An Omcorda strain HBF12 and its application

By soaking citrus fruits in Omicotta strain HBF12, the problems of drug resistance and environmental pollution in postharvest citrus diseases have been solved, and effective prevention of sour rot and green mold has been achieved, providing a safe and environmentally friendly method for disease control.

CN118703340BActive Publication Date: 2026-01-30HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411068452.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-05
Publication Date
2026-01-30
Estimated Expiration
2044-08-05

AI Technical Summary

Technical Problem

Existing chemical fungicides have problems with resistance in the control of postharvest diseases of citrus, and fungicide residues on fruit peels and environmental pollution are serious. There is a lack of effective solutions for green fungicides.

Method used

Omekoda strain HBF12 and its inoculant were used to inhibit citrus pathogens, especially sour rot fungi and green mold fungi, by soaking and storing citrus fruits.

Benefits of technology

It significantly inhibits citrus acid rot and green mold, with a preventive effect of over 62.50%, providing a safe and environmentally friendly means of disease control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703340B_ABST
    Figure CN118703340B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial technology, specifically relating to an Kodamaea strain HBF12 and its applications. The Kodamaea strain HBF12 provided by this invention is deposited at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC M 20241462. Verification through examples shows that this strain has significant inhibitory effects on *Geotrichum citri-aurantii* and *Penicillium digitatum*, and exhibits good preventative effects against postharvest diseases of citrus, particularly sour rot and green mold. Strain HBF12 demonstrates good biocontrol potential, providing a new resource for the safe control of postharvest diseases of citrus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to an Omcorda strain HBF12 and its applications. Background Technology

[0002] Citrus sour rot ( Oospora citriaurantii ex Persoon ) and citrus green mold ( Penicillium italicum Wehmer Postharvest rot (PRO) is a typical citrus disease. Its pathogens can infect all citrus varieties to varying degrees, causing not only huge economic losses but also potential environmental pollution. Chemical fungicides are a commonly used method for postharvest storage and preservation of citrus fruits in actual production. Currently, commonly used postharvest fungicides for citrus include imazalil, cyprodinil, and propiconazole. However, some citrus postharvest processing plants use these agents improperly, leading to varying degrees of resistance in pathogens in citrus-producing areas to these agents (e.g., "Indoor Toxicity Determination of Biguanide against Major Citrus-Producing Areas' Acid Rot Bacteria," Wang Zhen, [Master's Thesis], Wuhan: Huazhong Agricultural University, 2019). The residue of fungicides on citrus fruit peels and environmental pollution also restrict their further development. Exploring green fungicides is currently a safer and more environmentally friendly approach. Summary of the Invention

[0003] The purpose of this invention is to provide an Omnikol strain HBF12 that can effectively prevent postharvest diseases of citrus and enrich the microbial resources for preventing postharvest diseases of citrus.

[0004] This invention provides an Omcorda strain ( Kodamaea ohmeri HBF12, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 20241462.

[0005] The present invention also provides a microbial agent comprising the Omcoda strain HBF12 described in the above technical solution.

[0006] Preferably, the concentration of Omcorda strain HBF12 in the bacterial agent is 1×10⁻⁶. 7 ~1×10 9 per mL.

[0007] The present invention also provides the application of the Omrokoda strain HBF12 or its metabolites or the bacterial agent described in the above technical solutions in inhibiting citrus pathogens.

[0008] Preferably, the citrus pathogens include sour rot fungi and / or green mold fungi.

[0009] Preferably, the acid rot pathogen includes Geotrichum candida (citrus white mold). Geotrichum citri-aurantii The green mold pathogens include Penicillium fingernail ( ); Penicillium digitatum ).

[0010] The present invention also provides the application of the Omcoda strain HBF12 described in the above technical solution or the inoculant described in the above technical solution in the prevention of postharvest diseases of citrus.

[0011] Preferably, the postharvest diseases of citrus include one or more of the following: Penicillium rot, Green mold, Sour rot, and Stem rot.

[0012] The present invention also provides a method for preventing postharvest diseases of citrus, comprising the following steps:

[0013] After harvesting, the citrus fruits are soaked in the microbial agent described in the above technical solution, and then stored.

[0014] Preferably, the soaking time is 1 to 2 minutes.

