Nucleic acid aptamer binding to foxj1 protein and application thereof

By improving the screening conditions and methods, we obtained the chemically stable, easy-to-store and label nucleic acid aptamers WJM-01 and WJM-11, which solved the difficulties in FOXJ1 protein detection and targeted drug development in the existing technology, achieved high sensitivity and specific binding, and were applied to the detection, diagnosis and treatment of FOXJ1 protein.

CN118638797BActive Publication Date: 2025-10-10ZHEJIANG UNIV OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410785450.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-18
Publication Date
2025-10-10
Estimated Expiration
2044-06-18

AI Technical Summary

Technical Problem

It is difficult to find nucleic acid aptamers with high affinity, good specificity, and easy modification and artificial synthesis for FOXJ1 protein with existing technology, which can be used for high-sensitivity detection of FOXJ1 protein and development of targeted drugs.

Method used

By improving the SELEX screening conditions and combining magnetic bead method with serum competitive screening, we obtained chemically stable, easy-to-store and label nucleic acid aptamers, including WJM-01 and WJM-11, which have high affinity and specificity for binding to FOXJ1 protein.

Benefits of technology

It achieves high affinity and high specificity binding to FOXJ1 protein, and is suitable for the detection, diagnosis, imaging and treatment of FOXJ1 protein, with broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004898494330000041
    Figure BDA0004898494330000041
  • Figure HDA0004898494340000011
    Figure HDA0004898494340000011
  • Figure HDA0004898494340000012
    Figure HDA0004898494340000012
Patent Text Reader

Abstract

The application discloses a nucleic acid aptamer combined with a FOXJ1 protein and application thereof, wherein the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2, or has a nucleotide sequence with at least 30% homology with SEQ ID NO. 1 or SEQ ID NO. 2 and capable of being combined with the FOXJ1 protein, or has an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The nucleic acid aptamer has relatively stable structure, is simple, easy to modify, can be artificially synthesized in a short time, is stable in chemical properties, is easy to preserve and label, can be used in detection, diagnosis, imaging and treatment and the like, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

(1) Technical field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a nucleic acid aptamer binding to FOXJ1 protein and an application thereof. (2) Background technology

[0002] The FOX family of transcription factors is a newly discovered class of molecules involved in tumorigenesis and progression. The role of FOX family members in gastric cancer has also attracted considerable research interest. Studies have shown that FOXC2, FOXM1, and FOXQ1 are overexpressed in gastric cancer. FOXM1b can promote vascular endothelial growth factor activation and angiogenesis in gastric cancer, suggesting a pro-oncogenic role. Furthermore, FOXD3 is downregulated during Helicobacter pylori-induced hypermethylation, implicated in HP-induced gastric cancer. Furthermore, FOXO3a and RUNX3 synergistically activate Bim and induce apoptosis in gastric cancer cells, suggesting that FOXD3 and FOXO3a may be involved in suppressing gastric cancer development. Furthermore, FOXM1 and FOXC1 have been shown to promote liver cancer metastasis by promoting the expression of MMP-7, RhoC, and ROCK1 or by inducing EMT. FOXQ1 can also promote oncogenesis and metastasis by inducing EMT and recruiting macrophages.

[0003] FOXJ1, a member of the forkhead / winged helix (Fox) transcription factor family, has the ability to suppress spontaneous autoimmunity by antagonizing NF-κB activation in T cells. As a member of the FOX family, in addition to playing important regulatory roles in embryonic development and differentiation, ciliogenesis, and the suppression of autoimmune responses, FOXJ1 has recently been found to play diverse roles in the development and progression of various tumors. On the one hand, FOXJ1 may play a tumor suppressor role in breast and ovarian cancer; on the other hand, some studies have reported a possible tumor-promoting role in liver cancer. This suggests that FOXJ1 may be heterogeneously expressed in tumors and play different roles in different tumor microenvironments.

