gDNA not containing DNAzyme, and calculates the ΔX value (i.e. ΔX = X DNA* -X PIWI ) between the PIWI domain and the DNA* double-stranded centroid coordinate along the main axis of the DNA* double strand during the simulation.

[0162] The results are shown in Figure 7 D, and in the presence of DNAzyme, the distribution of ΔX value presents two peaks, indicating a wider range, while in the absence of DNAzyme, there is only one narrow peak. It is shown that when DNAzyme is present, the PIWI domain has obvious translational movement in the X direction along gDNA zyme , Figure 7 The dashed arrow in A and the solid arrow in 7D respectively represent the direction of movement.

[0163] In the presence of DNAzyme, the large-scale global movement of the PIWI domain along gDNA zyme will cause the rearrangement of the local interaction between the catalytic residues in CbAgo and the potential cleavage site of tDNA. In order to describe the distribution characteristics of CbAgo catalytic residues around the original cleavage site of tDNA and its adjacent sequence, the atomic number density of CbAgo catalytic residues and the phosphate group from tDNA projected on the Y-Z plane is calculated.

[0164] The results are shown in Figure 7 E (with DNAzyme) and AACCAGCATAGTAF (no DNAzyme) is shown. With DNAzyme, the distribution area of the catalytic residue density is larger than that without DNAzyme, indicating that these residues move along the DNA double strand under the action of DNAzyme. Specifically, with the presence of DNAzyme, there are 4 nucleotide bases (i.e. DA, DT, DG, DC in the 5'-to-3' direction) near the CbAgo catalytic residue atomic number density distribution area, while there are only 3 (i.e. DT, DG, DC in the 5'-to-3' direction) without DNAzyme. Therefore, when DNAzyme is present, the number of nucleotides near the CbAgo catalytic residues increases, which helps to increase the potential cleavage site of CbAgo, thereby improving the cleavage efficiency.

[0165] The above docking takes the gDNA / tDNA double strand as the docking substrate of CbAgo, wherein the common segment of the gDNA / tDNA double strand with and without 8-17 DNAzyme is underlined and labeled as DNA*:

[0166] gDNA / tDNA double strand without 8-17 DNAzyme:

[0167] g-DNA: 5'-OH-GCT TTGGTCGTATCA -3';

[0168] t-DNA: 3'-GrA AACCAGCATAGTA -5'.

[0169] gDNA / tDNA double strand containing 8-17 DNAzyme:

[0170] g-DNA: 5'-OH-TCCGAGCCGGTCGAA TTGGTCGTATCA -3';

[0171] t-DNA: 3'-GrA Figure 8 -5'.

[0172] 2. Fluorescence experiment

[0173] MD simulation results show that gDNA zymeThe presence of DNAzyme leads to the movement of the PIWI domain and the increase in the number of potential cleavage sites of CbAgo. The cleavage site of CbAgo is between 10-11 nt of tDNA (Literature 1: Programmable DNA cleavage by Ago nucleases from mesophilic bacteria Clostridium butyricum and Limnothrix rosea; Literature 2: Argonaute integrated single-tube PCR system enables supersensitive detection of rare mutations; Literature 3: Programmable cleavage of linear double-stranded DNA by combined action of Argonaute CbAgo from Clostridium butyricum and nuclease deficient RecBC helicase from E. coli.) In order to further clarify the gDNA 1zyme The cleavage site of CbAgo is between 10-11 nt of tDNA (Literature 1: Programmable DNA cleavage by Ago nucleases from mesophilic bacteria Clostridium butyricum and Limnothrix rosea; Literature 2: Argonaute integrated single-tube PCR system enables supersensitive detection of rare mutations; Literature 3: Programmable cleavage of linear double-stranded DNA by combined action of Argonaute CbAgo from Clostridium butyricum and nuclease deficient RecBC helicase from E. coli.) In order to further clarify the gDNA Figure 8 A).

[0174] The sequence is as follows (5'-3'):

[0175] tDNA (S4): FAM-ACTATGCTGGT-BHQ1-TrAG;

[0176] tDNA (S5): FAM-ACTATGCTGT-BHQ1-TTrAG;

[0177] tDNA (S6): FAM-ACTATGCTT-BHQ1-GTTrAG;

[0178] tDNA (S7): FAM-ACTATGC-BHQ1-TGGTTrAG;

[0179] tDNA (S8): FAM-ACTATG-BHQ1-TTGGTTrAG;

[0180] tDNA (S9): FAM-ACTAT-BHQ1-TCTGGTTrAG;

[0181] tDNA(S10): FAM-ACTA-BHQ1-TGCTGGTTrAG.

