Pcf3 gene and its application for regulating crop quality

By regulating the expression level of the PCF3 gene, the problem of improving rice quality has been solved, resulting in increased rice protein content and palatability. Furthermore, yield can be controlled as needed, providing important genetic resources.

CN118638811BActive Publication Date: 2025-12-12HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410878545.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-02
Publication Date
2025-12-12
Estimated Expiration
2044-07-02

AI Technical Summary

Technical Problem

There is a lack of effective means in the current technology to improve the quality of rice, especially its protein content and taste.

Method used

By regulating the expression level of the PCF3 gene, genetic engineering techniques can be used to overexpress or suppress the PCF3 gene in rice, thereby regulating the content of storage substances and the eating quality of rice.

Benefits of technology

It significantly improves the protein content and eating quality of rice, while also increasing yield as needed, providing better genetic resources for rice quality regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118638811B_ABST
    Figure CN118638811B_ABST
Patent Text Reader

Abstract

The application provides a PCF3 gene and application thereof in regulating crop quality, and belongs to the technical field of crop breeding.The PCF3 gene provided by the application can be used as a quality-related gene of Gramineae, and is especially used for regulating rice trait indexes, including regulating the content of storage substances, yield or eating quality, and the like, so that more gene resources are provided for regulating rice quality.Through the technical scheme provided by the application, in the field of rice quality research and development, if a target rice species is excellent in other traits but the protein content in the rice is too low, the protein content in the rice can be increased by knocking out or mutating the PCF3 gene in the target rice species, so that the PCF3 gene is not expressed, or the PCF3 gene with weakened or no function is expressed;if a target rice species is excellent in other traits but has low yield and poor eating quality, the yield and eating quality can be simultaneously improved by increasing the expression level of the PCF3 gene.The PCF3 gene provided by the application will provide important biological materials for improving rice quality, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of crop breeding, and particularly relates to a PCF3 gene and application thereof in regulating crop quality. BACKGROUND

[0002] Rice (Oryza sativa L.) is an important source of carbohydrates and energy for human beings. The main edible part of rice is endosperm, which is composed of two major components, starch (up to 90% of dry weight) and protein (8-10%). Therefore, starch and protein are the main determinants of nutritional quality, appearance quality, cooking and eating quality, and processing quality of rice.

[0003] There are various rice-related genes disclosed in the prior art, including:

[0004] Chinese patent CN101130785A provides a WRKY protein and its coding gene derived from rice, which are related to drought resistance. The gene or a DNA sequence homologous to the gene and coding a protein with the same function is introduced into plant tissues, cells or organs, and the transformed plant cells, tissues or organs are cultivated into plants to obtain transgenic plants with improved drought resistance. Experiments prove that the gene of the application can significantly improve the tolerance of rice to drought stress, and has no obvious influence on the normal growth and economic traits of rice. The protein and its coding gene of the application have important theoretical and practical significance for the study of plant drought resistance mechanism and the improvement of plant drought resistance and related traits, and will play an important role in the drought-resistant genetic engineering improvement of plants (especially cereal crops), and have a wide application prospect.

[0005] Chinese patent CN108034661A discloses application of OsNPF8.8b gene in improving yield and nutritional quality of rice, and belongs to the field of plant genetic engineering. The amino acid of the protein coded by OsNPF8.8b gene and the cDNA sequence thereof are shown as SEQ ID NO. 1, 2. The application constructs an overexpression plant of rice OsNPF8.8b gene, and finds that increasing the expression of OsNPF8.8b gene can increase the number of tillers and effective panicles of rice, the number of grains per plant and the dry weight of grains per plant, and the content of globulin in rice. The application constructs a mutant plant, and finds that knocking out the expression of OsNPF8.8b gene can reduce the number of tillers of rice, the number of grains per plant and the dry weight of grains per plant, and the content of globulin in rice. Therefore, the OsNPF8.8b gene can be used to promote the improvement of yield and quality of rice, and has important application in improving nitrogen utilization efficiency of rice and improving rice quality.