[0015] Beneficial effects:

[0016] This invention provides an Omcorda strain ( Kodamaea ohmeri HBF12, deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20241462. Verification through examples has shown that this strain is effective against *Hydrocotyle vulgaris* (a pathogen that causes acid rot). Geotrichum citri-aurantii ) and Penicillium finger ( Penicillium digitatum It has a significant inhibitory effect and a good preventive effect on postharvest diseases of citrus, especially citrus sour rot and green mold. The strain HBF12 has good biocontrol potential and provides a new resource for the safe control of postharvest diseases of citrus.

[0017] The method for preventing postharvest diseases of citrus provided by this invention includes soaking the fruit in an inoculant of strain HBF12 and then storing it in bags. Verification through examples shows that when citrus fruit is stored for 6 weeks after harvest using the method provided by this invention, strain HBF12 achieves a control efficacy of 62.50% against storage-related diseases of Newhall navel oranges.

[0018] Biological Preservation Information

[0019] Omicoda strain HBF12, biologically classified as Kodamaea ohmeri It was deposited on July 3, 2024, at the China Center for Type Culture Collection, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, with accession number CCTCC NO: M20241462. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0021] Figure 1 Morphological characteristics of strain HBF12;

[0022] Figure 2 This is a phylogenetic tree of strain HBF12;

[0023] Figure 3 The growth curve of strain HBF12 over 16 h;

[0024] Figure 4 The growth curve of strain HBF12 over 36 h;

[0025] Figure 5 The number of strain HBF12 on the surface of citrus fruits;

[0026] Figure 6 The image shows the inhibitory effect of strain HBF12 on citrus acid rot fungus and Penicillium fingernail.

[0027] Figure 7 The diameters of Z-1 and N-1 colonies in Example 2 (plates facing each other);

[0028] Figure 8 The inhibition rate of strain HBF12 against citrus acid rot pathogens and Penicillium fingernail was measured.

[0029] Figure 9 The diagram shows the inhibitory effect of volatile substances produced by strain HBF12 on postharvest pathogens of citrus.

[0030] Figure 10 The diameters of Z-1 and N-1 colonies in Example 2 (gas confrontation);

[0031] Figure 11 The inhibition rate of volatile substances produced by strain HBF12 against postharvest pathogens of citrus;

[0032] Figure 12 The images show the effects of inoculating Newhall navel oranges with HBF12 bacterial suspension for 3 days and 6 days in Example 3.

[0033] Figure 13 The incidence of sour rot in Newhall navel oranges after 3 and 6 days of inoculation with HBF12 bacterial suspension in Example 3;

[0034] Figure 14 The diameters of lesions in Newhall navel oranges in Example 3 after inoculation with HBF12 bacterial suspension for 3 days and 6 days;

[0035] Figure 15 The effect of inoculating Newhall navel oranges with HBF12 bacterial suspension for 3 days and 6 days in Example 3 on the prevention of sour rot;

[0036] Figure 16 This is a diagram showing the effect of inoculating Wenzhou mandarin oranges with HBF12 bacterial solution for 3 days in Example 4;

[0037] Figure 17 The incidence of sour rot in Wenzhou mandarins 3 days after inoculation with HBF12 bacterial solution in Example 4;

[0038] Figure 18 The diameter of the lesion in Wenzhou mandarin oranges 3 days after inoculation with HBF12 bacterial solution in Example 4;

[0039] Figure 19 The effect of inoculating Wenzhou mandarin oranges with HBF12 bacterial solution for 3 days on the prevention of sour rot in Example 4;

[0040] Figure 20 This is a diagram showing the effect of inoculating Wenzhou mandarin oranges with HBF12 bacterial solution for 3 days in Example 5;

[0041] Figure 21 The incidence of sour rot in Wenzhou mandarins 3 days after inoculation with HBF12 bacterial solution in Example 5;

[0042] Figure 22 The diameter of the lesion in Wenzhou mandarin oranges 3 days after inoculation with HBF12 bacterial solution in Example 5;

[0043] Figure 23 The effect of inoculating Wenzhou mandarin oranges with HBF12 bacterial solution for 3 days on the prevention of sour rot in Example 5;

