Lactic acid bacteria AUh01 for protecting female genital tract and its application

By developing the female reproductive tract protection lactic acid bacteria AUh01, the specific deficiency, lactobacillus inhibition and drug resistance of antibiotics in the prior art are solved, and the effect of effectively inhibiting pathogens and restoring vaginal microecology is achieved.

CN118667688BActive Publication Date: 2025-06-13INST OF AGRO FOOD SCI & TECH CHINESE ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410570072.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-09
Publication Date
2025-06-13
Estimated Expiration
2044-05-09

AI Technical Summary

Technical Problem

The prior art When treating gynecological diseases such as bacterial vaginosis, fungal vaginitis and pelvic inflammatory disease, broad-spectrum antibiotics lack specificity, inhibit Lactobacillus growth, and have problems with drug resistance, side effects and high recurrence rates.

Method used

A female reproductive tract protective lactic acid bacteria AUh01 was developed, which belongs to Pediococcus acidilactici. Through high-density fermentation and equalization stability process research, its commercial production was optimized, and antibacterial products and products for the treatment of vaginal infection were prepared.

Benefits of technology

AUh01, lactica tablets, can effectively inhibit pathogens in the vagina, reduce vaginal pH, and have an adhesion effect, promote its colonization in the vaginal environment, thereby maintaining and restoring the vaginal microecological environment and avoiding the side effects of antibiotics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004830573590000041
    Figure BDA0004830573590000041
  • Figure BDA0004830573590000042
    Figure BDA0004830573590000042
  • Figure BDA0004830573590000051
    Figure BDA0004830573590000051
Patent Text Reader

Abstract

The present invention provides a lactic acid bacterium AUh01 for protecting female reproductive tract and its application. The present invention provides a new Pediococcus acidilactici AUh01 derived from female reproductive tract, which can produce acid to reduce the vaginal pH value, thereby effectively inhibiting related pathogenic bacteria in the vagina, and has a certain adhesion effect on vaginal epithelial cells, which is beneficial to its colonization in the vaginal environment, so as to play the role of maintaining the vaginal microecological environment and probiotic effect. In addition, the strain AUh01 has certain acid and bile salt tolerance, and can be developed into oral or topical dosage forms, with broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and specifically, to a lactic acid bacterium AUh01 for protecting the female reproductive tract and its application. Background Art

[0002] The stability of the female reproductive tract microecosystem is closely related to the vaginal flora, endocrine regulation system, anatomical structure, and local immunity. Among them, the normal structure of the vaginal microbiota plays a crucial role in maintaining a healthy vaginal microenvironment. Changes in various endogenous and exogenous factors can cause microecological disorders, such as low hormone levels, poor hygiene conditions, unprotected sex, vaginal douching, hormonal contraception, and smoking, ultimately leading to gynecological diseases such as bacterial vaginosis (BV), vulvovaginal candidiasis (MV), and pelvic inflammatory disease, seriously affecting women's physical and mental health. In addition, recent studies have found that certain gynecological cancers are also related to dysbiosis. Therefore, restoring the normal physiological structure of the vaginal microbiota is the key to treating such diseases.

[0003] Lactic acid bacteria are a general term for a group of bacteria that can produce a large amount of lactic acid by utilizing fermentable sugars. Morphologically, they are mainly cocci and bacilli, and are all Gram-positive bacteria. These bacteria are widely distributed in nature and have high application value in fields closely related to humans such as the food industry, agriculture, and medicine. Lactic acid bacteria are an essential group of bacteria with important physiological functions in the human and animal bodies. Except for a few, the vast majority of them are non-toxic, harmless, and have no side effects, and play a role in maintaining the microecological balance of the body. Lactobacilli are the main bacteria colonized in the vaginas of the vast majority of women of childbearing age and play a key role in maintaining female vaginal health, which is also unique to human females. The abundance of lactobacilli in the vaginas of healthy women is usually above 70%.