[0182] Different BHQ1 marker sites will produce different intensities of fluorescence signals in the presence or absence of CbAgo. Since the DNAzyme cleavage site is located between the 2' and 3' sites near the 3' end of tDNA, it can be inferred that the fluorescence signal between the 4' and 14' sites is generated by CbAgo cleavage.

[0183] Experimental results are as follows Figure 8 As shown in Figure B, when BHQ1 is labeled on the 4th, 5th, 6th, and 7th bases, a strong fluorescent signal is generated in the presence of CbAgo, which is recorded as F. on In the absence of CbAgo, there was almost no fluorescence signal, recorded as F. off The ratio of the two signals R = F on / F off >1. When BHQ1 is labeled on the 8th, 9th, and 10th bases, almost no fluorescent signal is observed regardless of the presence of CbAgo, and the ratio of the two signals is R = F. on / F off <1. Further analysis of the significance of the R values ​​of the signal generated by adjacent bases of the BHQ1 marker showed that the R value between the 7th and 8th bases was the most significant. Therefore, it can be inferred from the R values ​​that when gDNA... 1zyme When CbAgo cleaves tDNA, the CbAgo cleavage site changes from the original 10-11 nt site to multiple potential cleavage sites, and shifts 3 to 7 nucleotides towards the 5' end of the gDNA (between the 4' and 8' ends of the tDNA), primarily between the 7' and 8' ends of the tDNA. Figure 9 C).

[0184] Example 4: Verifying the universality of DNAzyme in enhancing CbAgo cleavage activity

[0185] To evaluate gDNA zyme In addition to the 8-17 DNAzymes mentioned above, this example also investigated several metal-specific DNAzymes, including Mg, to demonstrate the universality of CbAgo-mediated enhanced activity. 2+ Zn 2+ Pb 2+ Cu 2+ Hg 2+ Co 2+ UO2 2+ And other metal-specific DNAzymes, such as GR-5, 10-23, IR-3, and NaA43 DNAzyme ( Figure 9A). Experimental methods refer to Example 1, except that a final concentration of 500 nM Pb(Ac)2was added to the GR-5 system, a final concentration of 100 mM Zn(Ac)2was added to the 10-23 system, a final concentration of 2 mM Zn(Ac)2was added to the IR-3 system, and a final concentration of 100 mM NaCl was added to the NaA43 system.

[0186] The experimental results show that gDNA GR-5 based on GR-5 (gDNA 10-23 ), 10-23 (gDNA IR-3 ), IR-3 (gDNA NaA43 ) and NaA43 (gDNA zyme ) all significantly enhance the cleavage activity of CbAgo Figure 10 B). The results confirm that the gDNA design principles, theories and potential mechanisms outlined in the above section of this study have been preliminarily verified and extended.

[0187] Related sequences (5'-3'):

[0188] gDNA GR-5 : ACAGACATCATCTCTGAAGTAGCGCCGCCGTATAGTGAG;

[0189] tDNA GR-5 : CY3-CTCACTATrAGGAAGAGATGATGTCTGT-BHQ2.

[0190] gDNA 10-23 : TAAGTCAGGCTAGCTACAACGACCTCT;

[0191] tDNA 10-23 : CY5-TCGAGAGGrAUGACTTAAAGTCTAAC-BHQ2.

[0192] gDNA IR-3 : CAGGTATCTAGTTGAGCTGTCTA;

[0193] tDNA IR-3 : ROX-TAGACGTTGAAGGATACCTG-BHQ2.

[0194] gDNA NaA43 : CGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGAT AGA;

[0195] tDNA NaA43:ROX-CTCTATCTATrAGGAAGTACCGCCGC-BHQ2.

[0196] Example 5: gDNA zyme Enhanced CbAgo-mediated sensors for quantitative detection of Staphylococcus aureus

[0197] 1. Sensor design feasibility and optimization

[0198] a. Sensor Design

[0199] To evaluate the designed gDNA zyme To enhance the practical application of CbAgo, Staphylococcus aureus was selected as the target bacterium, and a method based on gDNA was developed. zyme The experimental procedure for enhancing CbAgo-mediated aptamer sensors is shown in the diagram below. Figure 10 As shown in Figure A, this sensor utilizes gDNA. zyme This enhances the cleavage activity of CbAgo, thereby providing amplification-free and ultrasensitive detection, overcoming the shortcomings of the low cleavage activity of traditional CbAgo.