[0006] However, there is still a lack of more schemes for improving rice quality in the prior art. SUMMARY

[0007] The application aims to provide a PCF3 gene and its application in regulating crop quality, and provides more gene resources for regulating rice quality.

[0008] In order to achieve the above-mentioned application purposes, the application provides the following technical solutions.

[0009] The application provides a Poaceae plant quality related gene PCF3, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0010] The application provides a protein encoded by the above-mentioned Poaceae plant quality related gene PCF3, and the amino acid sequence of the protein is shown in SEQ ID NO. 2.

[0011] The application provides an application of the above-mentioned Poaceae plant quality related gene PCF3, and the yield and / or taste quality of the Poaceae plant are improved by overexpressing PCF3.

[0012] Preferably, the method for overexpressing PCF3 comprises the following steps.

[0013] The cloned PCF3 is constructed into a gene overexpression vector to obtain a recombinant vector;

[0014] The obtained recombinant vector is transformed into Agrobacterium;

[0015] The Agrobacterium is inoculated into crops to realize gene overexpression.

[0016] The application provides an application of the above-mentioned Poaceae plant quality related gene PCF3, and the storage material content in the grain of the Poaceae plant is improved by inhibiting the expression of PCF3.

[0017] Preferably, the method for inhibiting the expression of PCF3 comprises gene mutation of PCF3, complete or partial restriction of the expression level of PCF3, and complete or partial restriction of the protein activity of PCF3 expression.

[0018] Preferably, the Poaceae plant is rice.

[0019] The application provides an amplification primer set for detecting the above-mentioned Poaceae plant quality related gene PCF3, and the primer set comprises an upstream primer and a downstream primer.

[0020] The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 3.

[0021] The nucleotide sequence of the downstream primer is shown in SEQ ID NO. 4.

[0022] The application also provides application of the amplification primer set for detecting the quality-related gene PCF3 of the Poaceae plant in crop quality-related research, which is used for protein content quality trait assisted breeding of crops.

[0023] The application also provides application of the amplification primer set for detecting the quality-related gene PCF3 of the Poaceae plant in crop quality-related research, which is used for total starch content, gum consistency and / or taste quality trait assisted breeding of crops.

[0024] The application has the following beneficial effects:

[0025] The PCF3 gene provided by the application can be used as a quality-related gene of the Poaceae plant, and is particularly used for regulating rice trait indexes, including regulating the content, yield or taste quality of storage substances. The application proves that the PCF3 gene is a negative regulator of the protein content of rice, and knockout of the gene can lead to an increase in the protein content in rice; overexpression of the gene can cause an increase in the total starch content, gum consistency and taste value. Transmission electron microscopy observation shows that the average cross-sectional area of the protein bodies I and II for storing proteins in the endosperm cells of the knockout material (KO-PCF3) of the PCF3 gene is obviously increased. The agronomic trait observation of the transgenic material shows that, compared with the wild type KY131, the spike number per plant, the effective spike number per plant and the panicle length of KO-PCF3 are increased; compared with the wild type ZH11, the grain number per panicle, the seed setting rate, the thousand-grain weight and the yield per plant of OX-PCF3 are obviously increased.

[0026] Through the technical scheme provided by the application, in the field of rice quality research and development, if the target rice has excellent other traits but the protein content in the rice is too low, the protein content in the rice can be increased by knocking out or mutating the PCF3 gene in the target rice, so that the PCF3 gene is not expressed or a functionally weakened or non-functional PCF3 gene is expressed; if the target rice has excellent other traits but has low yield and poor taste, the yield and taste quality can be simultaneously improved by increasing the expression level of the PCF3 gene. The PCF3 gene provided by the application will provide important biological materials for improving the quality of rice and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 Figure a is a PCF3 gene structure and gel migration diagram, and the scale is 100 bp; figure b is a chromatin immunoprecipitation and real-time quantification diagram; figure c is a vector schematic diagram used in the rice leaf sheath protoplast dual luciferase reporter experiment; figure d is a result diagram of the rice leaf sheath protoplast dual luciferase reporter experiment; and figure e is a result diagram of the relative expression amount of the PCF3 gene in various Ghd7-related materials.

