Application of CD36 as a molecular marker and therapeutic target for inhibiting lung cancer meningeal metastasis

Abstract

The present invention belongs to the field of biomedical technology, and discloses the application of CD36 as a molecular marker and therapeutic target for inhibiting lung cancer meningeal metastasis, and specifically discloses the application of CD36 inhibitors in the preparation of products for preventing and treating lung cancer meningeal metastasis or products for reducing the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier. The present invention discloses for the first time the application of CD36 inhibitors in preventing and treating lung cancer meningeal metastasis. By targeting and downregulating CD36 or knocking out CD36 with inhibitors, the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier can be reduced, thereby inhibiting lung cancer meningeal metastasis, and ultimately improving or treating lung cancer.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and specifically relates to the application of CD36 as a molecular marker and therapeutic target for inhibiting lung cancer meningeal metastasis. Background Art

[0002] Lung cancer is a type of cancer with high morbidity and mortality, accounting for about 20% of tumor-related deaths. Tumor metastasis is an important cause of high mortality in lung cancer patients. Among them, leptomeningeal metastasis (LM) is one of the most fatal complications of advanced lung cancer, with an incidence of about 5% to 10%, and it is showing an increasing trend. In recent years, a precision treatment model for lung cancer based on molecular target classification represented by epidermal growth factor receptor (EGFR), anaplastic lymphoma kinase (ALK), and programmed death ligand / receptor 1 (PD-1 / PD-L1) has been gradually established. A series of large-scale international randomized controlled clinical trials have provided solid evidence-based medicine, confirming that molecular targeted therapy and immunotherapy can bring long-term survival to patients with advanced lung cancer. In terms of advanced lung cancer, the overall survival (OS) has been extended from 8 to 10 months in the era of traditional chemotherapy to 30 to 40 months in the era of precision combined therapy. The five-year OS rate of patients with advanced non-small cell lung cancer has exceeded 30%. However, the extended survival period is also difficult to avoid the problem of recurrence and metastasis. The increasing incidence of central nervous system metastasis, especially the meningeal metastasis (LM) with a worse prognosis, has become an important factor limiting the survival of lung cancer patients. Previous studies by the team of the present invention suggest that the diagnosis rate of lung cancer meningeal metastasis is as high as 10%; the quality of life and survival of patients are extremely poor, and the prognosis of untreated lung cancer LM patients is only 1 to 3 months. Meningeal metastasis tumor cells are diffusely distributed in the subarachnoid space and cannot be surgically removed. At present, the treatment options for meningeal metastases are targeted therapy, chemoradiotherapy and immunotherapy. The problem of treatment resistance is inevitable during the use of targeted therapy. However, radiotherapy and chemotherapy lack precision. While killing tumor cells, they damage normal tissue cells, have large toxic side effects, and can cause nausea, loss of appetite, hair loss, decreased immunity and many other adverse reactions; immunotherapy is not effective.

[0003] Currently, the treatment of lung cancer LM is extremely limited, mainly due to the lack of understanding of the molecular mechanism of LM. The complex process of meningeal metastasis is disassembled: tumor cells first need to break through the blood-brain barrier; secondly, the pre-metastatic microenvironment formed at the metastatic site provides a "soil" for tumor cells to colonize and grow; then only tumor cells that adapt to the unique environment of the meninges with a lack of nutrients can eventually survive and spread. In recent years, the exploration of the mechanisms of multiple steps in the process of meningeal metastasis has made rapid progress: at the level of breaking through the blood-brain barrier and entering the cerebrospinal fluid, a research team from the University of Toronto and Memorial Sloan Kettering Cancer Center (MSKCC) found that tumor cells up-regulated the expression of chemokine ligand 2 (CCL2) and complement component 3 (C3), promoting tumor cells to enter the cerebrospinal fluid circulation; at the level of adaptive proliferation advantage in the cerebrospinal fluid, the MSKCC research team found that tumor cells use the lipocalin 2 / soluble carrier transport protein 22A17 iron transport system (LCN2 / SLC22A17) iron transport system to obtain iron ions to maintain their own growth, while macrophages in the cerebrospinal fluid cannot obtain limited iron ion resources, resulting in weakened immune surveillance function. The Beckman Institute team confirmed that macrophage colony-stimulating factor (GM-CSF) secreted by epidermal growth factor receptor 2 mutation-positive breast cancer cells can prolong the survival time of animal models of meningeal metastasis. The research paper of the Sun Yat-sen University team suggests that VLA4-positive tumor cells mediate the excretion of immune cells in the cerebrospinal fluid, thereby creating an immunosuppressive microenvironment. However, there are currently few clinically available targets for these studies, and no targeted drugs for lung cancer meningeal metastasis have been approved.

[0004] Fused in sarcoma / Translocated inliposarcoma (TLS) was first discovered in chromosomal translocations. It is often fused with the CHOP gene and is involved in the occurrence of liposarcoma. FUS is a DNA / RNA binding protein that can bind to both the cell's DNA and RNA at the same time. It plays an important role in gene transcription, RNA splicing and operation, and protein translation regulation. FUS mutations or abnormal expression are associated with the occurrence and development of a variety of tumors and neurodegenerative diseases. Existing evidence shows that FUS is involved in the occurrence and development of many tumors and neurodegenerative diseases, and mutations are more common in lateral sclerosis, gliomas, and osteosarcomas. The FUS gene is associated with mitochondrial damage or autophagy in gliomas and osteosarcomas. Reduced FUS expression enhances the metastatic ability of pancreatic cancer cells, but some studies have also pointed out that upregulated FUS expression promotes breast cancer metastasis. However, its role in lung cancer metastasis has not yet been reported.

[0005] Tumor cells proliferate vigorously and have high energy requirements. They mainly absorb nutrients from the environment to meet the energy supply requirements during the proliferation of metastatic lesions. Studies have shown that tumor cells in the cerebrospinal fluid / meningeal microenvironment show more efficient nutrient uptake and energy metabolism. A team from the University of Texas Southwestern Medical Center reported that fatty acid anabolism can promote brain metastasis of breast cancer cells, suggesting that breast cancer cells can obtain fatty acids from astrocytes and store them in the cytoplasm in the form of lipid droplets, changing the form of energy metabolism to promote brain metastasis of breast cancer. A research team from the Massachusetts Institute of Technology also found a similar phenomenon. The energy metabolism pattern targeting metastatic lesions may be the key to the treatment of central nervous system metastasis of lung cancer. Studies have found that CD36 plays a key role in fatty acid metabolism. CD36 is also known as leukocyte differentiation antigen. Existing studies have shown that it participates in important cellular physiological activities as a thrombospondin receptor and fatty acid translocase. As a membrane protein, CD36 is the starting site of intracellular signal transduction for fatty acid metabolism. It takes in lipids from the extracellular environment and triggers their β-oxidation to obtain energy in the form of ATP. The expression of CD36 has been reported to be associated with cancer in previous studies, but its therapeutic significance and mechanism of action in lung cancer are unclear. Previous patents CN 114381459A and CN 117338921 A disclosed the anti-tumor effects of CD36 antibodies in renal clear cell carcinoma and pancreatic cancer. However, there is currently no treatment method for blocking lung cancer by targeting CD36. CN 115768465 A disclosed the role of anti-CD36 neutralizing antibodies in treating metastasis of solid cancers, but it did not provide a detailed description of its application in specific metastatic sites of tumors, especially meningeal metastasis of lung cancer. There is also no evidence that the expression of CD36 in different parts of lung cancer has different metastasis-promoting abilities.