[0004] Aptamers are DNA or RNA molecules isolated and screened through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process. Aptamers can bind with high affinity and specificity to other targets, such as proteins, metal ions, small molecules, peptides, and even entire cells. Therefore, they hold great promise in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared to antibodies, aptamers offer advantages such as smaller molecular weight, improved stability, ease of modification, lack of immunogenicity, and a shorter production cycle. They can be synthesized artificially, eliminating the need for animal immunization, animal husbandry, protein extraction, and purification. Therefore, identifying aptamers with higher affinity and specificity for the FOXJ1 protein would facilitate highly sensitive and specific detection of the FOXJ1 protein and aid in the development of drugs targeting it.

[0005] Therefore, there is an urgent need to find a nucleic acid aptamer with high binding affinity to FOXJ1 protein, good specificity, easy modification and artificial synthesis, good stability, and convenient use. (3) Summary of the invention

[0006] The present invention aims to provide a nucleic acid aptamer that binds to the FOXJ1 protein and its application. By improving the screening conditions, a nucleic acid aptamer with a small molecular weight, stable chemical properties, easy storage and labeling is obtained. It can also maintain high affinity and high specificity binding to the FOXJ1 protein and can be used in detection, diagnosis, imaging and treatment, with broad application prospects.

[0007] The technical solution adopted in the present invention is:

[0008] In a first aspect, the present invention provides a nucleic acid aptamer that binds to the FOXJ1 protein, wherein the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2; or has a nucleotide sequence that is at least 30% homologous to SEQ ID NO.1 or SEQ ID NO.2 and binds to the FOXJ1 protein; or has an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] Based on the SELEX technique, the present invention designed and synthesized a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that are small in molecular weight, chemically stable, easy to store and label, and capable of binding to the FOXJ1 protein with high affinity. This screening yielded two high-affinity FOXJ1-binding nucleic acid aptamers, WJM-01 (SEQ ID NO. 1) and WJM-11 (SEQ ID NO. 2). These aptamers have high affinity and specificity for the FOXJ1 protein. The amino acid sequence of the FOXJ1 protein is shown in SEQ ID NO. 3.

[0010] It is understood that a nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% homology to the nucleic acid aptamers provided herein and that binds to the FOXJ1 protein, for example, a nucleotide sequence of any of the above-mentioned nucleic acid aptamers may have a portion of the sequence deleted or a portion of the sequence added, and still have a high affinity for the FOXJ1 protein and still fall within the scope of protection of the present invention. The nucleic acid aptamers described in the present invention also include modifications to a position on the nucleotide sequence of the above-mentioned nucleic acid aptamers, for example, phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or isotopization, provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it may have an affinity for binding to the FOXJ1 protein that is equal to or greater than that of the parent nucleic acid aptamer sequence before modification, or it may have a higher stability even though the affinity is not significantly improved. Therefore, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the FOXJ1 protein, and the modification is selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopization, which is still within the scope of protection of the present invention.

[0011] In a second aspect, the present invention provides a conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2; the conjugate of the nucleic acid aptamer includes a fluorescent marker; the derivative of the nucleic acid aptamer includes a phosphorothioate backbone or peptide nucleic acid that binds to the FOXJ1 protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0012] The aptamer conjugates described in the present invention refer to nucleic acid aptamers connected to other groups, such as fluorescent markers with marking functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA or enzyme labels, so that the modified nucleic acid aptamer sequence has desirable properties, for example, it can have an affinity for binding to FOXJ1 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0013] In other words, the aptamers mentioned above, whether partially substituted or modified, all have substantially the same or similar molecular structure, physicochemical properties, and functions as the original aptamers, and can be used to bind to the FOXJ1 protein.

[0014] The present invention also provides aptamer derivatives, which are derived by modifying the nucleotide sequence backbone of the aforementioned aptamer to a phosphorothioate backbone that binds to the FOXJ1 protein, or are peptide nucleic acids that bind to the FOXJ1 protein by modifying the aptamer or aptamer conjugate described in any of the aforementioned technical solutions. The prerequisite is that the derivatives have substantially the same or similar molecular structure, physicochemical properties, and functions as the original aptamer and bind to the FOXJ1 protein.