[0028] Figure 2 Figure a is a local Manhattan plot of the grain glutelin content in the association population, and figure b is a linkage disequilibrium plot of the significant SNP.

[0029] Figure 3 Figure a is a target and mutation result display diagram of the PCF3 gene, the scale is 100 bp; figure b is a plant type display diagram of the PCF3 knockout mutant and the wild type, the scale is 10 cm; figure c is a schematic diagram of the PCF3 gene overexpression vector; figure d is a plant type display diagram of the PCF3 overexpression plant and the wild type plant, the scale is 10 cm; figure e is a grain storage protein content diagram of the PCF3 each transgenic material and the wild type; figure f is a grain total protein content diagram of the PCF3 each transgenic material and the wild type; figure g is a grain transmission electron microscope diagram of the PCF3 each transgenic material and the wild type in the grain filling period, the scale is 5 μm; figure h is a protein body area statistical result diagram of the PCF3 each transgenic material and the wild type in the grain filling period; figure i is a milled rice display diagram of the PCF3 each transgenic material and the wild type, the scale is 10 mm; figure j is a chalky grain rate and chalky area diagram of the PCF3 each transgenic material and the wild type; figure k is a main eating quality trait diagram of the PCF3 each transgenic material and the wild type; figure l is a ear shape display diagram of the PCF3 each transgenic material and the wild type, the scale is 1 cm.

[0030] Figure 4 Figure a-i are respectively a plant type, a heading stage, a single plant ear number, an effective single plant ear number, a grain number per ear, an ear length, a seed setting rate, a thousand-grain weight and a single plant yield diagram of the PCF3 each transgenic material and the wild type. DETAILED DESCRIPTION

[0031] The PCF3 sequence information provided by the application is as follows:

[0032] The nucleotide sequence of the PCF3 gene (SEQ ID NO. 1) is as follows:

[0033]

[0034] Amino acid sequence of PCF3 protein (SEQ ID NO. 2):

[0035] MIKDLRTLESWAKEKPEIEQPALQAVVGGGGLRAAAAAAEGGMEQQAAPSSSTSTSTNSSRSTSDHHAAAAAAAAAAAAQVAHQHHPFYYAAAQGGANTMPAPASFMGSLAIVPAAAAPGGGGGQVQAAAAPVASSEKKAVVAAGAGAKRPTKDRHTKVEGRGRRIRMPALCAARVFQLTRELGHKTDGETIEWLLQQAEPAIVAATGTGTIPANFSSLAVSLRSAASHSSSPRAAPFHHLQQQQQHDVAAMLGFHHHHHQLLPPPPPHQHPEPTPQDPGAGEFMRKRYREADDLFKDTSRQDPVDGATGEAEQKARAAAAAAAPPPTAPSAMWAVGPNTTGATAAFWMQPAWAFPHGAGAGAAGNTVQAPLQFMSRSSFPTAMNVTMADNNNSSNNNLGMLAALNAGGGGRSGEHQHQHEGQSPAEMDHQRRANGGGGEAGGAASSQFRMIINQFAIVRGFTSPVIYLNHENPIKVAEN

[0036] The technical solutions provided by the present application will be described in detail below in combination with the embodiments, but they should not be understood as limiting the scope of protection of the present application.

[0037] Embodiments

[0038] Genetic materials involved in the present application

[0039] KY131 is a japonica rice variety introduced from Japan, which has the characteristics of early maturity, cold resistance, lodging resistance, more tillers, and high yield. KO-PCF3 is a PCF3 site knockout material constructed by using KY131 as the receptor and adopting the method of Agrobacterium infection.