[0006] In summary, there are currently very limited effective clinical intervention methods for lung cancer LM. In addition, the understanding of the mechanism of lung cancer meningeal metastasis is very scarce, and there are no reports of effective molecular targets for lung cancer LM. Summary of the invention

[0007] The present invention aims to target the FUS-CD36 fatty acid metabolism axis to develop new and efficient molecular targets for lung cancer LM, which has great clinical significance and translational value.

[0008] The first aspect of the present invention aims to provide a use of a CD36 inhibitor in the preparation of a product for preventing and treating lung cancer meningeal metastasis or a product for reducing the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier.

[0009] The second aspect of the present invention aims to provide a sgRNA.

[0010] The third aspect of the present invention aims to provide a product.

[0011] The purpose of the fourth aspect of the present invention is to provide the use of the sgRNA of the second aspect of the present invention or the product of the third aspect of the present invention in the preparation of a drug for treating cancer.

[0012] The fifth aspect of the present invention aims to provide the use of CD36 as a target in the development of drugs for preventing and treating lung cancer meningeal metastasis.

[0013] In order to achieve the above object, the technical solution adopted by the present invention is:

[0014] The first aspect of the present invention provides the use of a CD36 inhibitor in the preparation of a product for preventing and treating lung cancer meningeal metastasis or a product for reducing the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier.

[0015] In some embodiments of the present invention, the lung cancer meningeal metastasis includes lung cancer pia mater metastasis and lung cancer dura mater metastasis; preferably, lung cancer pia mater metastasis.

[0016] In some embodiments of the present invention, the CD36 inhibitor is at least one of a substance that inhibits CD36 activity, a substance that degrades CD36, a substance that reduces the expression level of CD36, and a substance that knocks out / knocks down CD36 expression.

[0017] In some embodiments of the present invention, the substance that reduces the expression level of CD36 is at least one of (1) to (5):

[0018] (1) siRNA, dsRNA, miRNA, sgRNA, ribozyme or shRNA targeting CD36;

[0019] (2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme or shRNA targeting CD36 described in (1);

[0020] (3) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (2);

[0021] (4) Small molecule compounds targeting CD36;

[0022] (5) CD36 inhibitory polypeptides that block CD36 protein and / or CD36 protein intermediates.

[0023] In some embodiments of the invention, the transgenic cell line does not contain reproductive material

[0024] In some embodiments of the present invention, the small molecule compound targeting CD36 includes at least one of sulfo-N-succinimidyl oleate, AP5258, AP5156, 2-methylthio-1,4-naphthoquinone (MTN), Puerarin, Salvianolic acid (SAB) and FA-Linked Pt(IV)-Prodrugs.

[0025] In some embodiments of the present invention, the CD36 inhibitory polypeptide that blocks CD36 protein and / or CD36 protein intermediates includes anti-CD36 antibodies, such as FA6.152, JC63.1, Cyeli csap, EP80317, and VT1021.

[0026] In some embodiments of the present invention, the CD36 inhibitor is at least one of a1) to a5):

[0027] a1) sgRNA targeting CD36;

[0028] a2) a nucleic acid molecule encoding the sgRNA targeting CD36 described in a2);

[0029] a3) an expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in a2);

[0030] a4) sulfo-N-succinimidyl oleate;

[0031] a5) Anti-CD36 antibody.

[0032] In some embodiments of the present invention, the nucleotide sequence of the sgRNA is shown in SEQ ID NO:5 or SEQ ID NO:6.

[0033] In some embodiments of the present invention, the product includes drugs and reagents.

[0034] In some embodiments of the present invention, the product achieves the purpose of inhibiting lung cancer meningeal metastasis by targeting the FUS-CD36-fatty acid metabolism axis.

[0035] According to a second aspect of the present invention, an sgRNA is provided, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO:5 or SEQ ID NO:6.

[0036] The third aspect of the present invention provides a product, including a CD36 inhibitor targeting tumor cell CD36, wherein the CD36 inhibitor includes the sgRNA of the second aspect of the present invention.

[0037] In some embodiments of the present invention, the product has the function of inhibiting lung cancer meningeal metastasis and / or reducing the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier.

[0038] In some embodiments of the present invention, the lung cancer meningeal metastasis includes lung cancer pia mater metastasis and lung cancer dura mater metastasis; preferably, lung cancer pia mater metastasis.

[0039] A fourth aspect of the present invention provides use of the sgRNA of the second aspect of the present invention or the product of the third aspect of the present invention in the preparation of a drug for treating cancer.

[0040] In some embodiments of the present invention, the cancer comprises lung cancer.

[0041] In some embodiments of the present invention, the cancer comprises lung cancer meningeal metastasis.

[0042] A fifth aspect of the present invention provides the use of CD36 as a target in the development of drugs for preventing and treating lung cancer meningeal metastasis.

[0043] In some embodiments of the present invention, the lung cancer meningeal metastasis includes lung cancer pia mater metastasis and lung cancer dura mater metastasis.

[0044] In some embodiments of the present invention, the lung cancer meningeal metastasis is lung cancer leptomeningeal metastasis.

[0045] The beneficial effects of the present invention are:

[0046] The present invention discloses for the first time the use of CD36 inhibitors in preventing and treating lung cancer meningeal metastasis. By targeting and downregulating CD36 or knocking out CD36 with inhibitors, the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier can be weakened, thereby inhibiting lung cancer meningeal metastasis. That is, lung cancer meningeal metastasis can be treated by inhibiting the fatty acid transport of lung cancer cells by targeting CD36, ultimately improving or treating lung cancer.