[0200] The specific experimental method is as follows:

[0201] (1) At room temperature, the aptamer (Apt), cDNA, and two input strands S1 and S2 were first mixed and hybridized in 1×BB buffer at a ratio of 1:1:1:1. Then, negative nucleotides (replaced with an equal amount of ddH2O) and different concentrations (10, 10) were used for hybridization. 2 10 3 10 4 10 5 10 6 10 7 10 8 Staphylococcus aureus (CFU / mL) was incubated at 37°C for 45 min, with Apt, cDNA, S1, and S2 at a final concentration of 200 nM, and the volume of the reaction mixture was 5 μL.

[0202] (2) Add hairpin probe HP (designed to a final concentration of 200 nM based on the target analyte), its complementary cHP, signal probe, 0.1 U / μL Nt.BstNBI cleavage enzyme, NEBuffer, and 100 μM zinc acetate to the reaction mixture obtained in step (1). Incubate at 55 °C for 45 min. The total volume is 10 μL.

[0203] (3) Finally, add 100 μg / mL CbAgo and react at 37℃ for 30 min;

[0204] (4) Add the reaction solution to the enzyme label well and use a multi-functional microplate reader to detect the fluorescence signal.

[0205] The materials used above and their sequences are as follows:

[0206] Apt: 5'GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3';

[0207] cDNA: 5'GGGATGACCAGCGAGCGCTA 3';

[0208] Strand 1(S1): 5'GCGCTCGCCGTCTGGTGATCCCCATTCT 3';

[0209] Strand 2(S2): 5'CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3';

[0210] HP: 5'AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT 3';

[0211] cHP: 5'ACTATGCT 3';

[0212] tDNA: 5'FAM-ACTATGCTGGTTrAG-BHQ1 3'.

[0213] In the presence of *S. aureus*, the aptamer preferentially binds to *S. aureus*, and the free cDNA forms a triple-stranded hybridization complex with the tail of the input splitting strand, opening the stem and loop of the hairpin probe HP and achieving a complete hybridization conformation. The formed double strand is recognized by *Nt. BstNBI* at a specific cleavage site, resulting in cleavage and the release of gDNA containing DNAzyme fragments. zyme Sequence. When CbAgo is added, it forms a binary complex with the luciferin (5'-FAM, 3'-BHQ1), which cleaves the tDNA labeled with luciferin (5'-FAM, 3'-BHQ1) to produce a fluorescent signal.

[0214] The binding of different nucleotide chains during the above reaction was verified by gel electrophoresis, and the results are as follows: Figure 10 As shown in B and 10C, S. aureus releases cDNA after binding to Apt. Figure 10 Lane B, 6), cDNA forms a complex with S1 and S2 ( Figure 10 Lane C4), the complex opens the HP and cHP double-stranded structures ( Figure 10C lane 3), exposing the Nt.BstNBI enzyme cleavage site locked in the HP hairpin structure, so as to be recognized by Nt.BstNBI. The fluorescence signal detection results show that, compared with the case without target, the case with target has a stronger fluorescence characteristic absorption peak at 520 nm Figure 11 D). The preliminary verification of the successful construction of the aptamer sensor was carried out by gel electrophoresis and fluorescence spectrum measurement.

[0215] b. Sensor optimization

[0216] The experimental conditions of the constructed aptamer sensor were further optimized, as follows:

[0217] (1) Aptamer-cDNA complex concentration optimization, the specific experimental method is as above, the difference is that the aptamer and cDNA concentrations are set to be 0.05 μM, 0.1 μM, 0.2 μM, 0.5 μM, 1 μM, respectively.

[0218] (2) HP-cHP complex concentration optimization, the specific experimental method is as above, the difference is that the HP and cHP concentrations are set to be 0.05 μM, 0.1 μM, 0.2 μM, 0.5 μM, 1 μM, respectively.

[0219] The results are shown in Figure 12 A and 11B, respectively, the optimal aptamer-cDNA complex concentration is 0.2 μM, and the optimal HP-cHP complex concentration is 0.2 μM, and the subsequent detection is carried out under the optimal conditions.