[0040] ZH11 is a japonica conventional rice bred by the Crop Science Institute of Chinese Academy of Agricultural Sciences. OX-PCF3 is a PCF3 site overexpression material constructed by using ZH11 as the receptor and adopting the method of Agrobacterium infection.

[0041] Construction of OX-PCF3 overexpression material: the CDS full length of PCF3 gene is amplified by PCR method with ZH11 cDNA as template (the amplification primer sequence used is: OX-PCF3-F: TACGAATTCGAGCTCGGTACCATGATTAAAGATCTAAGAAC, as shown in SEQ ID NO. 3; OX-PCF3-R: ACGACGGCCAGTGCCAAGCTTCCATAAAAGTCGCGGAAAAT, as shown in SEQ ID NO. 4), and then subcloned into the overexpression vector PU2301-flag. The recombinant plasmid is transformed into the receptor variety ZH11 by the method of Agrobacterium-mediated genetic transformation, and finally the overexpression plant of PCF3 gene (OX-PCF3) is obtained through the corresponding molecular detection.

[0042] Construction of KO-PCF3 knockout material: the target site is designed in the third exon (base 51-70) of PCF3 gene. The recombinant plasmid is transformed into the receptor variety Kongyu 131 by the method of Agrobacterium-mediated genetic transformation, and finally the knockout plant of PCF3 gene (KO-PCF3) is obtained through the corresponding molecular detection.

[0043] The genetic material used in the present application for whole genome association analysis includes a natural population of 533 cultivated rice varieties, wherein the 533 cultivated rice varieties include 50 aus varieties, 305 indica rice varieties and 178 japonica rice varieties. The genotype data of population structure and whole genome LD analysis is from 1 million randomly selected SNPs present in all varieties in the whole genome, and the present application uses the Bayesian clustering software fastSTRUCTURE to calculate the population structure of 533 core germplasm materials with different K (1-10) values. Then the best K value is selected by using the python script K.py of the software. The visualization of population structure is realized by using the matching script distruct.py. The calculation of whole genome LD uses the PLINK software to calculate the point pair r 2 . The simple linear model and the mixed linear model are analyzed by using the software FaST-LMM, and the R package used in the multi-site mixed linear model (MLMM) is from Segura. The significance threshold in the association analysis is based on the Bonferroni correction (ref), and the threshold values of indica rice subpopulation, japonica rice subpopulation and total core germplasm population are set to 8.7x10 -8 , 2x10 -7 and 6.6x10 -8 , respectively. The confirmation of target segment candidate genes is based on the Nipponbare reference genome (ref).

[0044] All materials were grown in the experimental fields of Huazhong Agricultural University in Wuhan or Lingshui, Hainan. The matured rice grains were air-dried and stored at room temperature for at least three months before use in the experiments.

[0045] Sample processing

[0046] a) Determination of grain protein content:

[0047] The protein content was determined using a FOSS XDS near-infrared rapid content analyzer. (2) Start the FOSS XDS Rapid Content Analyzer (Foss NIR Systems, Inc. Laurel, MD) and open the ISIscan software to warm up for half an hour. Then fill the static cup with the brown rice sample to be tested, making sure that there is no light transmission when viewed from the bottom of the cup. If there is light transmission, it indicates that the brown rice in the cup is not mixed evenly and needs to be manually shaken horizontally. (3) Select the created brown rice protein content near-infrared determination model 203ok to analyze the protein content of the sample. Each sample is measured at least twice to ensure that the instrument is not affected by the external environment and the data is stable. In addition, each sample contains at least 10 biological replicates.

[0048] b) Extraction and determination of four storage proteins:

[0049] (1) Accurately weigh 0.1 g of milled rice powder on an analytical balance and place it in a 2 ml centrifuge tube. Add albumin extraction solution (10 mM Tris-HCl, pH 7.5) and shake well. Shake on a shaker at room temperature for 2 hours. Centrifuge at 12000 rpm for 15 minutes at 4°C. The supernatant is albumin. Repeat the extraction 3 times and mix the 3 supernatants to obtain the total albumin content. If you do not plan to measure it immediately, you can first store it in a -20°C refrigerator.

