TaTCP15 gene for regulating nitrogen utilization in wheat and biological materials and application thereof

Abstract

The application discloses a TaTCP15 gene for regulating nitrogen utilization of wheat as well as a biological material and application thereof, and identifies an upstream regulatory factor of a key gene TaNRT2.1 for regulating nitrogen utilization of wheat through a research strategy combining forward and reverse genetics, and screens and clones a TaTCP15 gene for regulating nitrogen utilization of wheat. It is shown by function prediction and identification results that the TaTCP15 gene is expressed in roots, stems and young panicles at high abundance, and after overexpression of the TaTCP15 gene in Arabidopsis and wheat, the plant height is significantly dwarfed, the ear length is shortened, the yield per plant is reduced, the thousand-grain weight is reduced, the grain length and width are reduced, the grains are round, the tillering is reduced, the heading stage is lengthened, the growth period is lengthened, and the leaf is greener. The application accumulates new data and information for in-depth research on a molecular regulation mechanism of nitrogen utilization of wheat.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a TaTCP15 gene that regulates nitrogen utilization in wheat and its related biomaterials and applications. Background Technology

[0002] Nitrogen fertilizer is a crucial fertilizer in agricultural production. It enhances soil fertility, providing the necessary nutrients for plants throughout their growth stages, ensuring healthy crop growth and high, stable yields. However, improper application of nitrogen fertilizer can lead to a series of agricultural problems. For example, excessive residual nitrogen in the soil can cause soil compaction, preventing crops from fully utilizing nitrogen and resulting in economic losses for farmers. Furthermore, it can cause environmental problems. Excessive nitrogen fertilizer can seep into the ground with rainwater or irrigation, polluting groundwater or flowing into rivers and ditches, causing eutrophication and impacting the ecological environment. Therefore, improving the efficiency of nitrogen utilization by crops, and ensuring high yields without increasing fertilizer application or even reducing it, is of paramount importance.

[0003] Wheat (Triticum aestivum L.) is one of the three major food crops worldwide and also the most important food crop in my country. Stable wheat production is of great significance for increasing farmers' income and ensuring my country's food security. Nitrogen use efficiency (NUE) in wheat is a complex quantitative trait, influenced by transport proteins, kinases, transcription factors (TFs), and microRNAs (miRNAs) involved in nitrogen uptake, as well as key enzymes related to nitrogen assimilation, circadian rhythm regulators, and carbon metabolism. However, the discovery and functional identification of these key genes related to NUE in wheat are still insufficient. Given this reality, conducting cloning and genetic network analysis of wheat nitrogen use-related genes will not only provide important theoretical basis and excellent gene resources for genetic improvement but also further enhance the level and influence of basic wheat research in my country. Summary of the Invention

[0004] To address the aforementioned technical problems, the purpose of this invention is to provide a TaTCP15 gene that regulates nitrogen utilization in wheat, along with related biomaterials and applications.

[0005] Firstly, one object of the present invention is to provide a DNA molecule for regulating nitrogen utilization in plants, wherein the DNA molecule provided by the present invention is as follows: 1) or 2) or 3):

[0006] 1) A DNA molecule with a nucleotide sequence as shown in SEQ ID No. 1;

[0007] 2) cDNA molecules or genomic DNA molecules that have 75% or more identity with the nucleotide sequence defined in 1);

[0008] 3) cDNA or genomic DNA molecules that hybridize to the nucleotide sequence defined in 1) or 2) under strict conditions.

[0009] Another object of the present invention is to provide a biological material related to the above-mentioned DNA molecule, said biological material being any one of the following A1) to A15):

[0010] A1) An expression cassette containing the aforementioned DNA molecules;

[0011] A2) Recombinant vectors containing the above-mentioned DNA molecules;

[0012] A3) Recombinant microorganisms containing the above-mentioned DNA molecules;

[0013] A4) Transgenic plant cell lines containing the above-mentioned DNA molecules;

[0014] A5) Transgenic plant tissues containing the aforementioned DNA molecules;

[0015] A6) Transgenic plant organs containing the above-mentioned DNA molecules;