[0044] Figure 24 This is a diagram showing the effect of inoculating Newhall navel oranges with HBF12 bacterial culture for 3 days in Example 6;

[0045] Figure 25 The diameter of the lesion in Newhall navel oranges in Example 6 after 3 days of inoculation with HBF12 bacterial suspension;

[0046] Figure 26 The effect of inoculating Newhall navel oranges with HBF12 bacterial suspension for 3 days on the prevention of green mold in Example 6;

[0047] Figure 27 This is a diagram showing the effect of inoculating Wenzhou mandarin oranges with HBF12 bacterial solution for 3 days in Example 7;

[0048] Figure 28 The incidence of green mold in Wenzhou mandarins 3 days after inoculation with HBF12 bacterial solution in Example 7;

[0049] Figure 29 The diameter of the lesion in Wenzhou mandarin oranges 3 days after inoculation with HBF12 bacterial solution in Example 7;

[0050] Figure 30 The preventive effect of HBF12 bacterial suspension on green mold in Wenzhou mandarins 3 days after inoculation in Example 7;

[0051] Figure 31This is a diagram showing the effect of inoculating Wenzhou mandarin oranges with HBF12 bacterial solution for 3 days in Example 8;

[0052] Figure 32 The incidence of green mold in Wenzhou mandarins 3 days after inoculation with HBF12 bacterial solution in Example 8;

[0053] Figure 33 The diameter of the lesion in Wenzhou mandarin oranges 3 days after inoculation with HBF12 bacterial solution in Example 8;

[0054] Figure 34 The preventive effect of HBF12 bacterial suspension on green mold in Wenzhou mandarins 3 days after inoculation in Example 8;

[0055] Figure 35 The cumulative incidence of diseases in Newhall navel oranges during 6 weeks of postharvest storage;

[0056] Figure 36 The incidence rates of different diseases in Newhall navel oranges after 6 weeks of postharvest storage. Detailed Implementation

[0057] This invention provides an Omcorda strain ( Kodamaea ohmeri HBF12, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 20241462.

[0058] The present invention also provides a microbial agent comprising the Omcoda strain HBF12 described in the above technical solution.

[0059] In this invention, the concentration of the bacterial agent is preferably 1×10⁻⁶. 9 ~1×10 7 Cells / mL, more preferably 1×10⁻⁶ 9 The bacterial agent is preferably prepared by culturing HBF12 strain in YPD liquid medium and adjusting the bacterial concentration to 1×10⁻⁶ / mL. 9 ~1×10 7 The bacterial culture conditions are preferably 27-29℃, 130-160 rpm, more preferably 28℃, 140 rpm. The culture time is preferably 20-26 h, more preferably 24 h; the bacterial concentration is preferably adjusted using YPD medium.

[0060] This invention isolates an Omnikol strain HBF12 from the flowers of Wenzhou mandarin oranges, which has the effect of preventing postharvest diseases of citrus.

[0061] In view of the advantages of the Omekorda strain HBF12 provided by the present invention, the present invention also provides the application of the Omekorda strain HBF12 or the bacterial agent described in the above technical solution in inhibiting citrus pathogens.

[0062] In this invention, the citrus pathogens preferably include *Geotrichum candida* and / or *Geotrichum gloeosporioides*; the *Geotrichum candida* is preferably *Geotrichum gloeosporioides*. Geotrichum citri-aurantii The preferred green mold pathogen is *Penicillium fingernail* (…). Penicillium digitatum ).

[0063] The present invention also provides the application of the Omnikorda strain HBF12 or its metabolites or the inoculant described in the above technical solutions in the prevention of postharvest diseases of citrus.

[0064] In this invention, the postharvest diseases of citrus fruits preferably include one or more of Penicillium rot, green mold, sour rot and stem rot, more preferably green mold and sour rot; the citrus fruits preferably include Newhall navel oranges and / or Wenzhou mandarins.

[0065] The present invention also provides a method for preventing postharvest diseases of citrus, comprising the following steps:

[0066] After harvesting, the citrus fruits are soaked in the microbial agent described in the above technical solution, and then stored.