[0050] (2) Add globulin extraction solution (1 M NaCl) to the centrifuge tube containing only the precipitate in (1) and shake well. Shake on a shaker at room temperature for 2 hours. Centrifuge at 12000 rpm for 15 minutes at 4°C. The supernatant is globulin. Repeat the extraction 3 times and mix the 3 supernatants to obtain the total globulin content. If you do not plan to measure it immediately, you can first store it in a -20°C refrigerator.

[0051] (3) Add prolamin extraction solution (60% n-propanol containing 1 mM EDTA-2Na) to the centrifuge tube containing only the precipitate in (2) and shake well. Shake on a shaker at room temperature for 2 hours. Centrifuge at 12000 rpm for 15 minutes at 4°C. The supernatant is prolamin. Repeat the extraction 3 times and mix the 3 supernatants to obtain the total prolamin content. If you do not plan to measure it immediately, you can first store it in a -20°C refrigerator.

[0052] (4) In the centrifuge tube left with the precipitate in (3), add gluten extraction solution (0.05M NaOH), shake well, and shake on a shaker at room temperature for 2h. Centrifuge at 4°C, 12000rpm for 15min. Absorb the supernatant as the gluten. Repeat the extraction for 3 times, and mix the 3 supernatants to obtain the total content of the gluten. If not to be determined immediately, the mixture can be stored in a refrigerator at -20°C.

[0053] (5) The content of the four kinds of storage proteins is determined by Coomassie brilliant blue method (G-250), using bovine serum albumin as the standard, and a suitable standard curve is prepared to make the content of the four kinds of storage proteins fall within the range of the standard curve. The OD value of each sample is determined by TECAN Infinite M200 multifunctional enzyme labeler.

[0054] c) Determination of amylose content:

[0055] The determination of the amylose content of milled rice powder is based on the national standard NY / T2639-2014 with simple adjustments, and the specific steps are as follows: first, add 10±0.5mg of milled rice powder, 0.1ml of 95% ethanol and 0.9ml of 1M sodium hydroxide into a dry 15ml glass tube in turn, mix well, and then screw on the lid. After boiling in a water bath for 10min and cooling to room temperature, dilute with 9ml of single distilled water. Then, add 0.5ml of the diluted solution into a new 15ml glass tube, add 9.25ml of single distilled water, 0.2ml of 1M acetic acid and 0.15ml of 0.2% iodine-potassium iodide solution in turn, screw on the lid, invert well and mix thoroughly, and then stand for 20min. Finally, add 0.2ml of the above mixture and the same treated mixture of four standard samples of amylose content (0.4%, 10.6%, 16.2% and 26.5%) into a transparent ELISA plate, and determine the absorbance at 620nm wavelength by Tecan Infinite M200 multifunctional enzyme labeler. According to the linear equation of the absorbance of the standard samples and the amylose content, the amylose content of each sample is calculated. Each single sample is measured 3 times, and the average value is the final amylose content.

[0056] d) Determination of total starch content:

[0057] Firstly, 2.5 g of sample (accurate to 0.1 mg) is taken in a 100 mL volumetric flask, 25 mL of 1.128% hydrochloric acid solution is added, shaken, and then 25 mL of 1.128% hydrochloric acid solution is added. After shaking thoroughly, the volumetric flask is immersed in a boiling water bath for hydrolysis, and the first 3 minutes should be shaken constantly to prevent clumping. After 15 minutes of hydrolysis, the volumetric flask is removed, 30 mL of cold water is added, and it is immediately cooled to 20°C. 5 mL of zinc acetate solution is added, shaken for 1 minute, 5 mL of potassium ferrocyanide solution is added, shaken for 1 minute, and then diluted to the mark with water, mixed thoroughly and filtered. If the filtrate is not clear, a suitable amount of zinc acetate solution and potassium ferrocyanide solution can be added before testing to clarify the solution. The filtrate is poured into a 20 cm polarimeter tube, and the total optical rotation (P) is measured with a polarimeter. Total starch content = 2000 / 185.9 * 2.5 α1 / m1 (185.9 - pure starch specific rotation of rice flour at 589.3 nm; α1 - total optical rotation; m1 - total optical rotation corresponding to the mass of the rice flour.

