CsDOF1.8 gene and its application in increasing C9 aldehyde and corresponding alcohol aroma in fruits

Abstract

This invention relates to the field of plant genetic engineering technology, specifically to a... CsDOF1.8 Gene and its application in increasing the aroma of C9 aldehyde and corresponding alcohols in cucumber fruit. This was achieved through the construction of... CsDOF1.8 Genetic transformation of cucumber using overexpression vectors yields... CsDOF1.8 Overexpression in transgenic cucumbers. The increased content of C9 aldehydes and corresponding alcohols in the fruits of overexpression-mediated transgenic cucumber lines indicates... CsDOF1.8 Overexpression can increase the content of C9 aldehydes and corresponding alcohols in cucumber fruits.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a CsDOF1.8 gene and its application in increasing the aroma of C9 aldehydes and corresponding alcohols in fruits. Background Technology

[0002] Cucumbers are the world's third largest vegetable crop. During the ripening process, their fruits synthesize a large number of volatile compounds, which gives them a unique aroma that is widely popular with consumers.

[0003] More than 70 volatile compounds have been identified in cucumber fruits, mainly including aldehydes, alcohols, ketones, and terpenes. These are primarily derivatives produced through the lipoxygenase metabolic pathway. In cucumber fruits, the lipoxygenase pathway catalyzes the oxidation of unsaturated fatty acids such as linolenic acid and linoleic acid, producing 9-hydroperoxide (9-HPOs) and 13-hydroperoxide (13-HPOs). These are then oxidatively cleaved by hydroperoxide lyase (HPL), leading to the formation of short-chain C6 or C9 aldehydes. These C6 or C9 aldehydes are further metabolized by alcohol dehydrogenase (ADH) to generate the corresponding C6 or C9 alcohols. Therefore, C6 and C9 aldehydes and alcohols are the main aroma components constituting the flavor of cucumbers. During fruit development, C9 aldehydes and corresponding alcohol aromas gradually accumulate in cucumber fruits, mostly possessing cucumber flavor and fresh aroma. Among them, (E,Z)-2,6-nonadienal, which has the highest content, is the characteristic aromatic substance of cucumber fruits.

[0004] Transcription factors are crucial for regulating fruit quality traits, and studies have shown that they also participate in the regulation of lipoxygenase (LOX) metabolic pathways. Research indicates that DOF transcription factors are involved in various plant growth and development processes, such as dormancy and germination, flowering, fruit ripening, responses to biotic and abiotic stresses, and primary and secondary metabolism. Studies have found that DOF transcription factors participate in plant carbon and nitrogen metabolism. In maize, ZmDOF3 acts as a positive regulator of endosperm development, controlling starch accumulation and aleurone layer development in maize kernels. ZmDOF36 controls the content of reducing and soluble sugars in maize kernel endosperm by regulating the expression of starch synthesis-related genes ZmAGPS1a, ZmAGPL1, ZmISA1, ZmISA3, ZmGBSSI, and ZmSSIIa. In rice, OsDOF11 regulates sugar transport by modulating the expression of OsSUT and OsSWEET genes. In addition, DOF transcription factors also participate in the regulation of the synthesis of various secondary metabolites in plants.

[0005] In Arabidopsis, AtDOF4.2 is involved in the phenylpropane metabolic pathway, while AtDOF1.1 is involved in glucosinolate biosynthesis. DOF transcription factors also participate in the regulation of fatty acid metabolism. For example, heterologous overexpression of soybean GmDOF4 and GmDOF11 in Arabidopsis increases seed oil content by activating the expression of acetyl-CoA carboxylase and long-chain acyl-CoA synthase genes in Arabidopsis seeds; in rapeseed, downregulation of BnDOF5.6 significantly reduces fatty acid content in the embryo.

[0006] However, there are no reports on the involvement of DOF transcription factors in the regulation of lipoxygenase metabolic pathways, and the transcriptional regulatory mechanisms of C9 aldehydes and corresponding alcohols in cucumber fruit aroma synthesis are currently unclear. Therefore, elucidating the transcriptional regulatory mechanisms of cucumber fruit aroma and identifying key genes controlling cucumber fruit aroma is of great significance for accelerating cucumber flavor and quality breeding. Summary of the Invention

[0007] In view of this, the present invention relates to a CsDOF1.8 gene and its application in increasing the aroma of C9 aldehydes and corresponding alcohols in fruits. Overexpression of CsDOF1.8 can increase the content of C9 aldehydes and corresponding alcohols in cucumber fruits.