[0015] The term "phosphorothioate backbone" as used herein has the meaning generally understood by those of ordinary skill in the art and refers to the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers that can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone having phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets and enhanced resistance to nuclease degradation.

[0016] The term "peptide nucleic acid," as used herein, has the meaning generally understood by those skilled in the art and refers to a synthetic analog of a DNA molecule first reported by Nielsen et al. in 1991. Using N-(2-aminoethyl)-glycine units instead of the sugar-phosphate backbone as repeating structural units, oligonucleotide mimics linked by peptide bonds are synthesized, termed peptide nucleic acids. Because peptide nucleic acids (PNAs) lack the phosphate groups found in DNA or RNA, there is no electrical repulsion between PNAs and DNA, resulting in a stronger binding strength between the two than between DNA.

[0017]

[0018] In a third aspect, the present invention provides a product for purifying or detecting FOXJ1 protein comprising the nucleic acid aptamer, wherein the product includes the nucleic acid aptamer or the conjugate or derivative of the nucleic acid aptamer; the product includes any one or more of a kit, a detection chip, and a chromatography detection device.

[0019] In a fourth aspect, the present invention provides a method for screening nucleic acid aptamers that bind to FOXJ1 protein. The method is based on the SELEX screening method (10.1016 / j.biochi.2018.09.001). In the magnetic bead screening step, serum is added from the 4th to 7th rounds of screening for competition to further improve the specificity and stability of the nucleic acid aptamer.

[0020] Furthermore, serum was added in the 4th to 7th rounds. The specific process was as follows: serum with a volume concentration of 2% was added to the supernatant of the 4th and 5th rounds of reverse screening, and serum with a volume concentration of 5% was added to the supernatant of the 6th and 7th rounds of reverse screening for positive screening. The human serum was normal human serum purchased from Beijing Solebau Technology Co., Ltd., item number: SL010.

[0021] Furthermore, the method comprises the following steps:

[0022] (1) Synthesize a random single-stranded DNA library with a random region length of 20-40 bp;

[0023] (2) Magnetic bead screening: at least 7 rounds of reverse screening and positive screening were performed, and reverse screening was performed before each round of positive screening. Serum was added to the supernatant of the reverse screening in the 4th and 5th rounds at a volume concentration of 2%, and serum was added to the supernatant of the reverse screening in the 6th and 7th rounds at a volume concentration of 5% for positive screening. The reverse screening was performed by incubating the random single-stranded DNA library with magnetic beads coupled with His small peptide at 25°C for 1 hour, in order to remove some sequences bound to His and the magnetic beads. The screening was performed by adding the reverse screening supernatant to magnetic beads coupled with FOXJ1 protein and incubating at 25°C for 1 hour.

[0024] Furthermore, the sequence of the random single-stranded DNA library in step (1) is:

[0025] 5'-ATTGGCACTCCACGCATAGG-36N-CCTATGCGTGCTACCGTGAA-3', where N represents the base C, T, A, or G.

[0026] The conventional conditions for nucleic acid aptamer screening are carried out in an ionic buffer, while the present invention gradually adds a certain concentration of serum under the screening conditions. On the one hand, because the serum contains rich proteins, it can compete with the proteins on the surface of the magnetic beads to bind to the library, thereby removing those sequences that have weak binding ability to the target FOXJ1 protein or are only adsorbed. On the other hand, the aptamer binds to the target in a serum environment, which can better meet the actual detection environment of the application based on nucleic acid aptamer development in the later stage. Studies have shown that in subsequent rounds of screening, the use of high concentrations of serum can screen for nucleic acid aptamers with higher affinity and better specificity.

[0027] In a fifth aspect, the present invention provides a use of the nucleic acid aptamer in preparing a reagent for detecting or purifying FOXJ1 protein, wherein the nucleic acid aptamer includes a conjugate or derivative of the nucleic acid aptamer. The reagent for detecting FOXJ1 protein includes a FOXJ1 protein imaging reagent.