[0058] e) Determination of gel consistency:

[0059] (1) The milled rice sample is ground into milled rice flour using a spherical grinding instrument, and sieved through a 200 mesh sieve;

[0060] (2) In a special test tube, 0.1 g of rice flour is added, followed by 0.2 ml of 0.025% thymol blue solution and the test tube is shaken gently to disperse the rice flour evenly;

[0061] (3) Then add 2 ml of 0.2 mol / l KOH solution and mix well in a vortex;

[0062] (4) Then quickly place the test tube in a boiling water bath (preferably use a large electric rice cooker, as the water bath kettle has poor insulation effect), place a glass bead on the test tube opening, and gelatinize in the boiling water bath for 8 minutes (pay special attention, the height of the gel in the test tube should not exceed 2 / 3 of the total length of the test tube, otherwise it is easy to overflow, during this process, it is best to use a hair dryer to blow the test tube opening intermittently, do not let the gel in the test tube overflow, the sample that has overflowed needs to be re-measured);

[0063] (5) After gelatinization, the test tube is first placed at room temperature for 5 minutes, then in an ice bath for 20 minutes, and then placed horizontally on the experimental bench for 1 hour at room temperature;

[0064] (6) Measure the length of the gel in each test tube with a ruler (i.e. the gel consistency), or place the test tube on a table covered with coordinate paper to measure, and record the gel consistency of each sample.

[0065] f) Determination of taste value:

[0066] Accurately take 30.00 g of milled rice for standby, and try to remove the broken rice. Put the prepared milled rice into a steel tank, soak for 30 min, and wash for 30 s. Add water according to the corresponding rice-water ratio (the indica rice-water ratio is 1:1.4, and the japonica rice-water ratio is 1:1.35, mass ratio), and cover with filter paper. Seal with a rubber ring, and soak for 30 min from the start of washing. When adding water, weigh, 30+30*rice-water ratio+tank weight. Then, together with the filter paper, place in an electric rice cooker (milled rice taste instrument set), and heat for 10 min. Take out the steel tank, gently stir the milled rice in it to a fluffy state, cover with filter paper, and place in a matching air cooling device to cool for 20 min. After air cooling, remove the filter paper, replace with a matching steel cover, and seal for natural cooling for 90 min. Repeat the sample three times, take 8.00 g (7.00 g for indica rice) of milled rice to prepare a sample, and press the cakes for 20 s each. Use the STA1B type milled rice taste meter (STA1B, SATAKE CO., Ltd, Japan) produced by Japan Satake Company to measure the taste value of the sample milled rice. Directly read the taste value, and the total score of the taste value is 100 points. Generally, the higher the taste value score, the better the taste quality.

[0067] Analysis of experimental results of the present application

[0068] Discovery and identification of PCF3 gene

[0069] Using the ChIP-seq sequencing data of Ghd7 protein, a potential downstream target gene PCF3 was found, and was verified by EMSA and ChIP-qPCR Figure 1 . At the same time, PCF3 is also one of the candidate genes obtained by whole genome association analysis of the glutelin content of 533 core germplasms Figure 2 and Table 1), therefore, PCF3 gene is extremely likely to be a gene affecting rice quality.