[0004] Bacterial vaginosis (BV) is a common vaginal disease caused by changes in the flora and biochemical properties of secretions in the vaginal microecological environment. BV is the result of the combined action of multiple bacteria and is relatively lacking in clinical inflammatory responses.

[0005] At present, there are mainly two major strategies for the treatment of gynecological diseases such as bacterial vaginosis (BV), vulvovaginal candidiasis (VVC), and pelvic inflammatory disease: one is the use of antibiotics; the other is the use of probiotic-based microecological preparations. Although antibiotics are effective in controlling diseases, due to the lack of specificity of broad-spectrum antibiotics, they will inhibit the growth of lactobacilli while killing symbiotic bacteria, and have many side effects such as drug resistance, high recurrence rate after treatment, and clearance of endogenous non-target flora in normal sites. Therefore, it is necessary to find an alternative therapy to antibiotics to maintain the vaginal microecological balance and restore its function. In recent years, the microecological therapy mainly based on microecological preparations provides another suitable theoretical perspective for the prevention and treatment of reproductive tract infections.

[0006] Microecological preparations are also known as probiotics, probiotic agents, and probiotics. They are natural bioactive preparations without toxic side effects, drug resistance, and drug residues. They use the antagonistic and mutualistic symbiotic relationships between microorganisms and their metabolites to inhibit pathogenic microorganisms. According to the types of strains used, they can be divided into: single-strain microecological preparations, such as lactic acid bacteria, Bacillus spores, yeasts, and photosynthetic bacteria; compound microecological preparations include probiotics, prebiotics, and synbiotics.

[0007] As the composition and complex relationship of the vaginal microecosystem are further confirmed, it is clearly recognized that the imbalance of the reproductive tract flora is an important cause of gynecological infectious and inflammatory diseases, and restoring the homeostasis of the reproductive tract ecosystem is the key to the treatment of reproductive tract infectious diseases. Microecological preparations have the advantages of being non-toxic, harmless, and pollution-free. They can not only quickly build the vaginal microecological balance but also avoid side effects such as flora imbalance and superinfection caused by the abuse of antibiotics. They are a new era product for the prevention and treatment of female reproductive tract infectious diseases. Based on the existing clinical evidence, the use of microecological preparations to treat reproductive tract infections has positive significance. Therefore, it is imperative to develop more new and effective microecological preparations for practical applications. Summary of the Invention

[0008] The purpose of the present invention is to provide a lactobacillus AUh01 for protecting the female reproductive tract and its application.

[0009] In order to achieve the purpose of the present invention, lactobacilli were isolated and identified from the secretions of healthy women, the purified lactobacillus strains were evaluated for their in vitro functions, lactobacilli with probiotic potential were screened out, and high-density fermentation and uniform stabilization processes were studied for high-quality strains to provide guidance for the commercial production of the strains.

[0010] In a first aspect, the present invention provides a lactic acid bacterium AUh01 for protecting the female reproductive tract, which is classified and named as Pediococcus acidilactici. It has been deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with a postal code of 100101. The deposit number is CGMCC No. 30220, and the deposit date is April 1, 2024.

[0011] In a second aspect, the present invention provides a bacterial agent or biological product containing Pediococcus acidilactici AUh01.

[0012] In a third aspect, the present invention provides the application of Pediococcus acidilactici AUh01 in the preparation of an antibacterial product;

[0013] Among them, the bacteria to be inhibited include Gardnerella Vaginalis (GV).

[0014] In a fourth aspect, the present invention provides the application of Pediococcus acidilactici AUh01 in the preparation of a product for treating vaginal infections;

[0015] Among them, the vaginal infection is caused by Gardnerella Vaginalis.

[0016] In a fifth aspect, the present invention provides a preparation for treating vaginal infections, the active ingredient of which is Pediococcus acidilactici AUh01 or its bacterial agent.

[0017] Furthermore, the preparation is in an oral or topical dosage form.