[0067] In this invention, the soaking time is preferably 1-2 minutes, more preferably 1 minute; the soaking temperature is preferably room temperature; before storage, the fruit surface is preferably dried; the storage is preferably bagged; the bagging method is preferably single-fruit bagging; the bagging storage conditions are preferably room temperature ventilation; the bag is preferably a disposable HDPE preservation bag. This invention uses bagging to store the fruit, avoiding moisture loss and preventing diseased fruit from infecting other healthy fruits through contact.

[0068] To further illustrate the present invention, the following detailed description of an Omco strain HBF12 and its applications, in conjunction with the accompanying drawings and embodiments, is provided but should not be construed as limiting the scope of protection of the present invention.

[0069] In this embodiment of the invention, the significant differences in the data were determined by a t-test. "This indicates that multiple comparisons were performed between the treatments." P Significant difference at the <0.1 level, "This indicates that multiple comparisons were performed between the treatments." P Significant difference at the <0.05 level, "This indicates that multiple comparisons were performed between the treatments." P Significant difference at the <0.01 level, "This indicates that multiple comparisons were performed between the treatments." P Significant difference at the 0.0001 level, ns represents no significant difference among treatments after multiple comparisons.

[0070] Example 1

[0071] 1. Isolation of strain HBF12

[0072] Ten flowers of Wenzhou mandarin oranges were collected from Wuhan, Hubei Province and ground in a sterile mortar. The mixture was transferred to a sterile 50 mL centrifuge tube and added to YPD liquid medium containing 100 mg / mL cephalosporin (1 wt.% yeast extract, 2 wt.% peptone, 2 wt.% glucose, and distilled water to a final volume of 1 L, autoclaved at 121℃ for 20 min). The medium was incubated at 28℃ with shaking at 150 rpm for 30 min. 0 10 -1 and 10 -2 Three gradients were prepared, with 100 μL of each culture spread onto YPDA medium (1 wt.% yeast extract, 2 wt.% peptone, 2 wt.% glucose, 1.5 wt.% agar, diluted to 1 L with distilled water, autoclaved at 121℃ for 20 min), with three replicates per group. The cultures were incubated at 28℃ for 48 h. The colonies were then streaked to purify the culture, yielding strain HBF12.

[0073] 2. Identification of strain HBF12

[0074] Strawberry strain HBF12 was streaked on YPDA medium at 28 °C for 24 h. Figure 1 As shown.

[0075] Depend on Figure 1 The colony morphology of strain HBF12 can be obtained: the colonies are round, slightly yellow, opaque, smooth, and have neat edges. However, if the slant culture time is too long, the edges will become wrinkled and the cells will be round.

[0076] DNA extraction from the strain: Add 700 μL of YPD liquid medium to a sterile 2 mL centrifuge tube, pick out a single colony with a sterile toothpick and place it in the centrifuge tube. Incubate at 28℃ and 150 rpm for 24 h until the YPD liquid medium becomes turbid. After centrifuging at 12000 rpm for 1 min, remove the supernatant and add 2 small steel beads to each centrifuge tube. Extract yeast DNA using the 2% CTAB method. The specific steps are as follows: (1) Preheat the 2% CTAB buffer in a 65℃ water bath; (2) Add 900 μL of 2% CTAB to each centrifuge tube and shake. (2) Incubate at 65℃ for 15 min, and remove and invert every 5 min to mix; (3) Add 450 μL of chloroform and 450 μL of Tris saturated phenol, and gently invert to mix; (4) Centrifuge at 12000 rpm for 10 min at room temperature; (5) Take about 700 μL of supernatant, transfer to a new 1.5 mL EP tube, add an equal volume of chloroform, invert to mix, and centrifuge at 12000 rpm for 10 min; (6) Take about 600 μL of supernatant, add an equal volume of isopropanol, mix, and precipitate at -20℃ for 30 min; (7) Centrifuge at 12000 rpm for 10 min at room temperature, discard the supernatant, wash the precipitate twice with 75% ethanol, centrifuge at 12000 rpm for 1 min, aspirate the remaining liquid with a pipette, and dry in a 37℃ oven for about 10 min; (8) Dissolve the DNA in 15 ng / mL RNase water. The extracted DNA was analyzed for concentration and quality using a spectrophotometer (NanoDrop2000, Themo, USA) and gel electrophoresis, and stored at -20°C.