[0047] Specifically, the present invention detected by CSF ELISA that the cerebrospinal fluid presented an environment rich in free fatty acids; through the mouse model, cells with high meningeal metastasis rate FUS deficiency and lep cells were obtained, and then in the transcriptome sequencing, it was found that the expression of genes involved in fatty acid metabolism in FUS-deficient cells and Lep cells was significantly upregulated; further analysis showed that FUS deficiency upregulated the expression level of CD36 and enhanced the uptake of free fatty acids by lung cancer cells, suggesting that FUS deficiency may promote lung cancer meningeal metastasis by enhancing the fatty acid metabolism of tumors. In a humanized mouse model of lung cancer meningeal metastasis, the applicant verified that the phenotype of FUS deficiency promoting lung cancer meningeal metastasis depends on the expression of CD36; single-cell transcriptome sequencing analysis found that in the CSF of lung cancer patients, lung cancer cells highly expressed CD36, and changes in its expression level were related to the progression of the patient's disease; in the humanized mouse model, lung cancer cells with meningeal metastasis highly expressed the membrane protein CD36, overexpression of CD36 promoted lung cancer meningeal metastasis, and knocking out CD36 or blocking CD36-mediated fatty acid metabolism could inhibit lung cancer cells from meningeal metastasis. Lung cancer cells with FUS knockout and CD36 overexpression were injected into the left ventricle of mice. After systemic circulation, about 70% to 90% of individuals had meningeal metastasis. CD36 gene knockout was performed on mice with meningeal metastasis, and it was found that the incidence of meningeal metastasis in CD36 KO mice was reduced and the survival time was prolonged. At the same time, the present invention transplanted cells overexpressing CD36 subcutaneously in mice, and found that CD36 overexpression did not promote the proliferation of lung cancer subcutaneously, suggesting that CD36 gene overexpression in lung cancer mainly affects the proliferation of tumor cells in the skull. Small molecule drugs SSO and neutralizing antibodies targeting CD36-mediated fatty acid translocation can significantly inhibit the growth of tumor cells in lung cancer LM mouse model and LM-PDX, and significantly prolong the overall survival of LM mice. In summary, the present invention mainly found that CD36-mediated fatty acid metabolism is a key regulatory factor in lung cancer meningeal metastasis. Targeting the FUS-CD36 fatty acid metabolism axis to inhibit fatty acid transport has potential development prospects.

[0048] The present invention discovered for the first time that in the mouse model of lung cancer meningeal metastasis and in patients, tumor cells in the cerebrospinal fluid and tumor foci highly expressed CD36, and that this was related to the efficacy and course of the patient's intrathecal injection treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1The figure shows the construction of an animal model of lung cancer meningeal metastasis; A is a diagram illustrating the establishment scheme of a mouse model of lung cancer meningeal metastasis; B-C are the survival period and incidence of meningeal metastasis of mice after synchronous ventricular transplantation of par or Lep cells of A549 (B) and PC9 (C), brain signals were detected by fluorescent in vivo imaging, and the figure shows that Lep cells have stronger meningeal metastasis ability, and pathological sections of mouse brain tissue and keratin immunohistochemistry analysis show tumor lesions in meningeal structure, scale: whole brain image 2000μm, screenshot 200μm; D is a Transwell assay result diagram, showing that Lep cells have stronger BCSFB ability; E is a comparison of BCSFB ability of par cells and Lep cells, showing that Lep cells have a stronger ability to penetrate the blood-cerebrospinal fluid barrier; in the figure, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0050] Figure 2 Figure 1 is a whole-genome screening based on CRISPR cas9; A is a flowchart illustrating the application of CRISPRcas9 technology screening in LM mice; B is the sequencing gene analysis results of mouse cerebrospinal fluid cells after CRISPR cas9 screening, showing that FUS knockdown was detected in all four cell lines after meningeal metastasis; C is the Gini coefficient of sgRNA distribution in input and meningeal metastasis cells; D is the percentage of sgRNA counts in input cells and Lep cells compared with the GeCKO v2 library; E is the percentage of LM incidence in mice injected with GeCKO library cells and Input cells; F is the GeCKO screening results, showing the top 10 deleted genes that are downregulated in meningeal metastasis cells compared with parental cells; in the figure, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0051] Figure 3 FUS knockout promotes lung cancer meningeal metastasis; A is the ability of cells to penetrate BCSFB after FUS knockout; B is the result of in vivo imaging on the 21st day after transplantation, showing that cells with FUS knockout have stronger meningeal metastasis ability (8 mice in each group); C is the pathological sections of mouse brain tissue and the meningeal metastasis of cells in mice, showing that the incidence of meningeal metastasis in cells with FUS knockout is higher, and the pathological sections of mouse brain tissue show tumor lesions in meningeal structure, scale: whole brain image 2000μm, screenshot 200μm; D is the survival period of mice after transplantation of FUS knockout cells (ctl 15, sg-FUS 12), showing that the survival period is shortened; E is the result of qPCR detection; F is the result of Western blot detection; E and F results show that FUS expression in Lep cells is significantly lower than that in Par cells; in the figure, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0052] Figure 4 FUS deficiency-dependent upregulation of CD36 promotes lung cancer meningeal metastasis; A is the result of GSEA analysis, showing that the upregulated genes in Lep cells and sg-FUS cells are related to fatty acid metabolism; B is the intersection of the upregulated genes in Lep cells and sg-FUS cells to select 8 commonly upregulated genes, among which CD36 is involved in fatty acid uptake; C is mouse fluorescent in vivo imaging, the results show the changes in fluorescence signals after synchronous ventricular transplantation of FUS knockout cells, FUS and CD36 knockout cells and parental cells on the 28th day (8 in each group); D is the incidence of mouse meningeal metastasis after FUS knockout cells, the results show synchronous After ventricular transplantation, the incidence of meningeal metastasis in mice was the highest after FUS knockout cells were performed. On this basis, knocking down the expression level of CD36 could reduce the incidence of meningeal metastasis, and the incidence of meningeal metastasis in the parental mice was the lowest; E is a pathological section of mouse brain tissue, showing tumor lesions in the meningeal structure, scale: 2000μm for the whole brain image, 200μm for the screenshot; F is the survival period of mice after transplantation of FUS knockout cells, and the results showed that the survival period was significantly shortened. On this basis, knocking down the expression level of CD36 could prolong the survival of mice; in the figure, the mice were divided into: Ctl group, 8 mice, sg-FUS group, 9 mice, sg-FUS&CD36 group, 12 mice; * indicates p<0.05.