[0018] In a sixth aspect, the present invention provides a fermentation method of Pediococcus acidilactici AUh01, preparing a seed solution of Pediococcus acidilactici AUh01, inoculating the seed solution into a fermentation medium at an inoculation amount of 2%-6% v / v, and performing fermentation under the conditions of 30°C - 38°C and a rotation speed of 60 - 100 rpm;

[0019] Among them, the preparation method of the fermentation medium is as follows: Dissolve 10.0 g of peptone, 5.0 g of yeast extract, 20.0 g of glucose, 2.0 g of sodium tripolyphosphate, 2.0 g of ammonium citrate, 5.0 g of sodium acetate, 0.1 g of magnesium sulfate, 2.0 g of potassium dihydrogen phosphate, 2.0 g of disodium hydrogen phosphate, 1.0 mL of Tween 80, and 0.5 g of beef broth in 1000 mL of deionized water, and obtain it after high-temperature sterilization; the initial pH of the fermentation medium is 6.2 - 7.0 (preferably pH 6.5).

[0020] Preferably, the inoculation amount of the seed solution is 5% v / v, and fermentation is carried out under the conditions of 30°C and a rotation speed of 90 rpm.

[0021] In a seventh aspect, the present invention provides a probiotic powder comprising Pediococcus acidilactici AUh01 and a freeze-drying protectant.

[0022] Among them, the freeze-drying protectant comprises skim milk and trehalose.

[0023] Preferably, the mass ratio of skim milk to trehalose in the freeze-drying protectant is (1 - 2):(2 - 1).

[0024] More preferably, the mass ratio of skim milk to trehalose in the freeze-drying protectant is 1:1.

[0025] In an eighth aspect, the present invention provides a method for preparing the probiotic powder, comprising the following steps:

[0026] (1) The fermentation broth obtained by the above method is centrifuged to collect the bacterial sludge;

[0027] (2) Prepare the freeze-drying protectant: Prepare a mixed solution of skim milk and trehalose with water, which is the freeze-drying protectant;

[0028] Among them, the concentration of skim milk is 10% - 15%, and the concentration of trehalose is 10% - 15%;

[0029] (3) Mix the bacterial sludge and the freeze-drying protectant according to the mass ratio of (0.8 - 1.2):(1.5 - 2.0), and then perform freeze-drying to obtain the product.

[0030] In a ninth aspect, the present invention provides the application of Pediococcus acidilactici AUh01 in acid production.

[0031] By means of the above technical solutions, the present invention has at least the following advantages and beneficial effects:

[0032] The present invention provides a new Pediococcus acidilactici AUh01 derived from the female genital tract, which can produce acid to lower the vaginal pH value, thereby effectively inhibiting related pathogenic bacteria in the vagina, and has a certain adhesion effect on vaginal epithelial cells, which is beneficial to its colonization in the vaginal environment, so as to play the role of maintaining the vaginal microecological environment and probiotic effect. In addition, the strain AUh01 has certain acid resistance and bile salt resistance, and can be developed into oral or topical dosage forms, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is the effect diagram of the antibiotic sensitivity determination of some strains in the preferred embodiment of the present invention; among them, the sensitivity effect of C37 to 8 antibiotics; 1. Ampicillin; 2. Piperacillin; 3. Amikacin; 4. Gentamicin; 5. Vancomycin; 6. Cefoperazone; 7. Minocycline; 8. Penicillin.

[0034] Figure 2Survival rate of 22 strains of genital tract acid-resistant bacteria cultured for 2 h at different pH values in the preferred embodiment of the present invention.

[0035] Figure 3 Survival rate of 22 strains of genital tract bacteria resistant to bile salts cultured for 3 h at different concentrations of bile salts in the preferred embodiment of the present invention.

[0036] Figure 4 Adhesion of some strains to HT-29 cells in the preferred embodiment of the present invention; among them, A is strain C9, B is strain C26, C is strain C15, and D is strain AUh01.

[0037] Figure 5 Results of the culture and fermentation test of some strains in the preferred embodiment of the present invention. Detailed implementation mode

[0038] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products. The main instrument equipment and reagents used in the following examples are shown in Table 1 and Table 2 respectively.