[0077] ITS fragment PCR amplification: The ITS fragment of the fungal strain was amplified using the universal fungal primers ITS1 / ITS4 (White TJ, Bruns T, Lee S, Taylor JW, Shawetaylor J. Amplification and direct sequencing of fungalribosomal RNA genes for phylogenetics. In Gelfand DH, Sninsky JJ, White TJeds, PCR protocols: a guide to methods and applications. Innis MA. Academic: New York. 1990. 315-322).

[0078] ITS1: 5'-CTTGGTCATTTTAGAGGAAGTAA-3' (SEQ ID No. 1);

[0079] ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID No. 2).

[0080] The PCR reaction system was 25 μL, specifically: 12.5 μL Mix, 0.5 μL 0.38 μmol / L ITS1, 0.5 μL 0.51 μmol / L ITS4, 1 μL DNA template, and ddH2O to bring the total volume to 25 μL.

[0081] The PCR reaction procedure was as follows: (1) 95℃ pre-denaturation for 5 min; (2) 95℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 30 s, repeated 32 times; (3) 72℃ extension for 5 min; (4) 16℃ storage for 2 min. After the reaction was completed, the PCR product was detected by 1% agarose gel electrophoresis. After a single and clear band was detected, the PCR product was sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The obtained sequences were compared with BLAST in the NCBI database, and a phylogenetic tree was constructed using the maximum likelihood method (mL). The phylogenetic analysis of the strain was performed. The sequence information used is shown in Table 1.

[0082] Table 1. Sequences used for phylogenetic analysis of HBF12 strains in this study.

[0083]

[0084] Depend on Figure 2 It can be seen that the ITS sequence of the HBF12 strain is specifically: 5'-GCTGCTATATTCTTAAACTGTTTTTTTACAACAAAACAAACATATCTAATCTATAAATCTACGTTTTAAAATTCTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATACGAATCGCAGCTCTCGGAATCATCGAATCTTTGA ACGCACATTGCACCATTGGGTATTCCCAATGGTATGCTTGTTTGAGCGAATACTTCCCTAATCCTCACGGATTGTATTGTGTTTGCACGAAAATAATGACGACAGTACTCTACAAAACGGTACCGTCAGTACGCTCATTTTTTTTTCCTCAAATCAAGTAGGACTACCCGCTGAACTTAAGCATATCTAAAGGGG-3' (SEQ ID No.3); and Kodamaea ohmeri The ITS sequence similarity of 134 is 99%.

[0085] Combination Figure 1 The HBF12 strain was identified as Omniknightia yeast. Kodamaea ohmeri It was named Omkoda yeast. Kodamaea ohmeri HBF12 was deposited at the China Center for Type Culture Collection on July 3, 2024, with accession number CCTCC NO: M 20241462.

[0086] 3. Growth curve of strain HBF12

[0087] The HBF12 bacterial culture was divided into two groups, each incubated in an Erlenmeyer flask containing 100 mL of YPD liquid medium at 28°C and 150 rpm. The OD value of the first group was recorded at 600 nm every 2 hours; the OD value of the second group was recorded at 600 nm every 12 hours. Both groups were incubated until the OD value remained constant to record the dynamic growth curve of strain HBF12. The results are shown below. Figure 3 and Figure 4 As shown.

[0088] Depend on Figure 3 It can be seen that the OD value of the first group of strains HBF12 remained basically unchanged after 12 h, with a final concentration of 1.25 × 10⁻⁶. 9 cells / mL; by Figure 4 It can be seen that the OD value of the second group of strains, HBF12, reached its highest value at 12 h, at which point the final concentration of strain HBF12 was approximately 1.15 × 10⁻⁶. 9 The number of colonies remained basically unchanged at 12 h. After continued shaking culture, strain HBF12 stopped growing. Figure 3 and Figure 4 The results showed that strain HBF12 reproduced rapidly and in large quantities under sufficient nutrient conditions, reaching a plateau phase after 12 hours.

[0089] 4. Colonization of strain HBF12 on the surface of citrus fruits

[0090] Strain HBF12 was cultured in YPD medium at 28°C and 150 rpm for 24 h with shaking, and the concentration was adjusted to 1×10⁻⁶ with YPD medium. 9 per mL.