[0008] To address the problems existing in the prior art, the technical solution of the present invention is as follows: the coding sequence of the CsDOF1.8 gene is shown in SEQ NO.1.

[0009] Application of the CsDOF1.8 gene in increasing the aroma of C9 aldehydes and corresponding alcohols in cucumber fruits.

[0010] CsDOF1.8 increases the content of C9 aldehydes and corresponding alcohols in the fruits of transgenic plants overexpressing C9.

[0011] The genetically modified plant mentioned above is a cucumber.

[0012] The CsDOF1.8 overexpression vector was transferred into cucumber to obtain CsDOF1.8 overexpressing cucumber lines. The synthesis of C9 aldehydes and corresponding alcohols in the fruits of CsDOF1.8 overexpressing cucumber lines was increased.

[0013] Compared with the prior art, the advantages of the present invention are as follows:

[0014] 1. This invention utilizes plant genetic engineering technology to obtain a transgenic line of cucumber CsDOF1.8 overexpression through genetic transformation.

[0015] 2. The fruits of the transgenic cucumber strains overexpressing CsDOF1.8 of this invention show increased content of C9 aldehydes and corresponding alcohols for aroma.

[0016] 3. This invention demonstrates that overexpression of the cucumber CsDOF1.8 gene increases the aroma content of the fruit, providing a theoretical basis and technical means for the regulation of cucumber C9 aldehyde aroma, and laying the foundation for cucumber flavor and quality breeding. Attached Figure Description

[0017] Figure 1 Images of cucumber fruits from wild-type and CsDOF1.8 overexpression line (CsDOF1.8-OE).

[0018] Figure 2 To detect the CsDOF1.8 protein level in CsDOF1.8-OE plants using immunoblotting analysis.

[0019] Figure 3 The expression level of CsDOF1.8 in the CsDOF1.8-OE line and wild type was analyzed by RT-qPCR.

[0020] Figure 4 The aroma content of C9 aldehydes and corresponding alcohols in fruits of the CsDOF1.8-OE strain and wild type. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0022] This invention relates to the application of the CsDOF1.8 gene in increasing the synthesis of C9 aldehydes and corresponding alcohols in cucumber fruits.

[0023] The method and steps used are as follows:

[0024] Step 1: Amplify the CDS sequence of CsDOF1.8 and construct a CsDOF1.8 overexpression vector using homologous recombination technology;

[0025] Step 2: Transform the successfully constructed CsDOF1.8 overexpression vector into Agrobacterium, and use the Agrobacterium transformation method to introduce the CsDOF1.8 overexpression vector into cucumber to obtain CsDOF1.8 gene overexpression lines;

[0026] Step 3: Perform Western blot and quantitative analysis on the obtained CsDOF1.8 gene overexpression lines to confirm that the CsDOF1.8 gene is upregulated in the overexpression lines.

[0027] Step 4: Samples were taken from the fruits of the CsDOF1.8 gene overexpression line, and the contents of C9 aldehydes and corresponding alcohols in the fruits were measured to analyze the effect of CsDOF1.8 gene overexpression on the contents of C9 aldehydes and corresponding alcohols in the fruits.

[0028] The following are the specific steps for the application of the cucumber CsDOF1.8 gene in the synthesis of C9 aldehydes and corresponding alcohols in cucumber fruit aroma:

[0029] 1. Experimental Procedure

[0030] 1.1 Construction of CsDOF1.8 overexpression vector: Based on the genome sequence of cucumber 9930 (North China type), the first strand of cDNA synthesized by reverse transcription of total RNA from cucumber leaves was used as a template, and the CDS sequence of the CsDOF1.8 gene was amplified for the first time by polymerase chain reaction technology.

[0031] The coding region sequence of this gene is shown in SEQ NO.1:

[0032] ATGGATTCTGCTCACTGGCCTCAGGTTGAAGTTAAGAACATGGAATTAGAAGAAGAGGGTCTGAAGGCAGTTGTGGAAAGAAAAGCAAAAGCTAGGAAAGATCAAATATTGAACTGTCCAAGATGCAATTCCAACAACAAAGTTCTGTTACTACAACAATTACAGTC TCTCACAGCCAAGATACTTCTGTAAGTCTTGTAGAAGATATTGGACAGCTGGTGGGTCTTAAGGAACATTCCAGTTGGTGGGGCATCTAGGAAGAACAAGAGACCTTCAGCTAATTTTTCATTACCTCCTTCAAAGAACAATCAAAAGAATTATAATAATGATGGTGGT GACGATGATGATCAGGGCATTTCCCAATTAAATATCAATATTACTTCTTGTTCTTCAACTGCCACCACTACTAACACTGCTACTTCTTGTTGTTGGCTGTCATCTGATAATGATCATATGAATAATCAAATAATGCTGAGAAGTAATGGCATAATGTCTCAAAGGGAGC TCATTCCTTTTATTCCTATGCCTGCACCAGCTCCTCCAGCCTACTGCTGTTGCTGCTTTGGAGGATTTCAAGCAACTTTCAACCATCATTTCTACTGATCAAAATGGAGCTAAATTGGGGGATGCTCCTGCATTTTGGAGTGGCATTTTTGGTGGAGGTTCATGGTGA