[0039] Table 1 Main instruments and equipment

[0040]

[0041] Table 2 Main test reagents

[0042]

[0043]

[0044] The culture media used in the following examples are as follows:

[0045] Both MRS and BHI culture media are purchased from Aoboxing Biotechnology Co., Ltd.

[0046] DMEM incomplete culture medium is purchased from Beijing Lvyuan Bode Biotechnology Co., Ltd.

[0047] HT-29 cell special culture medium is used for the routine culture of HT-29 cells; the incomplete culture medium of DMEM is composed of 80% DMEM culture medium and 20% fetal bovine serum, and is used for cell adhesion test.

[0048] The bacterial strains and cell lines used in the following examples: Gardnerella vaginalis is purchased from Qingdao Haibo Biotechnology Co., Ltd.; HT-29 cells are purchased from Beijing Lvyuan Bode Biotechnology Co., Ltd.

[0049] Example 1 Isolation and probiotic function evaluation of genital tract lactic acid bacteria

[0050] 1. Experimental Materials and Methods

[0051] 1.1 Isolation and Identification of Lactobacilli

[0052] 1.1.1 Sample Collection and Processing

[0053] Collect 30 vaginal secretion samples from healthy women at different physiological stages of the pre - pregnancy, pregnancy, childbirth, and postpartum periods using a cotton swab collection kit. After collection, the samples must be immediately placed in a sterile sampling tube containing 30% glycerol, numbered, and immediately placed in a refrigerated incubator (temperature below 4°C). Transfer the samples to a - 80°C freezer for storage within 8 hours. At the same time, record the personal health information of the donors. The sample collection is organized by Ausnutria Dairy Co., Ltd. through a third - party collection.

[0054] 1.1.2 Strain Isolation

[0055] Place the collected cotton swab aseptically into a test tube containing MRS liquid medium and incubate anaerobically at 37°C for 18 - 24 h. Streak - plate the bacterial liquid on MRS solid medium for 2 - 3 consecutive times, with each anaerobic incubation for 18 - 24 h, to complete the isolation and purification of the strain and store it.

[0056] 1.1.3 Strain Identification

[0057] Use 16rRNA molecular biology identification. Extract the genomic DNA of the strain. Use primers 338F (5’ - ACTCCTACGGGAGGCAGCAG - 3’) and 1492R (5’ - GGTTACCTTGTTACTT - 3’) to perform PCR amplification on the strain's genes. Send the amplification products to a sequencing company for sequencing. Compare the sequencing results (SEQ ID NO:1) in the GenBank database by BLAST, and determine the species information of the strain based on the sequence similarity. Screen out no less than 80 strains that can be used in food.

[0058] 1.2 Determination of the Ability to Inhibit Pathogenic Bacteria

[0059] Activate the lactobacilli preserved in 30% glycerol at - 20°C in the refrigerator. Inoculate the genital tract bacteria in MRS medium and incubate at 37°C for 24 h for three generations of activation. After three generations, centrifuge at 8000g for 15 min, discard the supernatant, and collect the corresponding strains. Wash the bacterial pellet 3 times with PBS buffer solution, and finally resuspend the bacterial pellet in PBS buffer solution to ensure that the viable cell count of the resuspended bacterial suspension reaches 2×10 9 CFU / mL. Similarly, after activating Gardnerella vaginalis in BHI liquid medium for three generations, centrifuge at 8000g for 15 min, collect the bacterial pellet of Gardnerella vaginalis after three generations of activation, wash the bacterial pellet 3 times, and resuspend the bacterial pellet in PBS buffer solution. Finally, obtain a concentration of 2×10 8Gardnerella vaginalis suspension of CFU / mL.