[0028] In a sixth aspect, the present invention provides the use of the nucleic acid aptamer in preparing a preparation targeting FOXJ1 protein, wherein the nucleic acid aptamer includes a conjugate or derivative of the nucleic acid aptamer. The preparation targeting FOXJ1 protein includes an agent or drug for diagnosing and treating abnormal FOXJ1 expression.

[0029] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0030] 1. By improving the screening conditions, a chemically stable, easy-to-store and label aptamer capable of binding to FOXJ1 protein with high affinity and specificity was obtained;

[0031] 2. The nucleic acid aptamers provided by the present invention have a relatively stable, simple structure, are easy to modify, can be artificially synthesized in a short period of time, have stable chemical properties, and are easy to store and label;

[0032] 3. The nucleic acid aptamers provided by the present invention can be used for detection, diagnosis, imaging, and treatment, such as purification or high-sensitivity detection of FOXJ1 protein; preparation of drugs targeting FOXJ1 protein; preparation of reagents or drugs for diagnosis and treatment of abnormal FOXJ1 expression, etc., and have broad application prospects. (IV) Description of the accompanying drawings

[0033] Figure 1 Schematic diagram of the detection of the binding ability of the random library (pool 0) and the enriched libraries obtained from the first (pool 1), fourth (pool 4), sixth (pool 6), and seventh rounds (pool 7) of screening with the target protein using the chemiluminescence method in Example 1.

[0034] Figure 2Schematic diagram of the affinity test results between nucleic acid aptamer WJM-01 and FOXJ1 protein in Example 2.

[0035] Figure 3 Schematic diagram of the affinity test results between nucleic acid aptamer WJM-11 and FOXJ1 protein in Example 2.

[0036] Figure 4 Schematic diagram of the specificity study results of the nucleic acid aptamer WJM-01 in Example 3.

[0037] Figure 5 Schematic diagram of the specificity study results of nucleic acid aptamer WJM-11 in Example 3.

[0038] Figure 6 Schematic diagram of the dot blot hybridization test results of nucleic acid aptamers on different proteins in Example 4; A represents the biotin-modified nucleic acid aptamer WJM-01, and B represents the biotin-modified nucleic acid aptamer WJM-11.

[0039] Figure 7 Schematic diagram of the dot blot hybridization test results of nucleic acid aptamers on different concentrations of FOXJ1 protein in Example 4; A represents the biotin-modified nucleic acid aptamer WJM-01, and B represents the biotin-modified nucleic acid aptamer WJM-11. (V) Specific implementation methods

[0040] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0041] Example 1: Screening of ssDNA aptamers binding to FOXJ1 protein

[0042] The method for screening ssDNA nucleic acid aptamers that bind to FOXJ1 protein in this embodiment includes the following steps:

[0043] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:

[0044] 5'-ATTGGCACTCCACGCATAGG-36N-CCTATGCGTGCTACCGTGAA-3'; where "36N" represents a sequence consisting of 36 arbitrary nucleotide bases. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0045] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0046] Table 1. Primers and their sequences

[0047] Primer name Sequence (5'-3') Lib10S1 ATTGGCACTCCACGCATAGG Lib10-FAM-S1 FAM-ATTGGCACTCCACGCATAGG Lib10-Biotin-A2 Biotin-TTCACGGTAGCACGCATAGG Lib10A2 TTCACGGTAGCACGCATAGG

[0048] The "S" in the primer name represents the forward primer, and the "A" in the primer name represents the reverse primer. Each primer was prepared into a 100 μM stock solution in ddH2O and stored at -20°C until use.

[0049] 2. Magnetic bead screening

[0050] The magnetic bead method was used for screening, and a total of 7 rounds of screening were performed. The screening process of each round is shown in Table 2.