[0220] 2. Performance evaluation

[0221] a. Sensitivity determination

[0222] Based on the above optimal conditions, the gDNA zyme sensors were detected, and the sensitivity of the gDNA zyme sensors was enhanced, and the sensors based on gDNA zyme sensors and linear gDNA (i.e. cDNA) guided CbAgo sensors as controls, as follows:

[0223] Experimental method:

[0224] I. Sensitivity determination of gDNA zyme sensors

[0225] (1) At room temperature, Apt, cDNA, S1, S2 were hybridized in 1:1:1:1 ratio in 1x BB buffer, and negative (replaced with the same amount of ddH2O) and different concentrations (10, 10 2 , 10 3 , 10 4 xx, 10 510 6 10 7 10 8 S. aureus (CFU / mL) was subjected to an incubation at 37°C for 45 minutes, with Apt, cDNA, S1, and S2 having a final concentration of 200 nM and a volume of 5 μL.

[0226] (2) Add HP, cHP, tDNA, 0.1 U / μL Nt.BstNBI and 100 μM Zn to the reaction mixture obtained in step (1) to a final concentration of 200 nM. 2+ The reaction was carried out at 55°C for 45 minutes, and the system volume was 10 μL.

[0227] (3) Add the reaction solution into the enzyme label well and use SpectraMax i3 to monitor the generated fluorescence signal.

[0228] II. Sensitivity Determination of CbAgo Sensor Based on Linear gDNA (i.e., cDNA) Guidance

[0229] (1) At room temperature, Apt and cDNA were subjected to different concentrations of S. aureus at 37°C for 45 minutes, with the final concentration of Apt and cDNA being 200 nM.

[0230] (2) Add 100 μg / mL CbAgo to the above reaction system and react at 37 °C for 30 min;

[0231] (3) After adding tDNA to a final concentration of 200 nM, the reaction solution was added into the enzyme label wells, and the generated fluorescence signal was monitored using SpectraMax i3.

[0232] gDNA zyme Enhanced CbAgo-mediated sensor sensitivity detection results are as follows: Figure 13 As shown in Figures A and 12B, the fluorescence at 520 nm gradually increases with increasing S. aureus concentration, with a linear range of 10⁻¹⁰. 8 The detection limit was 35 CFU / mL (based on a threshold of three standard deviations of a blank sample), and the linear regression equation was y = 332526.83x - 348125.35 (R²). 2 =0.98, where x represents the concentration of *S. aureus*, y = F - F0, where F is the fluorescence value in the presence of *S. aureus* and F0 is the fluorescence value in the absence of *S. aureus*. (Compared to gDNA-based...) zyme Compared to the detection limit of the previous sensor (587 CFU / mL), this sensor's sensitivity is improved by approximately 17 times. Figure 13A); and the detection limit of the sensor based on linear gDNA guided CbAgo was 1.06 x 10 5 The sensitivity of this sensor was improved by 3000 times compared with CFU / mL Figure 12 B).

[0233] b. Anti-interference performance determination

[0234] In order to evaluate the anti-interference performance of the sensor, Escherichia coli, Listeria monocytogenes and Salmonella were introduced as interference targets, and the specific experimental method was the same as above, except that Staphylococcus aureus was replaced by ddH2O, Salmonella, Escherichia coli, Listeria monocytogenes or mixed strains of the above strains for detection.

[0235] The results show that only when Staphylococcus aureus exists, a significant fluorescence signal will be generated Figure 14 C), which indicates that the sensor platform has good anti-interference performance.

[0236] Example 6: gDNA zyme Enhanced CbAgo-mediated sensor for simultaneous quantitative detection of multiple targets

[0237] In this embodiment, Staphylococcus aureus, Escherichia coli and Salmonella are taken as examples for simultaneous detection of three targets, and those skilled in the art can make routine replacements according to the needs of the targets, or further increase the detection targets.

[0238] The experimental schematic diagram is shown in Name A.

[0239] 1. gDNA zyme Enhanced CbAgo-mediated sensor for simultaneous quantitative detection of multiple targets

[0240] Experimental method: First, the aptamer (Apt) corresponding to each pathogenic bacterium, cDNA and S1 and S2 with 8 bases hybridized to cDNA were mixed in 1 x BB buffer at a ratio of 1:1:1:1. Then, different concentrations of three kinds of pathogenic bacteria prepared were added, and the final reaction system was 15 μL, ensuring that the final concentration of each DNA chain was 200 nM, and the reaction was carried out at 37°C for 45 minutes. Then, 200 nM of three kinds of HP, cHP and tDNA modified with three different fluorophores, 0.1 U / μL Nt.BstNBI and 100 μM Zn 2+ . Finally, in the environment of 1 x NEBuffer with a total volume of 30 μL, the reaction was carried out at 55°C for 45 minutes, then CbAgo was added to ensure its final concentration was 100 μg / mL, and the fluorescence signal generated was recorded using SpectraMax i3 after reaction at 37°C for 30 minutes.