[0060] Adjust the 24-hour culture of Gardnerella vaginalis to 10 8 CFU / mL, and add 100 μL of Gardnerella vaginalis suspension to each well of a 96-well plate. At the same time, add 100 μL of the supernatant of the experimental genital tract bacteria collected to the 96-well plate, and use MRS as a blank control. Incubate the 96-well plate at 37 °C for 24 h. After 24 h of biofilm formation, carefully remove the planktonic cells by washing 3 times with PBS, add 100 μL of methanol to each well and fix for 30 minutes. After discarding the methanol, stain the biofilm with 0.1% crystal violet for 5 minutes. Discard the crystal violet, wash 3 times with PBS, and add 200 μL of 33% glacial acetic acid to each well. Measure the absorbance of each well at 590 nm using a microplate reader.

[0061] 1.3 Determination of acid production ability of lactic acid bacteria

[0062] The production of acid by lactic acid bacteria is an important reason for inhibiting the growth of other pathogenic bacteria. The present invention evaluates the acid production ability of the screened lactic acid bacteria isolates. Take 1×10 6 CFU / mL of lactic acid bacteria, inoculate 1 mL into 50 mL of MRS medium and culture for 48 hours, then measure the pH value of the fermentation broth. Screen the strains with a fermentation broth pH ≤ 4.

[0063] 1.4 Determination of antibiotic sensitivity of lactic acid bacteria

[0064] Evaluate the sensitivity of the screened lactic acid bacteria to antibiotics such as enrofloxacin, penicillin, ampicillin, cephalosporins, ciprofloxacin, vancomycin, gentamicin, etc. Use a vortex mixer to mix the experimental bacterial solution, take 100 μL of the bacterial solution and spread it on the MRS solid medium. After the bacterial solution is completely absorbed by the medium, place the drug sensitivity test paper on the medium. After standing for 15 min, invert it and place it in an incubator at 37 °C for 20 h, measure and record the diameter of the inhibition zone of each drug sensitivity test paper. Make a judgment according to the paper disk method standard provided by the "CLSI Antimicrobial Susceptibility Testing Performance Standards" (2018).

[0065] 1.5 Determination of acid and bile salt tolerance of lactic acid bacteria

[0066] 1.5.1 Acid tolerance test

[0067] Adjust the pH value of the MRS liquid medium to 2.0, 2.5, 3.0 respectively with 0.1 mol / L HCl; sterilize at 121 °C for 20 min. Cool, inoculate the strain under sterile conditions, so that the initial viable bacteria count in the medium remains at 1×10 8 CFU / mL, incubate at a constant temperature of 37 °C, and take samples at 0 h and 2 h of culture to count the viable bacteria.

[0068] 1.5.2 Bile salt tolerance test

[0069] Use bovine bile salt to adjust the mass fraction of bile salt in MRS liquid medium to 0.1%, 0.3%, 0.5% respectively, and sterilize at 121 °C for 20 min. Inoculate the strain under sterile conditions so that the initial viable cell count in the medium remains at 1×10 8 CFU / mL, incubate at a constant temperature of 37 °C, and take samples after 3 h of incubation to count the viable cell count.

[0070] 1.6 Determination of the adhesion ability of lactic acid bacteria to HT-29 cells

[0071] 1.6.1 Preparation before cell experiment

[0072] Before conducting cell-related experiments, the reagents, consumables, etc. used need to be moved into the cell room in advance. The cell room needs to be sterilized by ultraviolet light for more than 30 min. The outer packaging of the reagents used is sprayed with 75% ethanol once before being moved into the laminar flow hood. Instruments and equipment such as the laminar flow hood and pipette gun need to be wiped several times with alcohol cotton before use.

[0073] 1.6.2 HT-29 cell culture

[0074] HT-29 cells are stored in liquid nitrogen (-180 °C) with cell cryoprotectant. During the experiment, after the cells are resuscitated, they are placed in a culture flask, and the special medium for HT-29 cells is added. Incubate in an incubator with 5% carbon dioxide at 37 °C. When the cells grow well (70% confluence), digest and passage them with 0.25% trypsin-EDTA. The cells grow adherently. Usually, the culture medium is changed every 2 days, and passage is carried out every 4 days. Adhesion experiments are carried out after about 5 passages. 2 The cells grow adherently. Usually, the culture medium is changed every 2 days, and passage is carried out every 4 days. Adhesion experiments are carried out after about 5 passages.