[0091] Disinfect the surface of Wenzhou mandarin oranges with a 1:50 diluted solution of commercially available 84 disinfectant, then rinse three times with distilled water. (The last part, "1×10," appears to be an unrelated instruction and has been omitted from the translation.) 9After soaking in HBF12 bacterial suspension at a concentration of 1 / mL for 1 min, the fruit was air-dried. On days 1, 3, 5, and 7 after soaking, 0.5 cm × 0.5 cm pieces of citrus peel were collected and transferred to 2 mL centrifuge tubes. Each sampling was performed in triplicate, and each replicate was processed as follows:

[0092] Add 1 mL of sterile water, incubate at 28°C and 150 rpm for 5 min, then sonicate for 30 s and dilute 10-fold. Spread 100 μL onto YPDA solid medium. Incubate at 28°C for 24 h, then count the yeast colonies and logarithmize the count to assess the colony-growth ability of the strain on citrus peel. Results are as follows. Figure 5 As shown.

[0093] Depend on Figure 5 It can be seen that the lgCFU value of HBF12 remained basically consistent on the 1st, 3rd, 5th and 7th days after fruit soaking, indicating that strain HBF12 can survive stably on the surface of citrus within one week.

[0094] Example 2

[0095] 1. Antagonistic effect of strain HBF12 against pathogens of postharvest sour rot and green mold in citrus.

[0096] In this embodiment of the invention, acid rot bacteria are used. Geotrichum citri-aurantii and Penicillium finger Penicillium digitatum To verify the antagonistic effect of strain HBF12 on the pathogens of postharvest sour rot and green mold of citrus, for ease of reference, in this embodiment of the invention, they are respectively referred to as sour rot pathogen strain Z-1 and Penicillium fingernail strain N-1.

[0097] Strain Z-1 of the acid rot pathogen and strain N-1 of Penicillium fingerlings were cultured on PDA (200 g of peeled potatoes boiled for 10 min, the filtrate was mixed with 15 g of agar powder and 20 g of glucose, and distilled water was added to a final volume of 1 L, followed by autoclaving at 121℃ for 20 min) at 28℃ for 7 days. They were then divided into treatment and control groups and treated as follows:

[0098] Treatment group: Take a 3 mm diameter circular mycelial disc from the edge of the colony and inoculate it onto a PDA. Mark two points on the plate, 1.5 cm inward from the edge of the plate. Pick a single colony of strain HBF12 and streak it at the two marked points with a width of 5 mm.

[0099] Control group: Take a 3 mm diameter circular mycelial cake from the edge of the colony and inoculate it onto the PDA.

[0100] Each group was set up with three replicates. After incubation at 28℃ for 6 days, the colony diameters of the treated and control strains were recorded and the inhibition rates were calculated. The results are as follows: Figure 6 , Figure 7 and Figure 8 As shown, where Figure 6 The upper left shows the plate of the control group of Acid Rot Bacterium strain Z-1, and the lower left shows the plate of the treatment group of Acid Rot Bacterium strain Z-1. Figure 6 The upper right corner shows the plate of the control group of Penicillium digitatum strain N-1, and the lower right corner shows the plate of the treatment group of Penicillium digitatum strain N-1.

[0101] Inhibition rate = (Treatment group colony diameter / Control group colony diameter) × 100%.

[0102] Depend on Figure 6 , Figure 7 and Figure 8 It can be seen that strain HBF12 has a certain inhibitory effect on the mycelial growth of citrus sour rot fungus and Penicillium fingernail, with inhibition rates of 40.98% and 31.79%, respectively.

[0103] 2. Inhibitory effect of volatile substances produced by strain HBF12 on pathogens of postharvest sour rot and green mold in citrus.

[0104] The acid rot pathogen strain Z-1 and the fingerling Penicillium strain N-1 were cultured on a PDA at 28°C for 7 days, and then divided into Z-1 treatment group, Z-1 control group, N-1 treatment group, and N-1 control group, and treated as follows:

[0105] Z-1 treatment group: A circular mycelial disc of the acid rot pathogen Z-1, with a diameter of 3 mm, was taken from the hyphal tip and inoculated onto the outermost side of a septate plate. On the other side, 100 μL of 1×10⁻⁶ solution was aspirated. 8 The HBF12 bacterial solution was coated.