[0051] Table 2. Screening process of FOXJ1 protein aptamers

[0052] Number of rounds Reverse screening Positive screening buffer solution First round Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer Second round Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer Round 3 Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer Round 4 Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer with 2% serum Fifth round Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer with 2% serum Round 6 Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer with 5% serum Round 7 Coupled His magnetic beads Coupling FOXJ1 protein DPBS buffer with 5% serum

[0053] The specific screening process is as follows:

[0054] 1) Coupling with FOXJ1 protein

[0055] Take 300 μl of non-covalent magnetic beads (Hangzhou Luomi Medical Technology Co., Ltd., catalog number: PN003-1), wash three times with 600 μl of DPBS containing 0.02% Tween 20, and discard the supernatant. Add 400 μl of FOXJ1 protein (100 μg / ml, purchased from Suzhou Uniprot Biotechnology Co., Ltd., Uniprot: Q92949; amino acid sequence shown in SEQ ID NO. 3) and incubate at 25°C on a vertical mixer for 60 minutes to obtain protein-coupled magnetic beads, labeled MB-FOXJ1, and store in a 4°C refrigerator.

[0056] 2) Coupling His protein

[0057] Similar to step 1), the His peptide was non-covalently coupled to magnetic beads to obtain His-coupled magnetic beads, labeled MB-His, which were used as counter-screening magnetic beads. The His peptide was synthesized by GenScript Biotech Co., Ltd. and consists of nine consecutive histidines.

[0058] 3) Anti-screening and positive screening

[0059] Library dissolution and denaturation: Take 1 OD of the randomized single-stranded DNA library from step 1 and centrifuge at 12,000 rpm for 5 minutes. Pour the library to the bottom of the tube and dissolve it in DPBS buffer to 5 μM. Mix thoroughly and aliquot into PCR tubes for denaturation. The PCR cycler is programmed as follows: hold at 95°C for 10 minutes to unwind the folded strands. Then, hold at 4°C for 5 minutes and equilibrate to room temperature to obtain the processed library.

[0060] Round 1: Add the processed library to 50 μL of MB-His magnetic beads, mix thoroughly, and incubate on a vertical mixer at room temperature for 1 hour. Place on a magnetic stand, collect the supernatant from the reverse screening, and label it "pool-". This will be used as the single-stranded nucleic acid library for positive screening with MB-FOXJ1 magnetic beads. Add the supernatant from the reverse screening to 50 μL of MB-FOXJ1 magnetic beads and incubate on a vertical mixer at 25°C for 1 hour. Place on a magnetic stand, aspirate the supernatant, retain the beads, and wash the beads four times with 200 μL of DPBS. Finally, add 100 μL of ddH2O to the washed beads, incubate in a boiling water bath for 10 minutes, and collect the supernatant, labeling it "elution-FOXJ1".

[0061] Amplification was performed using the nucleic acid molecules in elution-FOXJ1 as template using standard PCR. The method was as follows: 1 mL of elution-FOXJ1 template was added to 1 mL of PCR mix (containing the primers listed in Table 1). The template and PCR mix mixture was aliquoted into 50 μL tubes and added to PCR tubes. Amplification conditions were as follows: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 30 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds, for a total of 21 cycles, and stored at 4°C. The PCR feedstock was prepared using dNTPs (P031-02) purchased from Novozymes and rTaq enzyme (R500Z) purchased from Takara Biotech.

[0062] The amplified product was purified using commercially available Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. 1 / 5 volume of 4M sodium chloride aqueous solution was added to 1mL of PCR product, and then 80μL of SA magnetic beads that had been washed with DPBS and the supernatant removed were added. After incubation on a shaker at room temperature for 30 minutes, the PCR product supernatant was removed. The magnetic beads were then washed three times with DPBS containing 0.02% Tween20, and 100μL of 40mM sodium hydroxide aqueous solution was added after removing the supernatant. After incubation for three minutes, the magnetic beads were removed by magnetic attraction. 4μL of 1M hydrochloric acid was then added to the supernatant to neutralize the single chain, followed by 104μL of 2*DPBS for salt concentration dilution and neutralization. Finally, 208μL of the secondary library dissolved in 1*DPBS was obtained, which can be used as the library for the next round of screening.