[0075] 1.6.3 Preparation of lactic acid bacteria suspension

[0076] Inoculate the activated lactic acid bacteria into MRS liquid medium at an inoculation amount of 1% (v / v), culture at 37 °C for 24 h, centrifuge to collect the bacterial cells (8000 g, 4 °C, 10 min), and then wash them three times with sterile PBS (Phosphate Buffered Saline, pH 7.3). Resuspend the bacterial cells in PBS and adjust the concentration of the bacterial suspension to 1×10 8 CFU / mL.

[0077] 1.6.4 Adhesion experiment

[0078] After pre-placing sterile cover glasses in a six-well culture plate, inoculate HT-29 cells at a concentration of 2×10 4 cells / mL, and let the cells adhere to the cover glass and grow. Place the culture plate at a temperature of 37 °C, CO 2In an incubator with a content of 5%. After the HT-29 cells grew into a confluent monolayer, the cells were rinsed 2 times with PBS buffer. 1 mL of DMEM culture medium without antibiotics and 1 mL of the above-prepared lactic acid bacteria suspension were added to each well, gently shaken, and placed in a CO 2 incubator for continued incubation, with 3 wells repeated for each strain. After culturing for 120 min, the HT-29 cells were washed 5 times with PBS buffer to remove the non-adherent lactic acid bacteria, then fixed with 0.4% paraformaldehyde for 20 min, and then the HT-29 cells were Gram-stained. After natural drying, 20 fields of view were randomly selected and photographed under a microscope, and the number of strains adhered to 100 HT-29 cells was calculated, and the adhesion ability was expressed as the number of strains adhered to each HT-29 cell on average.

[0079] 1.7 Determination of D-lactic acid production ability

[0080] The key gene for D-lactic acid production by lactic acid bacteria, D-lactic acid dehydrogenase (d-ldh), was detected by PCR method. The PCR primer information is as follows:

[0081]

[0082] 1.8 Detection of biogenic amine production ability

[0083] The two key genes for biogenic amine production by lactic acid bacteria (histidine decarboxylase (hdc), tyrosine decarboxylase (tdc)) were detected by PCR method. The PCR primer information is as follows:

[0084]

[0085] 1.9 Optimization of high-density fermentation conditions

[0086] The high-density fermentation conditions of the 10 strains of bacteria with good probiotic functions screened in the above experiments were optimized. The viable cell counts were investigated under different inoculation amounts, culture temperatures, initial pH values, and rotation speeds through single-factor experiments, and the optimal fermentation conditions for each strain were screened.

[0087] 1.10 Bacterial powder preparation process

[0088] The survival rate of the freeze-dried bacteria is affected by many factors, and the protective medium is an important influencing factor. A good protective agent is required to provide protection for the bacteria during the freeze-drying process, reduce the mortality rate of the bacteria. At the same time, it has good self-stability, is easy to mix evenly with the bacterial sludge, and can also conveniently and effectively remove the excess solvent in the freeze-dried material. The optimal protective agent formula screened in this experiment is a composite protective agent with a skim milk addition amount of 12% and a trehalose addition amount of 12%.

[0089] 1.11 Whole-genome sequencing of strains

[0090] Through the above series of evaluations, high-throughput sequencing of the whole genome was performed on strains with excellent performance and probiotic functions.

[0091] 2. Results and Analysis

[0092] 2.1 Isolation and Identification of Strains

[0093] In this experiment, 203 strains of lactic acid bacteria were isolated from 30 genital tract samples, including: 48 strains of Enterococcus faecalis, 3 strains of Lactobacillus vaginalis, 43 strains of Enterococcus faecium, 2 strains of Lactobacillus gasseri, 1 strain of Lactobacillus casei, 15 strains of Lactobacillus brevis, 1 strain of Streptococcus paris, 32 strains of Lactobacillus plantarum, 59 strains of Pediococcus acidilactici, and 1 strain of Enterococcus durans.