[0241] The sequence information used for different targets is as follows:

[0242] For S. aureus detection:

[0243] Apt (S. aureus): 5' GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCC ACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA 3';

[0244] cDNA (S. aureus): 5' GGGATGACCAGCGAGCGCTA 3';

[0245] Strandl (S. aureus): 5' GCGCTCGCCGTCTGTGATCCCCATTCT 3';

[0246] Strand2 (S. aureus): 5' CCGGCTCGGAAGTGGACTCTCCCAGCCGGCAGACGTGGTCATC 3';

[0247] HP (S. aureus): 5' AGAATGGGGATCACCGGCTGGGAGAGTCCACTTCCGAGCCGGTCGAAAACCAGCATAGT 3';

[0248] cHP (S. aureus): 5' ACTATGCT 3';

[0249] tDNA (S. aureus): 5' FAM-ACTATGCTGGTTrAG-BHQl 3'.

[0250] For E. coli detection:

[0251] Apt (E. coli): 5' CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 3';

[0252] cDNA (E. coli): 5' GCTCTGTAGATGGCAAGGCA 3';

[0253] Strandl (E. coli): 5' CCTTGCCACAATGTGACTGTTGCATGA 3';

[0254] Strand 2 (E. coli): 5' CCGGCTCGGAAGTGGACTCTCCGAGCCGGACATTGTCTACAGA 3';

[0255] HP (E. coli): 5' TCATGCAACAGTCCCGGCTCGGAGAGTCCACTTCCGAGCCGGTCGAACCTTCAACGTCT 3';

[0256] cHP (E. coli): 5' AGACGTTG 3';

[0257] tDNA (E. coli): 5' ROX-AGACGTTGAAGGrAG-BHQ2 3'.

[0258] For Salmonella detection:

[0259] Apt (Salmonella): 5' TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGA TGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT 3';

[0260] cDNA (Salmonella): 5' CACACATCTCCTCTGCTATA 3';

[0261] Strand 1 (Salmonella): 5' TAGCAGAGAGGACAGAGCTAAGCATCT 3';

[0262] Strand 2 (Salmonella): 5' CCGGCTCGGAAGTGGACTCAAGCTACCGGTGTCCTGAGATGTG 3';

[0263] HP (Salmonella): 5' AGATGCTTAGCTCCCGGTAGCTTGAGTCCACTTCCGAGCCGGTCGAACCTCTCGAGTAG 3';

[0264] cHP (Salmonella): 5' CTACTCGA 3';

[0265] tDNA (Salmonella): 5' CY5-CTACTCGAGAGGrAG-BHQ2 3'.

[0266] 2, with gDNA only zymeThe constructed sensor for simultaneous detection of multiple targets, linear gDNA-guided CbAgo sensor, and real-time quantitative polymerase chain reaction (qPCR) as a control, and the specific experimental methods are as follows:

[0267] a. Only gDNA zyme The constructed sensor for simultaneous detection of multiple targets:

[0268] (1) At room temperature, S. aureus, E. coli, Salmonella corresponding to three kinds of Apt, cDNA, S1, S2 were hybridized in 1x BBuffer at a ratio of 1:1:1:1, and different concentrations of S. aureus, E. coli, Salmonella were incubated at 37°C for 45 minutes, wherein the final concentration of Apt, cDNA, S1, S2 was 200 nM, and the system was 5 μL;

[0269] (2) To the reaction mixture obtained in step (1), 200 nM of HP, cHP, tDNA, 0.1 U / μL Nt.BstNBI and 100 μM Zn were added 2+ , and the reaction was carried out at 55°C for 45 minutes, and the system was 10 μL;

[0270] (3) The reaction solution was added to the enzyme-labeled hole, and the fluorescence signal generated was monitored using SpectraMax i3. The sequences used for different targets are as above.