[0053] Figure 5 Overexpression of CD36 promotes meningeal metastasis of lung cancer; A is the result of Transwell assay, indicating that lung cancer cells overexpressing CD36 have stronger penetration ability, and knocking out CD36 weakens the ability to penetrate BCSFB; B~D are typical fluorescent in vivo imaging (B), brain slices (C) and survival time statistical analysis (D) on the 21st day after transplantation, respectively. The results show that overexpression of CD36 promotes tumor meningeal metastasis, while knocking out CD36 significantly inhibits tumor meningeal metastasis, and the survival time of mice is significantly prolonged (8 mice in each group); E is the situation of tumor metastasis in various organs after the mice were killed; F is the result of free fatty acids detection in cerebrospinal fluid of lung cancer patients; G is that overexpression of CD36 enhances the proliferation ability of tumor cells in the cerebrospinal fluid microenvironment of metastatic patients. H is the proliferation ability of PC9-derived cell lines in ordinary culture medium and CSF from patients with meningeal metastasis. The results show that FUS-knockout cells have stronger proliferation ability in cerebrospinal fluid and are dependent on CD36; I-J are the changes in tumor volume after CD36-overexpressing cells and parental cell lines were transplanted subcutaneously in the inguinal area of ​​mice. The results show that there is no significant difference in tumor size after CD36-overexpressing cells and parental cells were transplanted subcutaneously in mice and proliferated for a period of time, indicating that the proliferation ability of CD36-overexpressing cells in the subcutaneous (extracranial) area is not significantly enhanced; in the figure, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0054] Figure 6 The results are as follows: The results of CD36 overexpression promote the metastasis of lung cancer to the meninges; A is the immunohistochemical analysis, the results show that the tumor cells metastasized to the meninges of mice highly express CD36; B is the high expression of CD36 in the primary lesion of lung cancer is positively correlated with the poor prognosis of patients; C is the qPCR test results, showing that the expression level of CD36 in Lep cells is higher than that in par; D is Western The blot test results showed that the expression level of CD36 in Lep cells was higher than that in Par; E was the flow cytometry test results, showing that the expression level of CD36 in Lep cells was higher than that in Par; F was the UMAP dimensionality reduction analysis, showing the single-cell transcriptome sequencing results of cerebrospinal fluid in patients with lung cancer LM. The cell clustering in the cerebrospinal fluid of LM patients showed the presence of a group of tumor cells; G was the COPYCAT algorithm that re-loaded the presence of tumor cell groups in the cerebrospinal fluid; and some cerebrospinal fluid tumor cells highly expressed CD36; H was the flow cytometry test results, showing the expression of CD36 in cells in the cerebrospinal fluid of patients with lung cancer; in the figure, * indicates p<0.05; ** indicates p<0.01; *** indicates p<0.001.

[0055] Figure 7 To dynamically detect the number of CD36-positive tumor cells in the cerebrospinal fluid of patients with meningeal metastasis and their treatment status through cerebrospinal fluid flow cytometry; A and B are the typical MR and flow cytometry changes of CD36-positive tumor cells in patients with lung cancer meningeal metastasis who were relieved after intrathecal injection; C is the flow cytometry changes of CD36-positive tumor cells in patients with lung cancer meningeal metastasis who responded to intrathecal injection; D is the flow cytometry changes of CD36-positive tumor cells in patients with lung cancer meningeal metastasis who were not relieved after intrathecal injection.

[0056] Figure 8Targeting CD36 to inhibit fatty acid transport in lung cancer cells can prolong the survival time of lung cancer LM mice and LM-PDX; A, H, and K are experimental flow charts for constructing a meningeal metastasis model by left ventricular transplantation to evaluate the effect of targeting CD36 in inhibiting meningeal metastasis; B is the in vivo imaging of SSO treatment inhibiting tumor (A549-Lep) meningeal metastasis; C, F, and I are all mouse brain tissue pathological sections showing tumor lesions in meningeal structure, scale: whole brain image 2000μm, screenshot 200μm; D, G, and J are SSO treatment prolonging the survival time of mice The figure shows the survival period of mice; E is the in vivo imaging of SSO treatment inhibiting the meningeal metastasis of tumor (PC9-Lep); L is the in vivo imaging result on the 28th day, showing that CD36 neutralizing antibody treatment inhibited the meningeal metastasis of tumor; M is the pathological section of mouse brain tissue showing the tumor lesions of meningeal structure, scale: whole brain image 2000μm, screenshot 200μm; N is CD36 neutralizing antibody treatment extending the survival period of mice; in the figure, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, and there are at least 8 mice in each group. DETAILED DESCRIPTION

[0057] The present invention is further described in detail below through specific examples.

[0058] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0059] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0060] The sequences involved in the embodiments of the present invention are as follows:

[0061] qPCR primer sequences:

[0062] CD36-Forward: 5'-CAGGTCAACCTATTGGTCAAGCC-3' (SEQ ID NO: 1);

[0063] CD36-Reverse: 5'-GCCTTCTCATCACCATGGTCC-3' (SEQ ID NO: 2);

[0064] FUS-Forward: 5'-CAGACAGGGAAACTGGCAAGCT-3' (SEQ ID NO: 3);

[0065] FUS-Reverse: 5'-GGCGAGTAGCAAATGAGACCTTG-3' (SEQ ID NO: 4).

[0066] sgRNA sequence:

[0067] CD36-sg1: GAACTGTGGGCTCATCGCTGGGG (SEQ ID NO: 5);

[0068] CD36-sg2: AAACGAACTCTGTACGTATAAGG (SEQ ID NO: 6);

[0069] FUS-sg1: TATGGCTCGACTGGCGGCTA (SEQ ID NO:7);

[0070] FUS-sg2: CGCCAGTCGAGCCATATCCC (SEQ ID NO:8).

[0071] Whole genome knockout primers:

[0072] 1st PCR Forward:

[0073] 5'-AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG-3' (SEQ ID NO:9);

[0074] 1st PCR Reverse:

[0075] 5'-CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC-3' (SEQ ID NO: 10).

[0076] The term "leptomeningeal metastasis (LM)" means that the structure of the meninges is divided into three layers covering the surface of the brain parenchyma: the dura mater, the arachnoid mater, and the pia mater. The cerebrospinal fluid (CSF) circulates between the meninges, which protects and provides nutritional support to the brain parenchyma. The currently recognized definition of meningeal metastasis refers to tumor cells invading the arachnoid mater, the pia mater, and the circulating cerebrospinal fluid, forming lesions with various manifestations such as diffuse, nodular, and localized infiltration.

[0077] The term "BCSFB": blood-cerebrospinal fluid barrier, refers to the shielding structure composed of choroid plexus epithelial cells and choroid plexus capillary endothelial cells and their basement membranes. It can prevent some substances from entering the cerebrospinal fluid from blood vessels.

[0078] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0079] Materials and methods

[0080] Construction of LM disease model for lung cancer

[0081] 1. Cell culture:

[0082] The A549 and PC9 cell lines used in the study were derived from the applicant's research group's inventory resources (purchased from the ATCC cell bank in the United States). To facilitate observation, detection and in vivo imaging, the cell lines used were genetically engineered to introduce luciferase and green fluorescent protein GFP genes for in vivo observation. The cells were cultured in 10 cm diameter cell culture dishes or T25 and T75 culture flasks using RPMI-1640 complete medium (containing 10% FBS and 1% penicillin-streptomycin solution). The cell culture incubator temperature was 37°C and the CO2 concentration was 5%.

[0083] Construction of animal model of meningeal metastasis ( Figure 1 Middle A)

[0084] The animal experiments described in this invention were mainly completed at the Guangzhou Institute of Biomedicine and Health (GIBH), Chinese Academy of Sciences. The main experimental animals were NOD-SCID / IL2gr- / - (NSI) mice with specific pathogen-free (SPF) level, which were independently developed by GIBH (patent number: ZL201310229629.9). All experimental animal management and use were reviewed and approved by the GIBH Experimental Animal Ethics Management Committee in accordance with the international AAALAC standards, and were raised and bred in the SPF-level experimental animal center of GIBH (animal experimental facility license number: SYXK (Guangdong) 2020-0063). The present invention relates to a meningeal metastasis feature enrichment system, which comprises: inoculating mice with parent lung cancer cells in the cerebellomedullary cistern, and then after a period of feeding, killing the mice after the mice show obvious central nervous system tumors, drastic weight loss, unstable gait, hunched back posture and other symptoms, collecting cancer cells in cerebrospinal fluid, and inoculating the collected cells into another batch of mice, and then continuing to feed for a period of time, collecting cancer cells in cerebrospinal fluid, repeating the intraventricular injection three times, and collecting "Int3" cells. After the left ventricle injection of mice, the mice are fed for a period of time, and the fluorescent signal is monitored by fluorescent in vivo imaging. After the above-mentioned killing signs appear, the mice are killed and the cancer cells in the cerebrospinal fluid are collected, which are "lep" cells.