[0063] Seven rounds of magnetic bead screening were performed. In each round of magnetic bead screening, MB-His was used for counter-screening before positive screening targeting FOXJ1 protein. Serum was added to the supernatant of the 4th and 5th rounds of counter-screening at a concentration of 2%, and to the supernatant of the 6th and 7th rounds of counter-screening at a concentration of 5%. The serum was human serum (purchased from Beijing Solebow Technology Co., Ltd., catalog number: SL010), which was then used as a single-stranded nucleotide library for positive screening with MB-FOXJ1 magnetic beads.

[0064] During the screening process, the absorbance value at 360-700 nm was detected by chemiluminescence using a microplate reader. The larger the absorbance value, the stronger the binding force, and then the change in the recognition ability of the DNA single-stranded library for FOXJ1 protein was judged. When the recognition ability of the DNA single-stranded library for FOXJ1 protein met the requirements, that is, the binding ability of the screened DNA single-stranded library to the target protein was higher than that of the library initially input for screening ( Figure 1 ), Figure 1 Pool0, Pool1, Pool4, Pool6, and Pool7 represent the random library and the libraries obtained in the 1st, 4th, 6th, and 7th rounds of screening, respectively. It can be seen that the library obtained in the 6th round has a higher affinity with the target than that in the 4th round, and the affinity in the 7th round is much higher than that in the 1st round, meeting the sequencing requirements. The obtained library was analyzed by high-throughput sequencing.

[0065] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewizi Biotechnology (Jiangsu) Co., Ltd., and the affinity was detected using the method of Example 2.

[0066] Finally, two sequences of nucleic acid aptamers with strong binding ability were identified and named WJM-01 and WJM-11, and their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0067] SEQ ID NO.1

[0068] ATTGGCACTCCACGCATAGGTTTGGGAGGGTTAGGTGGTGGTGCGCGGGCGGGATACCTATGCGTGCTACCGTGAA;

[0069] SEQ ID NO.2

[0070] ATTGGCACTCCACGCATAGGTCTTGGGTGGGAGGGGGTGGAGGCGGTCTATGGGTACCTATGCGTGCTACCGTGAA.

[0071] Example 2: Surface Plasmon Resonance (SPR) Detection of the Affinity of Aptamers WJM-01 and WJM-11 to FOXJ1 Protein

[0072] Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize nucleic acid aptamers WJM-01 (SEQ ID NO. 1) and WJM-11 (SEQ ID NO. 2), which were diluted with DPBS buffer to 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM, respectively, as aptamer samples for later use.

[0073] 1. The FOXJ1 protein was coupled to the second channel of the CM5 chip surface. The specific method was as follows: After mixing equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution), 50 μl was injected into the activation chip at a flow rate of 5 μl / min. The FOXJ1 protein was diluted with 10 mM sodium acetate buffer at pH 5.5 to a final concentration of 50 μg / mL and injected with an injection volume of 50 μL and a flow rate of 5 μL / min. The FOXJ1 protein coupling amount was 6898.5 RU. After the injection was completed, ethanolamine (1 M) was injected to block the chip at a flow rate of 5 μL / min and 50 μL was injected. The His small peptide (same as in Example 1) was coupled to the first channel of the CM5 chip surface using the same method as the control channel.

[0074] 2. Detection: Detection parameters were set using a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K). The diluted two aptamer samples were passed through channels 1 and 2 in sequence. The procedure for each aptamer was as follows: injection at 20 μL / min for 2 minutes; dissociation at 20 μL / min for 2 minutes; regeneration with 1.5 M NaCl at 30 μL / min for 30 seconds.

[0075] The affinity test data of nucleic acid aptamers WJM-01 and WJM-11 with FOXJ1 protein are shown in Figure 2 and Figure 3 , KD values ​​are shown in Table 3 below.