[0271] b. Linear gDNA (i.e. cDNA) guided CbAgo sensor:

[0272] (1) At room temperature, S. aureus, E. coli, Salmonella corresponding to three kinds of Apt and cDNA were incubated with different concentrations of S. aureus, E. coli, Salmonella at 37°C for 45 minutes, wherein the final concentration of Apt, cDNA was 200 nM;

[0273] (2) To the above reaction system, 100 μg / mL CbAgo was added to a final concentration, and the reaction was carried out at 37°C for 30 min;

[0274] (3) After adding tDNA to a final concentration of 200 nM, the reaction solution was added to the enzyme-labeled hole, and the fluorescence signal generated was monitored using SpectraMax i3. The Apt and cDNA sequences used for different targets are as in Example 6, and the tDNA sequences are as follows:

[0275] tDNA (S. aureus): 5' FAM-TCGCTGGTCATCCC-BHQ1 3';

[0276] tDNA (E. coli): 5' ROX-GCCATCTACAGAGC-BHQ2 3';

[0277] tDNA (Salmonella): 5' CY5-AGAGGAGATGTGTG-BHQ2 3'.

[0278] c. qPCR

[0279] (1) 5uL Mix, 1 μL, 15 μM upstream primer, 1 μL, 15 μM downstream primer, 1 μL, 15 μM signal probe, different concentrations of extracted bacterial DNA, ddH2O, mixed together, the primers are shown in Table 4 below;

[0280] (2) 95°C for 5 minutes, 95°C for 10 seconds, 55°C for 20 seconds, 72°C for 20 seconds, 40 cycles, and monitoring in real-time fluorescence quantitative instrument.

[0281] Table 4 Primers for qPCR

[0282] Sequence (5’-3’) Staphylococcus aureus upstream primer TTCTTCACGACTAAATAAACGCTCA Staphylococcus aureus downstream primer GGTACTACTAAAGATTATCAAGACGGCT Staphylococcus aureus signal probe CAGAACACAATGTTTCCGATGCAACGT Escherichia coli upstream primer TCCTCAGCTATAGGGTGCTTTG Escherichia coli downstream primer ATCGAAACAAGGCCAGTTTTTTAC Escherichia coli signal probe TATTTTTCCGAGTACATTGGCATCGTGTGG Salmonella upstream primer GCGGCGTTGGAGAGTGATA Salmonella downstream primer AGCAATGGAAAAAGCAGGATG Salmonella signal probe CATTTCTTAAACGGCGGTGTCTTTCCCT Figure 14

[0283] Experimental results:

[0284] Using gDNA zyme Enhanced CbAgo-mediated sensor results as Figure 15 (14A-C are the detection ranges of S. aureus, E. coli and Salmonella, respectively), only gDNA zyme Constructed multi-target sensor as results Figure 15 ( Figure 16 A-C represent the detection ranges of S. aureus, E. coli and Salmonella, respectively), linear gDNA guided CbAgo sensor as results Figure 16 ( Figure 17 A-C represent the detection ranges of S. aureus, E. coli and Salmonella, respectively), qPCR detection results as Figure 17 ( Figure 14 A-C represent the real-time fluorescence kinetic detection curves and detection ranges of S. aureus, E. coli and Salmonella, respectively) using gDNA zyme Enhanced CbAgo-mediated sensor detection results show that under different excitation wavelengths, the linear range of three pathogenic bacteria S. aureus, E. coli and Salmonella is 10 to 10 6 CFU / mL. In addition, according to the 3σ principle, the detection limit of three pathogenic bacteria S. aureus, E. coli and Salmonella is calculated as 46 CFU / mL, 76 CFU / mL and 75 CFU / mL Figure 17A-C). gDNA zyme The linear range of the sensor constructed for simultaneous detection of multiple targets was 10 3 -10 6 CFU / mL, according to the 3σ principle, the detection limit of the three pathogenic bacteria S. aureus, E. coli and Salmonella was calculated to be 665 CFU / mL, 2050 CFU / mL and 665 CFU / mL respectively. The sensor constructed in this embodiment (gDNA zyme Enhanced CbAgo-mediated sensor) and gDNA zyme Compared with the sensor constructed for simultaneous detection of multiple targets, the sensitivity (LOD) of S. aureus, E. coli and Salmonella was improved by 15 times, 27 times and 9 times respectively, which indicated that the presence of CbAgo improved the gDNA zyme Activated CbAgo-mediated aptamer sensor sensitivity. The linear range of the gDNA-guided CbAgo sensor for simultaneous detection of multiple targets was 5x10 6 -10 7 CFU / mL, 10 6 -10 7 CFU / mL, 2.5x10 5 -5x10 6 CFU / mL, according to the 3σ principle, the detection limit of the three pathogenic bacteria S. aureus, E. coli and Salmonella was calculated to be 4.19x10 5 CFU / mL, 5.03x10 4 CFU / mL and 1.94x10 5 CFU / mL, the LOD of S. aureus, E. coli and Salmonella of the sensor constructed in this embodiment was improved by 9100 times, 600 times and 2500 times respectively compared with the linear gDNA-guided CbAgo sensor. Compared with the real-time quantitative polymerase chain reaction (qPCR) method, the method provided in this embodiment also showed higher sensitivity Figure 18 ).