[0016] A7) A recombinant vector containing the expression cassette described in A1);

[0017] A8) Recombinant microorganisms containing the expression cassette described in A1);

[0018] A9) Transgenic plant cell lines containing the expression cassette described in A1);

[0019] A10) Transgenic plant tissue containing the expression cassette described in A1);

[0020] A11) Transgenic plant organs containing the expression cassette described in A1);

[0021] A12) Recombinant microorganisms containing the recombinant vector described in A2);

[0022] A13) Transgenic plant cell lines containing the recombinant vector described in A2);

[0023] A14) Transgenic plant tissue containing the recombinant vector described in A2);

[0024] A15) Transgenic plant organs containing the recombinant vector described in A2).

[0025] Furthermore, this invention provides applications of the aforementioned DNA molecules or related biological materials. Specifically, it applies to the regulation of nitrogen utilization in wheat.

[0026] Furthermore, this invention provides the application of the aforementioned DNA molecules or biological materials in the cultivation of new plant varieties.

[0027] In the above applications, the plant traits of the new plant varieties are significantly shorter plant height, shorter ear length, lower yield per plant, lower thousand-grain weight, smaller grain length and width, rounder grains, reduced tillering, longer heading period, longer growth period, and greener leaves.

[0028] Among the aforementioned biological materials, recombinant vectors containing the TaTCP15 gene, expression cassettes containing the TaTCP15 gene, or recombinant bacteria containing the TaTCP15 gene are all within the scope of protection of this invention. This invention can construct recombinant expression vectors containing the TaTCP15 gene using existing plant expression vectors.

[0029] When constructing recombinant expression vectors, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before the transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, enhancers, including translational enhancers or transcriptional enhancers, can be used when constructing recombinant expression vectors. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plants, the expression vectors used can be processed, such as by adding genes that express enzymes or luminescent compounds that produce color changes in plants, antibiotic resistance markers, or chemical reagent resistance marker genes. From a transgenic safety perspective, no selective marker genes can be added, and transformed plants can be screened directly based on phenotype.

[0030] The plant expression vector may specifically be vector 110.2.

[0031] The recombinant vector containing the TaTCP15 gene can be the recombinant plasmid 110.2-TaTCP15 obtained by inserting the double-stranded DNA molecule shown in SEQ ID No. 3 into the BamHI restriction site of vector 110.2.

[0032] This invention also provides the application of TaTCP15 protein in regulating nitrogen utilization in wheat.

[0033] Furthermore, the present invention also provides applications of the TaTCP15 gene, recombinant vectors containing the TaTCP15 gene, or expression cassettes containing the TaTCP15 gene, as follows (b1):

[0034] (b1) Breed transgenic plants with increased nitrogen use efficiency.

[0035] This invention also provides the application of the aforementioned DNA molecules or related biological materials in the cultivation of new plant varieties. The plant varieties described herein exhibit the following plant traits: significantly shorter plant height, shorter ear length, lower yield per plant, lower thousand-grain weight, smaller grain length and width, and rounder grains. They are also used in plants with reduced tillering, longer heading period, longer growth period, and greener leaves.

[0036] This invention also provides a method for cultivating transgenic plants, comprising the following steps: introducing the TaTCP15 gene into a recipient plant to obtain a transgenic plant with increased nitrogen use efficiency. Specifically, the TaTCP15 gene is introduced into the recipient plant by introducing the recombinant plasmid 110.2-TaTCP15.

[0037] The transgenic plant has at least one of the following properties (1)-10):

[0038] 1) The height of the transgenic plant is smaller than that of the recipient plant;

[0039] 2) The spike length of the transgenic plant is shorter than that of the recipient plant;

[0040] 3) The yield per plant of the transgenic plant is less than that of the recipient plant;

[0041] 4) The thousand-grain weight of the transgenic plant is less than that of the recipient plant;

[0042] 5) The transgenic plant has a grain length and width smaller than that of the recipient plant.