[0076] Table 3. Affinity of nucleic acid aptamers and FOXJ1 protein

[0077] Aptamers length Affinity KD for FOXJ1 protein (nM) SEQ ID NO.1(WJM-01): 76 20.6 SEQ ID NO.2 (WJM-11) 76 20.7

[0078] As shown in Table 3, both WJM-01 and WJM-11 have very good affinity for FOXJ1 (the smaller the KD value, the greater the affinity).

[0079] Example 3: Study on the specificity of nucleic acid aptamers WJM-01 and WJM-11

[0080] The FOXJ1 protein in the second channel of Example 2 was replaced with CIQBP protein, CTCF protein, KAPO protein, and MDM2 protein, all purchased from Abotek Biotechnology Co., Ltd. The other operations were the same, and CIQBP protein, CTCF protein, KAPO protein, and MDM2 protein were coupled to the second channel of four channels on the surface of the CM5 chip, with coupling amounts of 2029.6 RU, 1945.5 RU, 754.5 RU, and 3628.2 RU, respectively.

[0081] The affinity test data of nucleic acid aptamer WJM-01 and CIQBP protein, CTCF protein, KAPO protein and MDM2 protein were detected by the method of Example 2. Figure 4 The affinity test data of nucleic acid aptamer WJM-11 and CIQBP protein, CTCF protein, KAPO protein and MDM2 protein are shown in Figure 5 .Depend on Figure 4 and Figure 5 It can be seen that the nucleic acid aptamers WJM-01 and WJM-11 are unable to bind to CIQBP protein, CTCF protein, KAPO protein, and MDM2 protein, indicating that they have very good specificity.

[0082] Example 4: Detection of FOXJ1 protein by dot blot hybridization based on nucleic acid aptamers WJM-01 and WJM-11

[0083] 1. Binding ability of WJM-01 to different proteins

[0084] (1) Take two 8 cm × 2 cm nitrocellulose membranes (purchased from Millipore), dilute FOXJ1 protein, control proteins (BSA, HIS peptide, Her2 protein and CD45 protein, BSA purchased from Sangon Biotech Co., Ltd., His peptide is the same as in Example 1, Her2 protein purchased from Beijing Sino-Biotech Co., Ltd., CD45 purchased from Abotek Biotechnology Co., Ltd.) with DPBS to a protein concentration of 0.5 mg / ml, and spot 2 μL of each sample on the nitrocellulose membrane and air-dry for 30 minutes.

[0085] (2) After drying, block with 10% bovine serum at room temperature for 1 hour. After blocking, wash three times with DPBS-T (DPBS containing 20000 parts per million tween 20) and aspirate clean.

[0086] (3) Biotin-modified WJM-01 nucleic acid aptamer (synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.) was used to 2+ The diluted aptamer was diluted to 500 nM with DPBS, and then the diluted aptamer was incubated with the protein on the nitrocellulose membrane on a shaker at room temperature for 30 minutes.

[0087] (4) After the incubation, the cells were incubated with 5 mM Mg 2+ Wash three times with DPBS-T, 5 minutes each time on a shaker.

[0088] (5) Add 5mM Mg 2+The nitrocellulose membrane was immersed in HRP-Streptavidin (purchased from Beyotime, product number A0303) diluted 1:2000 in DPBS and incubated on a shaker at room temperature for 30 minutes.

[0089] (6) Contains 5mM Mg 2+ Wash three times with DPBS-T, placing on a shaker for 2 minutes each wash.

[0090] (7) Add color development solution (BeyoECL Star ultra-sensitive ECL chemiluminescence kit, purchased from Beyotime, product number P0018A, solution A and solution B are the solutions provided with the kit) at a ratio of solution A: solution B = 1:1 (v / v), and develop the color at room temperature in the dark for 5 minutes.

[0091] (8) Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life Sciences TM LAS 4000 digital imaging system.