[0085] Intraventricular injection: Fix the anesthetized mouse on the puncture board: use the body position with the limbs spread out, the abdomen facing down, and the back facing up. Expose the puncture point: Use ophthalmic scissors to cut the skin of the head along the midline of the two ears for about 1 to 2 cm, use hemostatic forceps to gradually separate the subcutaneous fascia-muscle at the foramen magnum, and stop separating when the white aponeurosis under the muscle is visible (the junction of the foramen magnum and the atlas), and place a 15mL centrifuge tube under the neck of the mouse to fully expose the back of the mouse neck. Puncture injection: Take out the EP tube containing the cell suspension to be injected from the ice box, tap the bottom of the centrifuge tube to mix the cell suspension, and use a 50μL microsyringe to draw 5μL of the cell line suspension to be injected (the cell amount is 5×10 4 ). Use forceps to open the muscle with your left hand (use hemostatic forceps to separate and fix if necessary), hold the micro-syringe in your right hand, insert the needle at an angle of about 60-70° to the white fascia, feel the sense of empty space, insert the needle about 1.5mm, keep the needle depth unchanged, and slowly inject the cell suspension at a rate of 5μL / min. During the injection process, pay attention to observe the heartbeat and life status of the mouse, and be careful not to inject bubbles. After the injection, withdraw the needle, return the muscle to its original position, observe the life status of the mouse for 30 seconds, and after confirming that it is normal, intermittently suture the skin behind the mouse's brain, mark and record.

[0086] Ventricular injection: Place the mouse on the puncture board: Use the position with the limbs spread out and the chest facing up. Expose the puncture point: First observe the most obvious part of the mouse's heart beat, and then separate the skin on the mouse's chest step by step. Start separating from the xiphoid process to the clavicle plane. After cutting the skin, fix the skin on both sides of the mouse's chest with the index and middle fingers of the left hand to fully expose the chest cavity. Locate the most obvious part of the pulsation about 2 mm to 5 mm to the left of the midpoint between the xiphoid process and the clavicle end of the sternum, disinfect it twice with an alcohol cotton ball, and wipe it once with a clean sterile gauze. Puncture injection: Take out the cell line suspension to be injected from the ice box, flick the bottom of the centrifuge tube to mix the cell suspension thoroughly, and use a 1mL syringe to draw 100μL of the cell line suspension to be injected. Hold the skin on both sides of the mouse's chest with your left hand to fully expose the chest cavity; hold the syringe in your right hand and insert the needle at an angle of about 60 to 70 degrees from the upper edge of the intercostal space below the intercostal space where the heart beats most obviously. When the needle is about one-third of the way in, withdraw the needle and start to maintain negative pressure to slowly insert the needle deeper. When bright red blood flows into the needle, it is considered that the needle has entered the left ventricle. Keep the depth of the needle unchanged and slowly inject the cell suspension at a rate of 50μL / min. During the injection process, pay attention to the heartbeat and respiratory rate of the mouse; when 50μL of the cell line is injected, withdraw it. If it is still bright red blood, continue to inject. If it does not move when withdrawn, or the resistance to needle insertion disappears, consider withdrawing the needle to observe whether the needle is dislocated due to the heartbeat. Be careful not to inject bubbles. After the injection, withdraw the needle and observe the life status of the mouse for 30 seconds. After confirming that it is normal, suture the skin outside the mouse's chest cavity and mark and record. The tumor burden of mice was monitored by bioluminescence imaging (BLI) using an IVIS Spectrum machine on days 1, 7, and 14 after modeling.

[0087] Mice were killed: When mice showed significant neurological symptoms and could not survive, they were anesthetized with carbon dioxide to be killed. The skull was opened, and the skull base and brain surface were flushed with 2 mL of sterile PBS. The cerebrospinal fluid was centrifuged at 500 g for 5 min and resuspended in RPMI 1640 medium containing 10% FBS. The brain, spinal cord, heart, liver, spleen, lungs, kidneys and other organs were collected and stored in 4% paraformaldehyde.

[0088] Brain vascular endothelial cell Transwell assay

[0089] Coating with matrix gel: Matrigel gel and RPMI 1640 serum-free medium were mixed into a 30% concentration solution, and then dropped onto the upper chamber membrane of a Transwell with a pore size of 8 μm, and placed in an incubator overnight to solidify; (2) Adding brain vascular endothelial cells: After the Matrigel gel solidified, approximately 2×10 cells were taken. 5 The brain vascular endothelial cells were resuspended in complete culture medium and seeded into the upper chamber of the Transwell. (3) Tumor cells were added: about 1×10 cells were taken. 5The tumor cells were resuspended in 1% serum complete culture medium, seeded into the upper chamber of Transwell, and 300 μL of 10% FBS complete culture medium was added to the lower chamber, and cultured in a cell culture incubator for 36 hours; (3) Fixation: After 36 hours, the entire system was taken out, washed with phosphate buffer, and fixed with 75% alcohol for 10 minutes; (4) Staining: Crystal violet was diluted 1:4, added to the transwell system for staining for 10 minutes, and washed with phosphate buffer for 5 minutes; (5) Counting cells: Use a wet cotton swab to carefully wipe off the cells and other substances on the upper surface of the chamber, place the chamber on a Corning 12-well plate, and observe and photograph it under a microscope.

[0090] CRISPR-cas9 whole genome knockout library screening process

[0091] The present invention uses a human genome-wide knockout library (addgene, pooled libraries, Human CRISPR Knockout Pooled Library (GeCKO v2) (library A+B) designed by Professor Zhang Feng's team at BROAD Institute. The library is designed and constructed with 123,411 sgRNAs, targeting 19,050 genes in the human genome, and an average of 6 sgRNA sequences with different targeting sites are designed for each gene sequence.

[0092] The screening process is shown below:

[0093] Whole genome screening sgRNA library synthesis → construction of sgRNA library vector library → amplification of sgRNA library vector library → assembly of sgRNA library lentiviral library → infection of cells with lentiviral library → pressure screening (puromycin) to obtain infected cell pool → transplantation of experimental group / preparation of sequencing of wild group → comparative analysis of screening genes of sgRNA PCR amplification sequence results ( Figure 2 (A).