[0043] 6) The seeds of the transgenic plant are rounder than those of the recipient plant;

[0044] 7) The transgenic plant has fewer tillers than the recipient plant;

[0045] 8) The heading period of the transgenic plant is longer than that of the recipient plant;

[0046] 9) The growth period of the transgenic plant is longer than that of the recipient plant;

[0047] 10) The leaves of the transgenic plant are greener than those of the recipient plant.

[0048] Any of the recipient plants mentioned above are monocotyledonous or dicotyledonous. Any of the recipient plants mentioned above are members of the Poaceae family. Any of the recipient plants mentioned above are members of the Triticum genus. Any of the recipient plants mentioned above are hexaploid wheat. Any of the recipient plants mentioned above are wheat Fielder.

[0049] Any of the above-mentioned target plants are monocotyledonous or dicotyledonous. Any of the above-mentioned target plants are members of the Poaceae family. Any of the above-mentioned target plants are members of the Triticum genus. Any of the above-mentioned target plants are hexaploid wheat. Any of the above-mentioned target plants are *Triticum aestivum* (Fielder wheat).

[0050] The beneficial effects of this invention are:

[0051] This invention employs a research strategy combining forward and reverse genetics to identify upstream regulators of the key wheat nitrogen use gene TaNRT2.1, and screened and cloned a TaTCP15 gene that regulates wheat nitrogen use. Functional prediction and identification results show that the TaTCP15 gene is highly expressed in the root system, main stem, and young spikelets. Overexpression of the TaTCP15 gene in wheat significantly reduces plant height, spike length, yield per plant, thousand-grain weight, grain length and width, and grain rounding. It also reduces tillering, prolongs the heading period and growth period, and greens the leaves, providing new data and information for further research into the molecular regulatory mechanism of wheat nitrogen use. Attached Figure Description

[0052] Figure 1 This demonstrates that TaTCP15 gene expression is tissue-specific.

[0053] Figure 2 Electrophoresis diagram of transgenic T0 generation plants for PCR identification.

[0054] Figure 3 Phenotypic comparison of TaTCP15 overexpression lines with wheat Fielder and empty vector-transformed OE-TID lines.

[0055] Figure 4 The phenotypic statistics of TaTCP15 overexpression lines. Detailed Implementation

[0056] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. Unless otherwise specified, the quantitative experiments in the following examples were all performed in triplicate, and the results were averaged.

[0057] Fielder wheat is a common hexaploid wheat, vector 110.2

[0058] Example 1

[0059] I. Discovery of the TaTCP15 gene

[0060] TaNRT2.1 is a typical nitrate-induced gene that encodes one of the most important high-affinity nitrate transporters in Arabidopsis thaliana. In nitrogen- or ammonia-deficient Arabidopsis cultures, nitrate rapidly and strongly induces TaNRT2.1 expression. Upstream regulators of the key gene TaNRT2.1 were identified using a yeast single-hybrid screening method in wheat, and TaTCP15 was identified as a candidate gene. The TaTCP15 gene is located on wheat chromosome 6B. The TaTCP15 gene (open reading frame) in the wheat Fielder cDNA is shown in SEQ ID No. 1.

[0061] SEQ ID No. 1:

[0062] ATGGACATCGCCGGAGACGCCGGAGGCGGCCGTCGGCCCAACTTCCCCTTGCAGCTCCTCGAGAAGAA

[0063] GGAGGAGCAACCGTGCTCCAGCTCGGCTGCGGGGGGCACCTCGGCGGGCGGCGGGAATGGAGCAGCCCCTGGCG

[0064] GTGCCGCCGGAGGGGAGATGCAGGTGCGGAAGGCGGTGCCCAAGCGGACATCGACGAAGGACCGGCACACCAAG

[0065] GTGGAGGGCCGGGGACGGCGCATCCGGATGCCTGCGCTGTGCGCGGCGAGGGTGTTCCAGCTGACCCGGGAGCT

[0066] GGGGCACAAGACGGACGGCGAGACCATCGAGTGGCTGCTGCAGCAGGCGGAGCCGGCGGTGATCGCGGCCACCG

[0067] GCACTGGCACCATCCCGGCCAACTTCACCTCCCTCAACATCTCCCTCCGCTCATCTGGCTCCTCGCTCTCCATC

[0068] CCGGCCCACCTCCGCGGGGCCTTGCCAAGCCCCGGCGTAAGGTTCGGCTCCCGTGCCGACGCGTGGGACCGGGT

[0069] TGTGGGACTCGGGTACCCGCCTGAAGGCCCCGCCTCGTCTTCGTCCACTCCGTCGCCGCTGTTGCTCAACTTCC

[0070] ACTCGGGCAGCGTCGGTCTTGACGTGCAGCCCTCGGCGTCAGCTGCTGCCGCTGCCGCAGCCGCTGACCTTTCG

[0071] AGGAAGCGGCGATGGGAGCAAGAAATGCAACAGCAGCAGCAACAACAACATCAGCAGCAGCAGCAACAGTACCA

[0072] GCAGCAGATGGCGGGGTACACGCAGAGCCAAATGCCGGGCACCGTCTGGATGGTGCCAAGCAACAACACGCAGA

[0073] GCGGCGGGGCGCCTTCCGGCGGTGGAAACGGCGGCGGTGGAGGAGGAAGTGGTGAGTCGATCTGGACTTTCCCG

[0074] CAAGTGGGCAGCGCCGGCGCCGCTGCTGCCGTGTATCGTGGGAGCGTGCCAAGCGGGCTACATTTCATGAACTT

[0075] CCCTGCACCGATGGCGCTGCTAACCGGGCAGCAGCTGGGGCTCGGCCCCGTGGGAGGCAGCGGTGGTGGCGGAG

[0076] GCGGAGGCGATGGGCAGATGGGGATCCTCGCCGCGCTGAACGCGTACCGGACACAGGCGGCGGAAGCAGCGGCG

[0077] GGCCAAGGAGGCGGTGGTGCAGGAGGATCGTCTAGCCAGCAGCAACACGGAGGTGGCGGCGGCGGCGGCGAGCG

[0078] GCATGAGAGCATGAGCACCAGCGAGTCGTAG

[0079] II. The expression of TaTCP15 gene is tissue-specific

[0080] The test materials were: roots, stems, lower nodes of the spike, leaves, awns, glumes, palea, stamens, pistils, and endosperm of wheat Fielder.

[0081] Total RNA was extracted from the test materials and reverse transcribed to obtain cDNA. Real-time quantitative PCR was performed using the cDNA as a template.

[0082] The primer pairs used to identify the TaTCP15 gene are as follows:

[0083] TaTCP15-abd-F1GAGGATCGTCTAGCCAGCAG

[0084] TaTCP15-abd-R1 GTGGAGGAAGGAAACCACAA′

[0085] The primer pairs used to identify the actin gene are as follows:

[0086] TaActin-L GACCGTATGAGCAAGGAGAT

[0087] TaActin-R CAATCGCTGGACCTGACTC.

[0088] The relative expression levels of the target gene TaTCP15 are shown in the figure. Figure 1 .pass Figure 1 It can be seen that the relative expression level of the gene TaTCP15 is highest in the root, followed by the stem and young spike, while the expression level in other parts is very low.

[0089] III. Construction of Recombinant Plasmids

[0090] The double-stranded DNA molecule shown in SEQ ID No. 2 was inserted into the BamHI restriction site of vector 110.2 to obtain recombinant plasmid 110.2-TaTCP15. Recombinant plasmid 110.2-TaTCP15 has been sequenced and verified.

[0091] SEQ ID No. 2:

[0092]

[0093] IV. Preparation of Transgenic Plants

[0094] 1. Recombinant plasmid 110.2-TaTCP15 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium.

[0095] 2. The recombinant Agrobacterium obtained in step 1 was used to infect the embryogenic callus of wheat Fielder, and then differentiation culture, rooting culture and herbicide resistance screening (screening concentration of 250 mg / L) were carried out in sequence to obtain 3 T0 generation regenerated plants.

[0096] 3. The three T0 generation regenerated plants obtained in step 2 were identified by PCR.

[0097] PCR identification method: Take plant leaves, extract genomic DNA, and perform PCR amplification using primer pair composed of OE-TCP15-F2 and OE-TCP15-R2. If the amplification product is obtained, the identification result is positive, and the plant is a transgenic plant.