[0092] The results are as follows Figure 6 As shown in Figure A, FOXJ1 protein exhibits distinct coloration compared to control protein spots (BSA, His peptide, Her2, and CD54), demonstrating that biotin-modified WJM-01 can be used for membrane hybridization detection of FOXJ1 protein and does not bind to the control proteins. The WJM-01 provided by the present invention binds only to FOXJ1 protein and not to other proteins such as BSA, His peptide, and Her2 protein, demonstrating high specificity.

[0093] 2. Binding ability of WJM-11 to different proteins

[0094] In step 1, the biotin-modified WJM-01 was replaced with the biotin-modified WJM-11. Other operations were the same. The results are shown in Figure 6 As shown in Figure B, FOXJ1 protein showed significant color development compared to the spots of control proteins (BSA protein, His peptide, Her2 protein, and CD54 protein), demonstrating that biotin-modified WJM-11 can be used for membrane hybridization detection of FOXJ1 protein and does not bind to the control proteins. The WJM-11 provided by the present invention can only bind to FOXJ1 protein and cannot bind to other proteins such as BSA protein, His peptide, Her2 protein, and CD54 protein, demonstrating high specificity.

[0095] 3. Binding ability of WJM-01 to different concentrations of FOXJ1 protein

[0096] The FOXJ1 protein was diluted with DPBS to 1.000 mg / ml, 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, and 0.063 mg / ml, respectively, and 2 μL of each sample was spotted on a nitrocellulose membrane and naturally air-dried for 30 minutes. The other operations were the same as in Step 1.

[0097] The results are shown in Table B. Figure 7 As shown in Table A, after the FOXJ1 protein was diluted to 1.000 mg / ml, 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, and 0.063 mg / ml, respectively, the FOXJ1 protein was obviously colored, which indicated that the biotin-modified WJM-01 could be used for the detection of the FOXJ1 protein in membrane hybridization. The WJM-01 could be used for the accurate detection of 63 ug / ml of the FOXJ1 protein.

[0098] 4. Binding capacity of WJM-11 to FOXJ1 protein of different concentrations

[0099] The FOXJ1 protein was diluted with DPBS to 1.000 mg / ml, 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, and 0.063 mg / ml, respectively, and 2 μL of each sample was spotted on a nitrocellulose membrane and naturally air-dried for 30 minutes. In Step 1, the biotin-modified WJM-01 was replaced by biotin-modified WJM-11, and the other operations were the same as in Step 1.

[0100] The results are shown in Table B. Figure 7 As shown in Table B, after the FOXJ1 protein was diluted to 1.000 mg / ml, 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, and 0.063 mg / ml, respectively, the FOXJ1 protein was obviously colored, which indicated that the biotin-modified WJM-11 could be used for the detection of the FOXJ1 protein in membrane hybridization. The WJM-11 could be used for the accurate detection of 63 ug / ml of the FOXJ1 protein.

[0101] The above description is only the preferred embodiment of the present application, but the protection scope of the present application is not limited to this. Any person skilled in the art can make equivalent substitutions or changes to the technical solution and the inventive concept of the present application within the technical range disclosed by the present application, which should be covered in the protection scope of the present application.

Claims

1. A nucleic acid aptamer that binds to FOXJ1 protein, characterized in that: The nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. A conjugate of the nucleic acid aptamer according to claim 1, characterized in that: The conjugate of the nucleic acid aptamer includes a fluorescent marker, and the fluorescent marker is FAM, biotin or digoxigenin. 3 . A product for detecting FOXJ1 protein comprising the nucleic acid aptamer according to claim 1 .

4. The product according to claim 3, characterized in that The product includes the nucleic acid aptamer or the nucleic acid aptamer conjugate.

5. Use of the nucleic acid aptamer according to claim 1 in preparing a reagent for detecting FOXJ1 protein.

Citation Information

Patent Citations

  • Nucleic acid aptamer combined with HGFR protein and application of nucleic acid aptamer

    CN116121255A

  • RNA-regulated fusion proteins and methods of their use

    US20220290161A1