[0094] The key experimental steps of the screening process are as follows:

[0095] (1) Lentiviral sgRNA library assembly:

[0096] The day before transfection, plate 293T cells in a 10 cm culture dish in advance. Observe the cells on the day of the experiment, and when the confluence reaches about 70% to 80% of the cells, replace the culture medium with 1% DMEM complete medium. Add the auxiliary plasmid and GeCKO v2 library plasmid to a 15 mL centrifuge tube in proportion and mix well. Calculate the amount of polyetherimide (PEI) added by volume and place it in another 15 mL centrifuge tube. Then mix the liquids in the two centrifuge tubes, slowly pipette and mix, incubate at room temperature for 20 to 30 minutes, add it to the 293T cells after changing the culture medium, and change the culture medium 6 to 8 hours after transfection. Thereafter, collect the lentiviral library every day for 72 consecutive hours.

[0097] (2) Determination of lentiviral infection efficiency:

[0098] PC9 and A549 cells were cultured routinely and grown to 80% confluence, then counted and plated onto 10 cm culture dishes (starting cell number 3×10 5 ), add 10 ml of 1% DMEM complete medium, add 1 μL polybrene (set up 6-well experimental group and 6-well control group without drug treatment). After four days of culture, add 20 μg of 2 μg / mL puromycin for screening, and the control group is not treated. In the puromycin plate, the cells in the 0 μL virus group are completely dead, and the live cells of the two plates can be counted. The puromycin-treated plate is defined as the "number of live cells", and the untreated plate is defined as the "number of control cells". Then the active titer of each virus dose group is converted according to the formula: Titer (IFU / mL) = (number of live cells × starting number of cells) ÷ (number of control cells × volume of virus in milliliters). Finally, the average value is calculated to obtain the final titer. Calculate the infection efficiency = number of cells in the drug-added dish / number of cells in the non-drug-added dish, and select the volume with infection efficiency = 0.1 for library virus transfection.

[0099] (3) Lentiviral library transfection:

[0100] Prepare the lentivirus-infected cell pool according to the infection efficiency. Plate A549GL and PC9GL cells and culture until 70% of the bottom of the culture dish is covered. Discard the supernatant, wash twice with phosphate buffer, add the virus solution containing the lentivirus library according to the volume of infection efficiency = 0.1, add polybrene, and culture for 2 days; remove the lentivirus library culture medium, add the culture medium containing 2μg / mL puromycin, and continue to culture for 3 days; change the medium, collect the obtained cells, that is, the CRISPR / Cas9 whole genome knockout cell pool. Theoretically, after transfection with the lentivirus library virus solution with an infection efficiency of 0.1, each cell in the cell pool should have only one gene knocked out.

[0101] (4) Whole genome knockout cell genome library construction and sequencing

[0102] 3×10 cells were collected from the CRISPR / Cas9 whole genome knockout cell pool. 7 The sample genome was extracted. The sgRNA coverage was greater than 400×, so the template amount was 200μg gDNA, so 10 PCR systems were required. Each PCR system was constructed as follows: KOD: 50μL, gDNA: 20μg, 1st PCR forward primer: 3μL, 1st PCR reverse primer: 3μL, and double distilled water was added to 100μL. The two-step PCR amplification was performed, and the PCR product was obtained after 35 cycles, and the second round of PCR amplification was performed, that is, the barcode was added to the sgRNA.

[0103] The second round of PCR amplification system was constructed as follows: KOD: 25 μL, template: the first PCR production mixture 10 μL, primers: NGS-Lib-Fwd (1-10): 1.5 μL, NGS-Lib-KO-Rev-10 (index sequence): 1.5 μL, and double distilled water was added to 100 μL. The second PCR was performed for 35 cycles. The PCR products were subjected to 1% agarose gel electrophoresis and the gel was cut to recover the size bands of 250 to 280 base pairs, and the high-throughput sequencing library was completed.

[0104] (5) In vivo screening experiment of meningeal metastasis animal model

[0105] According to the above-mentioned method for constructing the meningeal animal model, the obtained experimental group cells were transplanted into the left ventricle and monitored by fluorescent in vivo imaging after transplantation. When the mice reached the end point of death, the mouse brain was dissected to obtain cerebrospinal fluid flushing fluid, which was plated in a 12-well plate for 2 days. After the cells adhered to the wall and the fluid was changed, they were photographed, the proportion of green fluorescent protein-positive cells was analyzed by flow cytometry after cell digestion, and the tumor cells in the cerebrospinal fluid obtained by screening were sequenced. The gene information of the control group during the high-throughput sequencing library construction was compared to enrich the genes obtained by screening.

[0106] Gene knockout

[0107] sgRNA sequences targeting FUS and CD36 (sequences such as SEQ ID NO:7-8 and SEQ ID NO:5-6, respectively) were designed using CRISPick sgRNA designer (https: / / portals.broadinstitute.org / gppx / crispick / public) and CCTop-CRISPR / Cas9 target online predictor (https: / / cctop.cos.uni-heidelberg.de:8043 / index.html), synthesized by GeneScript, cloned and inserted into the lentiviral vector LentiCRISPRv2. HEK 293T cells were co-transfected with sgRNA vectors and lentiviral packaging plasmids psPAX2 and pMD2G. Supernatants containing viruses were collected at 48 and 72 hours and then filtered through a 0.45 μm filter. Cells were exposed to lentivirus overnight for transduction and allowed to recover for 24 hours. Selection was performed with 1 mg / mL puromycin.

[0108] Gene overexpression

[0109] Human FUS (CCDS10707.1) and CD36 (CCDS34673.1) cDNA sequences were synthesized in vitro, cloned and inserted into the second generation lentiviral vector pWPXLd. HEK293T cells were transfected with polyethylenimine to generate lentiviral particles (Sigma-Aldrich). Lentiviral plasmids based on pWPXLD, as well as two packaging plasmids (psPAX2 and pMD). were co-transfected into HEK 293T cells. The supernatant containing lentivirus was collected 48 and 72 hours after transduction and subsequently filtered through a 0.45 μm filter. Cells were incubated with lentivirus overnight for transduction, and then the medium containing lentivirus was replaced with fresh growth medium.

[0110] Immunohistochemistry

[0111] Mouse brain tissue and organs were fixed with formalin, and 20 μm sections were made on a freezing microtome and embedded. Paraffin-embedded sections were dewaxed and heat-fixed before antigen re-exposure and H&E staining. Alternatively, sections were incubated with rabbit anti-CD36 (1:20 00, Abcam, ab252923) and mouse anti-pan-ck (1:20 00, Abcam, ab86734) at 4°C overnight. Subsequently, sections were exposed to peroxidase-labeled antibodies at 37°C for 1 hour, and slides were subsequently stained with DAB and counterstained with hematoxylin. Photos were taken using the Tissue FAXS Plus ST system (TissueGnostics).