[0094] 2.2 Determination of the Inhibitory Ability of Lactic Acid Bacteria against Vaginal Pathogens

[0095] Among the 203 strains of lactic acid bacteria isolated from 30 genital tract samples, Enterococcus faecalis, Lactobacillus plantarum, and Pediococcus acidilactici showed significant inhibitory rates against Gardnerella vaginalis (Table 4).

[0096] Table 4 Partial Test Results of the Inhibitory Ability of Strains Isolated from the Genital Tract

[0097]

[0098] 2.3 Determination of the Acid Production Ability of Lactic Acid Bacteria

[0099] In this experiment, 203 strains of lactic acid bacteria were isolated from 30 genital tract samples. 1 mL of lactic acid bacteria at 1×10 6 CFU / mL was inoculated into 50 mL of MRS medium and cultured for 48 hours, and then the pH value of the fermentation broth was measured. The results showed that Lactobacillus plantarum and Pediococcus acidilactici had better acid production ability (Table 5).

[0100] Table 5 Partial Test Results of the Acid Production Ability of Lactic Acid Bacteria

[0101]

[0102] 2.4 Determination of the Antibiotic Sensitivity of Lactic Acid Bacteria

[0103] The antibiotic sensitivity of genital tract bacteria with an inhibitory rate ≥ 70% in the antibacterial test and a pH ≤ 4 in the acid production experiment was determined. As Figure 1 shown in Table 6, 22 isolated strains were highly sensitive to minocycline; among them, C1, C5, C15, and C27 were highly sensitive to penicillin; C1 and C5 were highly sensitive to piperacillin. C15 was moderately sensitive to piperacillin and ampicillin; C1, C2, and C10 were moderately sensitive to ampicillin. The remaining isolated strains were resistant to other antibiotics.

[0104] Table 6 Partial test results of the antibiotic sensitivity of lactic acid bacteria

[0105]

[0106]

[0107] Note: S. Highly sensitive; I. Moderately sensitive; R. Resistant.

[0108] 2.5 Determination of the acid and bile salt tolerance of lactic acid bacteria

[0109] 2.5.1 Acid tolerance test

[0110] Twenty-two isolates were cultured at pH = 2.5 for two hours, and the survival rate was greater than 50% ( Figure 2 ).

[0111] 2.5.2 Bile salt tolerance test

[0112] Twenty-two isolates were cultured at a bile salt concentration of 0.3% for 3 hours, and the survival rate was greater than 50% ( Figure 3 ).

[0113] 2.6 Detection of the ability to produce biogenic amines

[0114] The genomes of 22 lactic acid bacteria were extracted respectively, and the genes of histidine decarboxylase (hdc) and tyrosine decarboxylase (tdc) were detected by PCR method, and the results were all negative.

[0115] 2.7 Detection of the ability to produce D-lactic acid

[0116] The genomes of 22 lactic acid bacteria were extracted respectively, and the key gene D-lactic acid dehydrogenase gene d-ldh for producing D-lactic acid was detected by PCR method, and the gene was not detected in all results.

[0117] 2.8 Determination of the cell adhesion ability of strains

[0118] Based on the above tests, the cell adhesion ability of the bacteria with the best performance in the above tests was determined. The specific results and experimental effects are shown in Table 7, Figure 4 as shown. It can be seen from Table 7 that except for C24, C27, and C33, the other strains have strong adhesion ability to HT-29, and the number of adhered cells exceeds 8; among them, C6, C20, C26, and AUh01 have strong adhesion ability to HT-29.

[0119] Table 7 Partial adhesion numbers of genital tract lactic acid bacteria to HT-29 cells

[0120]

[0121]

[0122] Based on the above in vitro experimental results, 12 strains with good probiotic characteristics were screened out as follows: C1, C7, C9, C15, AUh01, C20, C26, C28, C34, C37, C23, C29.

[0123] 2.9 Results of strain culture and fermentation tests

[0124] The results of the culture and fermentation tests of some strains are shown in Figure 5 .