[0285] To evaluate the anti-interference performance of the sensor in multiplex detection, cross-interference experiments were performed using S. aureus, E. coli, L. monocytogenes and Salmonella, and the specific method was referred to Example 5, with the difference that when evaluating the anti-interference performance of E. coli, the detection system of E. coli was used, and other bacteria were used as interference; when evaluating the anti-interference performance of Salmonella, the system of Salmonella was used, and other bacteria were used as interference. The results showed that the cross-interference of each sensor channel was minimal, indicating that the sensor had good anti-interference performance Figure 19 ).

[0286] Example 7: gDNA zyme Enhanced CbAgo-mediated sensor for clinical detection

[0287] The experimental procedure is shown in Figure 19 A.

[0288] To verify the effectiveness of gDNA zyme Enhanced CbAgo-mediated sensor for practical application, 52 patients and 10 healthy people (China Wuhan Central Theater Command Hospital) were detected by plate counting method and the method described in Example 6, the sample source is shown in Table 5, the specific method is referred to Example 6, the difference is that the target of detection is clinical sample. The hospital uses clinical method (clinical method is to screen and isolate pathogenic bacteria with selective medium, and then identify combined with morphological characteristics and physiological and biochemical characteristics and qPCR method).

[0289] The detection results show that 30 samples are identified as Escherichia coli positive, 20 samples are identified as Staphylococcus aureus positive, 2 samples are identified as Salmonella positive, and the rest are negative ​ B-C) gDNA zyme The detection results of the enhanced CbAgo-mediated aptamer sensor are very close to the detection results of the plate counting method (Table 6), and compared with the clinical method, the gDNA zyme The accuracy of the enhanced CbAgo-mediated sensor for detecting Staphylococcus aureus, Escherichia coli and Salmonella is 90%, 93% and 100% respectively, indicating that the aptamer sensor has extremely high accuracy when analyzing real samples. Compared with plate counting method, plate counting method needs 40-48 hours, and goes through several separation and culture steps to obtain accurate results, while the sensor can realize accurate multiplex detection within 2 hours without DNA extraction and amplification steps, which has great practical application potential.

[0290] Table 5 Sample source

[0291]

[0292]

[0293] Table 6 Detection results of different detection methods

[0294]

[0295] Although the present application has been disclosed in its preferred embodiments with reference to the accompanying drawings, it is not intended to limit the present application thereto, and various modifications and alterations can be made thereto by those skilled in the art without departing from the spirit and scope of the present application, and the scope of protection of the present application should be defined by the appended claims.

Claims

1. A guide DNA that enhances the cleavage activity of an Argonaute protein, characterized in that, The guide DNA comprises: (a) a DNA enzyme having a nucleotide sequence as shown in SEQ ID NO. 1; (b) Single-stranded DNA capable of binding to the Argonaute protein, said Argonaute protein being derived from Clostridium butyricum (Clostridium butyricum). Clostridium butyrium The mesophilic Argonaute protein CbAgo; The DNA enzyme is connected to the 5' end of the single-stranded DNA.

2. A method of detecting a target nucleic acid, characterized by, The method comprises: (a) providing the guide DNA of claim 1; (b) providing the Argonaute protein of claim 1; (c) providing a target nucleic acid; the target nucleic acid is modified with a fluorescent group and a quencher group; the target nucleic acid is at least partially reverse complementary to the guide DNA, and the 3' terminal nucleotide of the target nucleic acid is 5' rAG 3'; Mixing (a), (b) and (c) to guide the Argonaute protein to target and cleave the target nucleic acid, and determining the content of the cleaved target nucleic acid in the sample by measuring the fluorescence signal released by the fluorescent group; The method does not involve the diagnosis and / or treatment of diseases.