[0112] Proliferation assay

[0113] 1000 cells were seeded into each well of a 96-well plate and allowed to grow. For fatty acid experiments, 0.4 mM fatty acid was added to the culture medium. For inhibition experiments, the growth medium contained 2 μM rotenone or 50 μM SSO. For the growth of cancer cells in human cerebrospinal fluid, cerebrospinal fluid samples obtained from lumbar puncture of lung cancer patients were filtered through a 0.45 μm filter unit, mixed with basal medium in a 1:1 ratio, and then used as growth medium. Cell viability was assessed at 0, 24, 48, and 72 h after cell seeding using a cell counting kit-8 (CCK-8, KeyGEN) according to the manufacturer's protocol.

[0114] CSF analysis

[0115] In order to analyze the cancer cell population in the patient's cerebrospinal fluid samples, the present invention collected part of the cerebrospinal fluid from the lumbar puncture samples of patients with non-small cell lung cancer who were treated in Guangdong Provincial People's Hospital from April 19, 2022 to July 21, 2023 for further analysis, and obtained informed consent from all subjects. Take fresh cerebrospinal fluid and centrifuge it at 600g for 5 minutes. Before subsequent analysis, the supernatant was stored at -80°C and then resuspended in sterile PBS. The samples were incubated with anti-CD45-APC-CY7 (biolgend, 368516), anti-EpCAM-PE (biolgend, 369806) and anti-CD36-APC (biolgend, 336208) at 4°C for 30 minutes. After the initial incubation, the samples were washed in FBS and then resuspended in FBS with DAPI at a dilution of 1:10 00 for a second incubation. Unstained and single-color controls were used for each case. The samples were analyzed using an LSR Fortessa instrument (BD Biosciences). Free fatty acids were analyzed using a free fatty acid detection kit (BC0595, Solarbio) according to the manufacturer's instructions. Free fatty acids were quantified at 550 nm using a Synergy LX multimode microplate reader (Bio Tek).

[0116] Experimental Results

[0117] 1. Lep cells have a stronger ability to penetrate BCSFB

[0118] Meningeal metastasis represents a rare but fatal disseminated cancer with a poor prognosis, often accompanied by obvious neurological symptoms. At the same time, it is difficult to obtain meningeal tissue, and there is a lack of patient-derived meningeal metastasis samples. Currently, cerebrospinal fluid-shedding cancer cells are often used as the basis for the diagnosis and treatment of lung cancer meningeal metastasis in clinical practice. In order to overcome the problem of difficulty in obtaining meningeal metastasis tissue, the present invention learned the method of constructing a meningeal metastasis model by the MSKCC team to construct a mouse model of lung cancer meningeal metastasis.

[0119] Consistent with the results of the MSKCC research model, the present invention found that the parental cells did not show obvious tropism for meningeal metastasis, and with each subsequent round of ventricular transplantation enrichment, the cells became more adapted to the meningeal microenvironment. To determine the efficiency of in vivo selection, 20 mice were injected with parental (unselected) cells or Lep cells. At the end point, the incidence of meningeal metastasis of Lep cells increased from 20% to 22% to 70% to 80% compared with parental cells ( Figure 1 B-C). These data highlight that lep cells present a different phenotype of meningeal metastasis incidence. By adding brain vascular endothelial cells to the transwell assay, the results also showed that lep cells have a higher BCSFB penetration rate than parental cells. The choroid plexus is composed of polarized epithelial cells, which are stacked on top of each other through tight junctions. These tight junctions include BCSFB, which allow large molecules and some circulating cells to pass freely. This part of the research results suggests that these lep cells may have acquired a higher BCSFB penetration rate during the enrichment process, resulting in a higher incidence of meningeal metastasis ( Figure 1 ).

[0120] 2. FUS knockout and CD36 overexpression promote lung cancer meningeal metastasis

[0121] The meningeal and cerebrospinal fluid circulating pool microenvironment is very different from other metastatic sites. The space between the pia mater and the dura mater is filled with circulating cerebrospinal fluid (CSF) secreted by the choroid plexus. This biological fluid has a unique composition, with significantly lower levels of proteins, growth factors, and glucose compared to serum or tissue. Therefore, cancer cells that are adapted to thrive in such an environment may have a different phenotype. Phenotypic changes may arise from genetic or transcriptomic changes. Therefore, cancer cells that are adapted to thrive in such an environment may have a different phenotype. Phenotypic changes may arise from genetic or transcriptomic changes. To further explore the effects of different genes in promoting meningeal metastasis in lung cancer cell lines, we used the human genome-wide knockout library designed by Professor Zhang Feng's team at BROAD Institute (addgene, pooled libraries, Human CRISPR Knockout Pooled Library (GeCKO v2) (library A+B), modeled lung cancer cell lines based on this CRISPR / Cas9 gene knockout system, and targeted whole-gene knockout to screen genes related to lung cancer meningeal metastasis. After intraventricular injection of the whole-genome knockout library, the meningeal metastasis cell lines isolated from the cerebrospinal fluid were collected. The results showed that sgRNA targeting FUS was enriched in 4 lung cancer cell lines ( Figure 2 The ability of FUS knockout to promote the metastasis of lung cancer cells to the meninges was verified by CSF co-culture experiments, and animal model experiments showed that FUS knockout promoted the metastasis of lung cancer cells to the meninges ( Figure 3 ).

[0122] The FUS gene has been shown in previous studies to regulate lipid metabolism. In order to explore the changes in gene expression in FUS-deficient cells, the present invention performed transcriptome sequencing analysis on Lep-A549 / Lep-PC9 cells, A549 / PC9 cells, and FUS-knockout cells (sg-FUS). The results were combined and analyzed to show that the gene expression of Lep cells and sg-FUS cells at the transcriptome level had high similarity. The GSEA analysis results showed that the upregulated genes in Lep cells and sg-FUS cells were related to fatty acid transport, and their key gene CD36 was highly expressed in the sequenced cells. CD36 is a membrane protein involved in fatty acid transport. From the current results, it belongs to the downstream of FUS and regulates fatty acid transport as a starting molecule. In order to verify the key role of FUS-CD36-fatty acid metabolism axis in lung cancer meningeal metastasis, the present invention constructed a CD36 knockout cell line based on FUS knockout, and synchronously performed ventricular transplantation. The results showed that the incidence of meningeal metastasis in mice was the highest after FUS knockout cells. On this basis, knocking down the expression level of CD36 can reduce the incidence of meningeal metastasis, and the incidence of meningeal metastasis of parental cells is the lowest ( Figure 4 ). When we overexpressed CD36 in lung cancer cell lines, lung cancer cells with CD36 overexpression had a stronger ability to penetrate BCSFB, and knocking out CD36 weakened this ability. When transplanted into the left ventricle of mice, the results also showed that overexpression of CD36 promoted tumor meningeal metastasis ( Figure 5 ), while knocking out CD36 significantly inhibited tumor meningeal metastasis. The brain, spinal cord, liver, spleen, lung, kidney and other organs of the killed mice were collected and the presence of tumors was evaluated by HE staining. The results showed that mice with CD36 overexpression mainly had meningeal metastasis ( Figure 5 Middle E), mice with CD36 knockout mostly died due to extracranial organ metastasis ( Figure 5 These results suggest that the FUS-CD36-fatty acid metabolism axis plays a key regulatory role in lung cancer meningeal metastasis.