[0098] OE-TCP15-F2: 5′-CAAGCGGGCTACATTTCATG-3′;

[0099] OE-TCP15-R2: 5′-CTGCTGATATTCTGCAATGC-3′.

[0100] Of the three T0 generation regenerated plants, one was a transgenic plant. Results are shown below. Figure 2 .pass Figure 2 It can be seen that the three T0 generation regenerated plants were identified by PCR. Among them, the identification result of line 1 was positive, and this line is a transgenic line.

[0101] 4. Produce offspring through self-fertilization.

[0102] Transgenic plants are self-pollinated to obtain seeds, which are called T1 generation seeds. Plants grown from T1 generation seeds are called T1 generation plants. T1 generation plants are self-pollinated to obtain seeds, which are called T2 generation seeds. Plants grown from T2 generation seeds are called T2 generation plants. The T1 and T2 generation plants are then identified by PCR (using the same method as step 3). For a given T1 generation plant, if both the plant and its self-pollinated T2 generation plants are PCR-positive transgenic plants, then the T1 generation plant and its offspring constitute a homozygous transgenic line.

[0103] Take the transgenic lines for identification in step six.

[0104] V. Preparation of plants with empty vectors

[0105] Replace the recombinant plasmid 110.2-TaTCP15 with vector 110.2 and follow the steps in step four to obtain the empty vector line OE-TID.

[0106] VI. Phenotypic Identification

[0107] Test materials: T2 generation seeds of OE strain, wheat Fielder seeds, and T2 generation seeds of empty vector OE-TID.

[0108] Phenotypic identification of TaTCP15 overexpression lines:

[0109] The test materials—T2 generation seeds of the OE strain, wheat Fielder seeds, and T2 generation seeds of the empty vector OE-TID—were planted in the field at the Shangzhuang Experimental Station.

[0110] Phenotypic identification was performed on T2 generation plants of the OE line, wheat Fielder plants, and T2 generation plants of the empty vector OE-TID. (See...) Figure 3 ,pass Figure 3 It can be seen that OE-TCP15 plants are significantly shorter in height and shorter in length.

[0111] In the field, OE-TCP15 exhibited significantly shorter plant height, shorter ear length, lower yield per plant, lower thousand-grain weight, smaller grain length and width, and rounder grains. Tillering decreased but was not significant (possibly due to insufficient statistical sample). The heading period and growth period were longer, and the leaves became greener. Statistical results are shown below. Figure 4 The results showed that overexpression of the TaTCP15 gene can regulate nitrogen use in wheat.

[0112] Of course, the above description is not intended to limit the present invention, and the present invention is not limited to the examples given above. Any changes, modifications, additions or substitutions made by those skilled in the art within the scope of the present invention should be protected by the present invention.

Claims

1. The application of overexpression of the TaTCP15 gene in the breeding of new wheat varieties, characterized in that, The nucleotide sequence of the TaTCP15 gene is shown in SEQ ID NO.1; the new variety has significantly shorter plant height, shorter ear length, lower yield per plant, lower thousand-grain weight, smaller grain length and width, and rounder grains; longer heading period, longer growth period, and greener leaves.

2. A method for cultivating transgenic plants, characterized in that, The method involves introducing the TaTCP15 gene described in claim 1 into a recipient plant to obtain a transgenic plant; The transgenic plant has at least one of the following properties: 1)-9): 1) The height of the transgenic plant is smaller than that of the recipient plant; 2) The spike length of the transgenic plant is shorter than that of the recipient plant; 3) The yield per transgenic plant is less than that of the recipient plant; 4) The thousand-grain weight of the transgenic plant is less than that of the recipient plant; 5) The transgenic plant has a grain length and width smaller than that of the recipient plant; 6) The seeds of the transgenic plant are rounder than those of the recipient plant; 7) The heading period of the transgenic plant is longer than that of the recipient plant; 8) The growth period of the transgenic plant is longer than that of the recipient plant; 9) The leaves of the transgenic plant are greener than those of the recipient plant; The plant in question is wheat.

Images