3. A method of determining a target substance in a sample, characterized by, The method comprises: (1) providing a system, the system comprising: a nucleic acid aptamer, a cDNA, a first single-stranded DNA and a second single-stranded DNA; wherein: the nucleic acid aptamer comprises a third complementary fragment complementary to the cDNA; the first single-stranded DNA comprises a first complementary fragment complementary to the cDNA; the second single-stranded DNA comprises a second complementary fragment complementary to the cDNA; the first single-stranded DNA and the second single-stranded DNA are at least partially reverse complementary; (2) contacting a sample with the system, when the target substance exists in the sample, the nucleic acid aptamer specifically binds to the target substance, releases the cDNA, and the cDNA is complementary to the first single-stranded DNA and the second single-stranded DNA to form a complex; (3) mixing a hairpin probe HP, a probe cHP, an endonuclease and a signal probe with the complex, wherein: the hairpin probe HP comprises a fragment complementary to the first single-stranded DNA, a fragment complementary to the second single-stranded DNA, an endonuclease recognition site and the guide DNA of claim 1; the hairpin probe HP comprises a loop region and a stem region, the loop region comprises the endonuclease recognition site, and the stem region comprises a nucleotide fragment complementary to the probe cHP; the hairpin probe HP is contacted with the complex and complementary hybridized to form a double-stranded region, exposing the endonuclease recognition site, and the endonuclease cuts the hairpin probe HP at the endonuclease recognition site, so that the hairpin probe HP releases the guide DNA; (4) mixing the Argonaute protein of claim 1, Zn 2+ and the guide DNA of step (3), such that the guide DNA directs the Argonaute protein to target and cleave the signal probe. the signal probe is connected with a fluorescent group and a quencher group, and the 3' terminal nucleotide of the signal probe is 5' rAG 3'; the guide DNA is at least partially reverse complementary to the signal probe; the method does not involve the diagnosis and / or treatment of diseases. the nucleic acid aptamer, the cDNA, the first single-stranded DNA, the second single-stranded DNA, the hairpin probe HP, the probe cHP and the signal probe are selected from at least one group of (a)~(c): (a) for Staphylococcus aureus detection: the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO. 2; The nucleotide sequence of the cDNA is shown as SEQ ID NO. 3; The nucleotide sequence of the first single-stranded DNA is shown as SEQ ID NO. 4; The nucleotide sequence of the second single-stranded DNA is shown as SEQ ID NO. 5; The nucleotide sequence of the hairpin probe HP is shown as SEQ ID NO. 6; The nucleotide sequence of the probe cHP is 5' ACTATGCT 3'; The nucleotide sequence of the signal probe is shown as SEQ ID NO. 7; (b) for detection of E. coli: The nucleotide sequence of the aptamer is shown as SEQ ID NO. 8; The nucleotide sequence of the cDNA is shown as SEQ ID NO. 9; The nucleotide sequence of the first single-stranded DNA is shown as SEQ ID NO. 10; The nucleotide sequence of the second single-stranded DNA is shown as SEQ ID NO. 11; The nucleotide sequence of the hairpin probe HP is shown as SEQ ID NO. 12; The nucleotide sequence of the probe cHP is 5' AGACGTTG 3'; The nucleotide sequence of the signal probe is shown as SEQ ID NO. 13; (c) for detection of Salmonella: The nucleotide sequence of the aptamer is shown as SEQ ID NO. 14; The nucleotide sequence of the cDNA is shown as SEQ ID NO. 15; The nucleotide sequence of the first single-stranded DNA is shown as SEQ ID NO. 16; The nucleotide sequence of the second single-stranded DNA is shown as SEQ ID NO. 17; The nucleotide sequence of the hairpin probe HP is shown as SEQ ID NO. 18; The nucleotide sequence of the probe cHP is 5' CTACTCGA 3'; The nucleotide sequence of the signal probe is shown as SEQ ID NO.

19.

4. A reaction system characterized in that, The reaction system comprises the guide DNA of claim 1, the signal probe, and the Argonaute protein of claim 1; the guide DNA and the signal probe are at least partially reverse complementary; the signal probe is connected with a fluorescent group and a quenching group; and the 3' terminal nucleotide of the signal probe is 5' rAG 3'.

5. A kit characterized in that, The kit comprises the guide DNA of claim 1 or the reaction system of claim 4.

Images