[0125] Colony count of C9: (25 + 41) / 2 × 10 9 = 3.3 × 10 10 CFU / ml

[0126] Colony count of AUh01: (23 + 27) / 2 × 10 9 = 2.5 × 10 10 CFU / ml

[0127] Colony count of C23: (35 + 38) / 2 × 10 9 = 3.6 × 10 10 CFU / ml

[0128] 2.10 Freeze-drying of strains

[0129] The strains were freeze-dried with a mass ratio of bacterial sludge to freeze-drying protectant of 1:1.8. After freeze-drying, the viable counts of the C9 and AUh01 bacterial powders were 4.6 × 10 11 CFU / g and 5.7 × 10 11 CFU / g, respectively.

[0130] The freeze-drying protectant is a mixed solution of skim milk and trehalose prepared with water, where the concentration of skim milk is 12% and the concentration of trehalose is 12%.

[0131] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection of the present invention.

Claims

1. Female reproductive tract protective lactic acid bacteria AUh01, characterized in that: The lactic acid bacteria AUh01 is Pediococcus acidilactici ( Pediococcus acidilactici ), and its deposit number is CGMCC No. 30220.

2. A biological product containing the bacteria according to claim 1.

3. Use of the bacteria according to claim 1 in the preparation of antibacterial drugs; in, The bacteria inhibited were Gardnerella vaginalis ( Gardnerella Vaginalis ).

4. Use of the bacteria according to claim 1 in the preparation of medicines for treating vaginal infections; in, Vaginal infections are caused by Gardnerella vaginalis.

5. A preparation for treating vaginal infection, characterized in that: The active ingredient is the bacteria or bacterial agent described in claim 1; The preparation is an external dosage form.

6. The fermentation method of the bacteria according to claim 1, characterized in that: Prepare a seed solution of the bacteria according to claim 1, inoculate the seed solution into a fermentation medium at an inoculum amount of 2%-6% v / v, and ferment at 30° C.-38° C. and a rotation speed of 60-100 rpm; The preparation method of the fermentation medium is as follows: 10.0 g of peptone, 5.0 g of yeast extract, 20.0 g of glucose, 2.0 g of sodium tripolyphosphate, 2.0 g of ammonium citrate, 5.0 g of sodium acetate, 0.1 g of magnesium sulfate, 2.0 g of potassium dihydrogen phosphate, 2.0 g of disodium hydrogen phosphate, 1.0 mL of Tween 80 and 0.5 g of beef broth are dissolved in 1000 mL of deionized water, and the mixture is sterilized at high temperature to obtain the obtained medium; the initial pH of the fermentation medium is 6.2-7.

0.

7. The method according to claim 6, characterized in that The initial pH of the fermentation medium was 6.

5.

8. The method according to claim 6 or 7, characterized in that: The inoculation amount of the seed solution was 5% v / v, and the fermentation was carried out at 30°C and 90 rpm.

9. Probiotic powder, characterized in that Comprising the bacteria according to claim 1 and a lyophilization protectant; Wherein, the freeze-drying protective agent comprises skim milk and trehalose.

10. The probiotic powder according to claim 9, characterized in that: The mass ratio of skim milk and trehalose in the freeze-drying protective agent is (1-2):(2-1).

11. The method for preparing the probiotic powder according to claim 9 or 10, characterized in that: The following steps are involved: (1) The fermentation liquid obtained by the method according to any one of claims 6 to 8 is centrifuged to collect bacterial sludge; (2) Preparation of lyophilization protective agent: Prepare a mixture of skim milk and trehalose with water to obtain the lyophilization protective agent; Among them, the concentration of skim milk is 10%-15%, and the concentration of trehalose is 10%-15%; (3) Mix the bacterial sludge and the freeze-drying protective agent in a mass ratio of (0.8-1.2):(1.5-2.0), and freeze-dry to obtain the product.

Citation Information

Patent Citations

  • Lactobacillus crispatus for preventing and treating female urogenital tract infection and application thereof

    CN111893057A

  • Plant lactobacillus and application thereof in prevention and treatment of female vaginitis

    CN117535172A