[0033] The CDS sequence of CsDOF1.8 was ligated into the pCAMBIA1305-FLAG vector and transformed into E. coli (DH5α) competent cells for sequencing. The correctly sequenced p1305-CsDOF1.8 recombinant plasmid was transformed into EHA105 Agrobacterium competent cells.

[0034] 1.2 CsDOF1.8 Cucumber genetic transformation: Agrobacterium EHA105 competent cells were transformed using the freeze-thaw method. Agrobacterium containing the p1305-CsDOF1.8 recombinant plasmid was transformed into the CU2 inbred line.

[0035] Soak the seeds in 55℃ water for 30 minutes, remove the outer seed coat, and then sterilize them in a clean bench.

[0036] The disinfection steps are as follows: after treating the seeds with 75% alcohol for 30 seconds, rinse them three times with sterile water, then treat them with 4% sodium hypochlorite solution for 15 minutes, rinse them three times with sterile water, and then place them on seed germination medium for germination in the dark at 30℃.

[0037] The seed germination medium formula is: MS 4.43 g / L, sucrose 30 g / L, plant gel 2.5 g / L, pH adjusted to 5.6-5.8.

[0038] Agrobacterium containing the p1305-CsDOF1.8 recombinant plasmid was first incubated overnight with gentle shaking, and then cultured to OD. 600 The concentration of Agrobacterium was 0.5–0.7. After centrifugation, Agrobacterium was suspended in IM until the final concentration of OD600 was 0.2–0.3, which was used as the infection solution.

[0039] The infection solution was formulated as follows: MS 4.43 g / L, sucrose 30 g / L, 6-BA 2 mg / L, ABA 1 mg / L, acetylsylgenone (AS) 200 μM, 1.25 mM MES, and pH adjusted to 5.6–5.8.

[0040] When the radicle of the seed reaches 1–1.5 cm in length, the radicle at the tip of the cotyledon is cut off in a clean bench to form a U-shaped incision. The incision is placed in a 20 mL sterile syringe, and 10 mL of the prepared infection solution is added. The syringe is then opened to create negative pressure for two inoculations, each lasting 1.5 min. The inoculated explants are then co-cultured on a co-culture medium at 28°C in the dark for 3 days. After co-culture, the explants are transferred to a regeneration medium to induce the differentiation of regenerated shoots.

[0041] The co-culture medium was prepared by adding 2.5 g / L of plant gel to the infection solution.

[0042] The regeneration medium formula is as follows: MS 4.43 g / L, sucrose 30 g / L, plant gel 2.5 g / L, 6-BA 2 mg / L, ABA 1 mg / L, termethin 200 mg / L, pH adjusted to 5.6-5.8.

[0043] The GFP fluorescence of regenerated shoots from explant differentiation was observed using a stereofluorescence microscope (RXZ-5COB-LED, Ningbo). Regenerated shoots exhibiting fluorescent signals were marked, and after complete differentiation, they were transferred to rooting medium to induce rooting. Rooted fluorescent seedlings were then hardened off and transferred to sterilized substrate for further growth.

[0044] The rooting medium formula is: MS 4.43 g / L, sucrose 30 g / L, plant gel 2.5 g / L, termethin 200 mg / L, pH adjusted to 5.6-5.8.

[0045] 1.3 Identification of CsDOF1.8 Overexpression Positive Plants: After obtaining fluorescent seedlings, genomic DNA was extracted from the seedlings and used as a template for PCR amplification and detection using specific primers on the vector. Western blotting was performed on the CsDOF1.8 overexpressing plants using FLAG antibody to detect the expression of FLAG-tagged CsDOF1.8 protein in the overexpressing plants. CsDOF1.8 overexpressing lines and wild-type plants were transplanted to the glass greenhouse of Northwest A&F University. Fruits from 12 days post-transfer (12dpa) with good development and free from pests and diseases were collected between 8 and 9 am. After being transported back to the laboratory, the collected fruits were immediately flash-frozen in liquid nitrogen, then ground into powder using a liquid nitrogen grinder (IKA A11 basic, Germany), divided into three portions, and stored at -80℃. The expression level of CsDOF1.8 in the overexpressing lines and wild-type plants was determined.