[0070] Table 1 is the candidate gene obtained by whole genome association analysis of the glutelin content of 533 core germplasms

[0071]

[0072]

[0073] Effect of PCF3 gene on rice quality and agronomic traits of rice

[0074] In order to further clarify whether PCF3 regulates grain quality, the present application generates PCF3 knockout mutant (KO-PCF3) in KY131 background by CRISPR / Cas9 gene editing technology Figure 3 a,b). Compared with wild type KY131, the glutelin content, globulin content and protein content of KO-PCF3 are significantly increased Figure 3e, f). Correspondingly, transmission electron microscopy observations showed that the average cross-sectional areas of PBI and PBII in the endosperm of KO-PCF3 during development were significantly larger than those of KY131. Figure 3 g,h). Furthermore, this invention genetically transforms a vector containing the proUbi:PCF3 expression cassette into a ZH11 background, generating PCF3 overexpressing plants (OX-PCF3). Figure 3 (c, d). Apart from minor differences in gluten and globulin content, no significant changes were observed in other tested traits (Figures e, f). Appearance quality analysis showed that the chalkiness rate and chalkiness area of ​​KO-PCF3 kernels were significantly lower than those of KY131, while there was no significant difference between OX-PCF3 and ZH11. Figure 3 Subsequent analysis showed no significant changes in amylose and total starch content between KO-PCF3 and KY131. Figure 3 However, the gel consistency and flavor value decreased (k). Figure 3 k).

[0075] Conversely, compared to ZH11, OX-PCF3 has a lower content of cereal amylose, while its total starch, gel consistency, and flavor value are all increased. Figure 3 k). This invention further investigated the main agronomic traits of these transgenic materials (k). Figure 4 Compared with the control KY131, KO-PCF3 showed a decrease in plant height, seed setting rate, and thousand-grain weight of 3.1 cm, 15.3%, and 6.0 g, respectively, while the number of panicles per plant, the number of effective panicles per plant, and the panicle length increased by 7.2, 6.8, and 2.0 cm, respectively. However, there were no significant changes in heading date, number of grains per panicle, or yield per plant. Compared with the control ZH11, OX-PCF3 showed an increase in the number of grains per panicle, seed setting rate, thousand-grain weight, and yield per plant of 1.45, 22.9%, 8.0 g, and 8.0 g, respectively. However, there were no significant differences in plant height, heading date, number of panicles per plant, number of effective panicles per plant, or panicle length. These results indicate that increased PCF3 expression can simultaneously improve the eating quality and yield of rice.

[0076] The above experimental results indicate that PCF3 is an important gene affecting grain protein content and yield. Increased expression of this gene or other factors leading to enhanced protein function can reduce the protein content in rice, while simultaneously improving the eating quality and increasing yield.

[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a gene PCF3 related to quality of plants of the family Gramineae, characterized in that, The application discloses a method for improving yield and / or eating quality of a monocotyledon plant, such as rice, by overexpressing PCF3, wherein the nucleotide sequence of PCF3 is shown as SEQ ID NO.

1.

2. The use of the gene PCF3 related to the quality of the grass family according to claim 1, characterized in that, The method for overexpressing PCF3 comprises the following steps: constructing the cloned PCF3 into a gene overexpression vector to obtain a recombinant vector; transforming the obtained recombinant vector into Agrobacterium; inoculating the Agrobacterium into rice to realize overexpression of the gene.

3. Use of a gene PCF3 related to quality of plants of the family Gramineae, characterized in that, The application discloses a method for improving the protein content in grains of a monocotyledon plant, such as rice, by inhibiting the expression of PCF3, wherein the nucleotide sequence of PCF3 is shown as SEQ ID NO.

1.

4. Use of the gene PCF3 associated with quality of the plant of the family Gramineae according to claim 3, characterized in that, The method for inhibiting the expression of PCF3 is to mutate PCF3.

Citation Information

Patent Citations

  • Clone of rice WRKY gene relative to drought resistance and application thereof

    CN101130785A

  • Application of OsNPF8.8b gene for increasing yield and improving nutritional quality of paddy rice

    CN108034661A