[0123] 3. Clinical validation of CD36 promoting lung cancer meningeal metastasis

[0124] In order to measure how the changes caused by fatty acid transport after FUS loss enhance the ability of lung cancer cells to metastasize to the meninges, the free fatty acid content in the cerebrospinal fluid of lung cancer patients was detected by ELISA. The test results of the present invention show that the free fatty acid content in the cerebrospinal fluid from patients with meningeal metastasis is significantly higher than that in patients without meningeal metastasis, indicating that the cerebrospinal fluid of patients with meningeal metastasis is a fatty acid-rich environment. The cerebrospinal fluid from patients with meningeal metastasis and the cerebrospinal fluid from patients with non-meningeal metastasis were co-cultured with FUS-deficient and CD36-overexpressing cells, and it was found that FUS-deficient and CD36-overexpressing cells had better survival ability in CSF from patients with meningeal metastasis. However, this proliferation advantage was not reflected in the cerebrospinal fluid from patients without meningeal metastasis. At the same time, the FUS-deficient cells were cultured in vitro with the parental cells and FUS / CD36 double-knocked cells using ordinary culture medium and CSF from patients with meningeal metastasis, which also confirmed that the changes in fatty acid metabolism mediated by FUS loss depend on the upregulation of CD36 molecules ( Figure 6 ).

[0125] In order to measure the unique advantages of FUS-CD36 for lung cancer meningeal metastasis, we transplanted parental cells and CD36-overexpressing cells into the subcutaneous part of the groin of mice at the same time. After a period of feeding and observation, the tumors grew to a certain size and were killed. The tumor pieces were weighed and compared, and it was found that the overexpression of CD36 did not promote the growth of tumors under the skin of mice. We took the brains of mice with LM, embedded them in paraffin, and sliced ​​them for immunohistochemistry. The experimental results showed that the tumor cells in the meningeal structure of mice with meningeal metastasis expressed CD36; the cerebrospinal fluid of mice with lung cancer LM was collected, and the cells in it were subjected to qPCR, Western blot and flow cytometry. The results showed that the expression level of CD36 in Lep cells was significantly higher ( Figure 6 ). Analysis of TCGA data results showed that high expression of CD36 in primary lung cancer lesions was positively correlated with poor prognosis of lung cancer patients. Single-cell transcriptome sequencing analysis of the cerebrospinal fluid of 10 lung cancer patients was performed, and the COPYCAT algorithm was used after UMAP dimensionality reduction to confirm the presence of a group of tumor cells expressing CD36 in the cerebrospinal fluid of patients with lung cancer meningeal metastasis. At the same time, in a cohort of 47 lung cancer patients, flow cytometric analysis of cerebrospinal fluid showed a significant increase in the CD36-positive tumor cell subpopulation in the cerebrospinal fluid of patients with meningeal metastasis. These results verified the correlation between CD36 and meningeal metastasis of lung cancer from the animal, cell and clinical sample levels ( Figure 6 ).

[0126] In addition, for patients with meningeal metastasis treated with intrathecal injection, we dynamically tracked 8 lung cancer patients treated with intrathecal injection and collected cerebrospinal fluid samples before intrathecal injection for flow cytometry. It was detected that the proportion of CD36-positive cells in the cerebrospinal fluid of patients with significant relief of symptoms and imaging decreased significantly. On the contrary, the proportion of CD36-positive cells in the cerebrospinal fluid of patients who did not respond to treatment or had poor efficacy increased ( Figure 7 ).

[0127] The above data confirm that FUS-CD36-fatty acid metabolism mainly affects the proliferation and growth of lung cancer cells in the brain. Targeting this axis may be an effective treatment for lung cancer meningeal metastasis, and also supports the hypothesis that CD36 is a molecular marker for lung cancer meningeal metastasis.

[0128] 4. Targeting CD36 to inhibit fatty acid transport and prolong the survival of mice with lung cancer meningeal metastasis

[0129] In view of the fact that CD36 is a membrane protein molecule, it plays an initiating role in regulating fatty acid transfer, has good intervention potential, and plays an important role in lung cancer meningeal metastasis. The present invention selects to use the small molecule inhibitor SSO (Sulfosuccinimidyl sodium oleate, sulfo-N-succinimidyl oleate) and neutralizing antibody JC63.1 (Cayman, 10009893) that targets CD36 to inhibit fatty acid transfer in the lung cancer meningeal metastasis model. According to the modeling method in the method, a mouse lung cancer meningeal metastasis model was constructed, and the small molecule inhibitor SSO (5 mg / kg) / neutralizing antibody JC63.1 (10 μg / kg mouse body weight) was administered, and the non-administered group of mice was intraperitoneally injected with an equal amount of solvent DMSO / isotype antibody.

[0130] After that, the weight and health of the two groups of mice were observed every day, and the tumor burden of the mice was monitored by bioluminescence imaging (BLI). Once the mice showed obvious central nervous system tumors, severe weight loss, and unstable gait, they were euthanized with CO2, and the survival curve of the individual was recorded as the endpoint. As expected, treatment with SSO or JC63.1 slowed down the growth of tumors in the pia mater or cerebrospinal fluid and prolonged the survival of lung cancer LM mice ( Figure 8 ). In addition, the PDX animal model constructed by collecting cells from the cerebrospinal fluid of clinical patients also verified that SSO can prolong the survival of lung cancer LM PDX mice. These results suggest that targeting the FUS-CD36-fatty acid metabolism axis can inhibit lung cancer meningeal metastasis, and fatty acid transport represented by CD36 has the potential to serve as a molecular marker and therapeutic target for lung cancer meningeal metastasis.

[0131] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. The use of CD36 inhibitors in the preparation of products for preventing and treating lung cancer meningeal metastasis or for the preparation of products for reducing the ability of lung cancer cells to penetrate the blood-cerebrospinal fluid barrier; The CD36 inhibitor is at least one of a1) to a5): a1) an sgRNA targeting CD36, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 5 or SEQ ID NO: 6; a2) a nucleic acid molecule encoding the sgRNA targeting CD36 described in a1); a3) an expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in a2); a4) a small molecule drug targeting CD36, wherein the small molecule drug is sulfo-N-succinimidyl oleate; a5) CD36 inhibitory polypeptide JC63.1 that blocks CD36 protein and / or CD36 protein intermediates.

2. The use according to claim 1, characterized in that: The lung cancer meningeal metastasis includes lung cancer pia mater metastasis and lung cancer dura mater metastasis.

3. A sgRNA, the nucleotide sequence of which is shown in SEQ ID NO: 5 or SEQ ID NO:

6.

4. A product comprising a CD36 inhibitor targeting tumor cell CD36, wherein the CD36 inhibitor comprises the sgRNA according to claim 3.

5. Use of the sgRNA according to claim 3 or the product according to claim 4 in the preparation of a drug for treating cancer, wherein the cancer is meningeal metastasis of lung cancer.

Images