[0046] 1.4CsDOF1.8 overexpression strain fruit aroma analysis

[0047] The aroma content of the fruit was determined using an ISQ&TRACE ISQ GC-MS system.

[0048] Weigh approximately 5g of uniformly ground cucumber fruit sample and place it in a 10mL extraction flask. Add NaCl, octanal solution (100μL / mL, internal standard), and a magnetic stir bead. Immediately seal the flask with aluminum foil and stir at 55℃ for 15min using a magnetic stirrer. Then, extract the aroma using a 75μm Carboxen / PDMS manual extraction head at 55℃ for 30min. After extraction, analyze the aroma using an HP-INNWAX column (0.25mm×60m×0.25μm, Shanghai, China) on a Trace GC ULTRA / ISQ MS instrument (Thermo Scientific, USA). The initial column temperature was 40℃ for 2.5min, then increased to 230℃ at a rate of 6℃ / min. The inlet temperature was 220℃, and the carrier gas was nitrogen at 1cm / s.

[0049] After measurement, the aroma was qualitatively and quantitatively analyzed by comparing with the ion spectrum library and using the baseline peak area normalization method combined with the internal standard method. The calculation formula is as follows:

[0050] The content of each aroma component (μg / g) = [peak area of ​​each component / (peak area of ​​internal standard × sample mass (g))] × internal standard concentration (μg / μL) × internal standard volume (μL)

[0051] 2. Experimental Results and Analysis

[0052] To further verify the regulatory effect of CsDOF1.8 on C9 content in cucumber fruits, the CDS sequence of CsDOF1.8 was constructed into the pCAMBIA1305-FLAG vector. The recombinant plasmid was transformed into Agrobacterium and then infected cucumber cotyledons, resulting in two stable overexpression cucumber lines. Fruits from the overexpression lines and wild-type cucumbers were sampled 12 days after flowering, and no significant differences in appearance were found (see [link to original text]). Figure 1 Western blot analysis confirmed the significant accumulation of CsDOF1.8 protein in CsDOF1.8 overexpression lines (see [link]). Figure 2 RT-qPCR showed that CsDOF1.8 expression was significantly higher in fruits of the OE-DOF1.8-1 and OE-DOF1.8-2 lines than in the wild type. The expression level of CsDOF1.8 in fruits of the OE-DOF1.8-1 line was 3.15 times that of the wild type, and the expression level of CsDOF1.8-2 line was 7.23 times that of the wild type (see [link to RT-qPCR]). Figure 3 ).

[0053] Aroma of fruits from CsDOF1.8 overexpression lines and wild-type fruits was measured. The results showed that, compared with wild-type fruits, the contents of (E,Z)-2,6-nonadienal in fruits from OE-DOF1.8-1 and OE-DOF1.8-2 lines were significantly increased by 38.15% and 72.53%, respectively; the contents of (E)-2-nonadienal were significantly increased by 89.85% and 120.88%, respectively; and the contents of 1-nonanol were significantly increased by 375.41% and 710.60%, respectively (see [reference missing]). Figure 4 ).

[0054] The above results indicate that overexpression of CsDOF1.8 in cucumber can increase the synthesis of C9 aldehydes and corresponding alcohols in the fruit.

[0055] The above descriptions are merely embodiments of the present invention and do not limit the patent scope of the present invention. The embodiments and descriptions in the specification are only illustrative of the basic principles and main features of the present invention. Those skilled in the art can still make various changes and modifications to the specific embodiments of the application after reading this application, but all such changes and modifications are included within the patent protection scope of the present invention.

Claims

1. CsDOF1.8 The application of the gene in increasing the aroma of C9 aldehydes and corresponding alcohols in cucumber fruits, the aforementioned CsDOF1.8 The gene coding sequence is shown in SEQ ID NO.1; the C9 aldehyde and the corresponding alcohol aroma are: (E, Z)-2,6-nonadienal, (E)-2-nonenal or 1-nonanol.

2. As described in claim 1 CsDOF1.8 The application of the gene in increasing the aroma of C9 aldehydes and corresponding alcohols in cucumber fruits is characterized by, In overexpression CsDOF1.8 The genetically modified cucumber fruit showed an increase in the content of C9 aldehydes and corresponding alcohols for aroma.

Images