[0106] Z-1 control group: A circular mycelial cake of the acid rot pathogen strain Z-1 with a diameter of 3 mm was taken from the tip of the hyphae and inoculated on the outermost side of a plate with a partition, while the other side was not coated with HBF12 bacterial solution.

[0107] N-1 treatment group: A circular mycelial disc of the acid rot pathogen Z-1, with a diameter of 3 mm, was inoculated onto the outermost side of a septate plate. On the other side, 100 μL of 1×10⁻⁶ solution was aspirated. 8 The HBF12 bacterial solution was coated.

[0108] N-1 control group: Take a circular mycelial cake of the acid rot pathogen strain Z-1 with a diameter of 3 mm at the tip of the mycelium and inoculate it on the outermost side of a plate with a partition, and do not coat the other side with HBF12 bacterial solution.

[0109] Each group was set up with three replicates. After incubation at 28℃ for 4 days, the colony diameter was recorded and the inhibition rate was calculated. The results are as follows: Figures 9-11 As shown, where Figure 9The upper left represents the Z-1 control group plate, and the lower left represents the Z-1 treatment group plate; the upper right represents the N-1 control group plate, and the lower right represents the N-1 treatment group plate.

[0110] Inhibition rate = (Treatment group colony diameter / Control group colony diameter) × 100%.

[0111] Depend on Figures 9-11 The results showed that the volatile substances produced by strain HBF12 inhibited the mycelial growth of strains Z-1 and N-1 by 3.07% and 44.54%, respectively. This indicates that the volatile substances produced by strain HBF12 have no inhibitory effect on citrus sour rot fungus, but have a good inhibitory effect on Penicillium fingering.

[0112] Example 3

[0113] Strain HBF12 for the prevention of sour rot in Newhall navel oranges

[0114] The acid rot pathogen strain Z-1 was cultured on PDA medium at 28℃ for 7 days; 5 mL of sterile distilled water was applied to the surface of the Z-1 colonies to wash off conidia, and the concentration was adjusted to 1×10⁻⁶. 6 per mL.

[0115] Strains HBF12 were cultured in YPD medium at 28°C and 150 rpm for 24 h with shaking. The concentration was then adjusted to 1×10⁻⁶ using YPD medium. 8 per mL.

[0116] Disinfect the surface of Newhall navel oranges with a 1:50 diluted commercially available 84 disinfectant for 2-3 minutes, then rinse with distilled water. Make three 3 mm deep wounds on the equatorial side of the oranges. The oranges are then divided into a control group (Z-1) and a treatment group (Z-1+HBF12), with 10 oranges per group as replicates. Treatment is performed as follows:

[0117] Treatment group: 10 μL of 1×10 8 Inoculate the wound with 10 μL of HBF12 bacterial suspension at a concentration of 1 × 10⁶ cells / mL, and then inoculate with 1 × 10⁶ cells / mL of the bacterial suspension 2 h later. 6 Inoculate the wound with strain Z-1 spores at a concentration of 1 spores / mL.

[0118] Control group: 10 μL of 1×10 6 Inoculate the wound with strain Z-1 spores at a concentration of 1 spores / mL.

[0119] The oranges were cultured at 25℃ with humidity, and the surface was treated with double-distilled water every 24 hours. The incidence of sour rot was observed 3 days and 6 days after inoculation. The appearance of lesions was recorded as the onset of disease. The incidence rate, lesion diameter, and preventative effect were statistically analyzed. Results are as follows: Figures 12-15 As shown, where " "Indicates that multiple comparisons were performed between the treatments" P Significant difference at the <0.0001 level.

[0120] Prevention effect = (diameter of control lesion - diameter of treated lesion) / diameter of control lesion × 100%.

[0121] This invention statistically analyzes and calculates the average diameter of citrus lesions in all control groups. The difference between the average diameter of the control group and the lesion diameter of each treatment group is then divided by the average diameter of the control group to calculate the preventative effect. Figures 12-15 It was found that 3 days after inoculation, the disease incidence rate of citrus in the control group was 100%, while that in the treatment group was 0%, indicating that the preventive effect of HBF12 was 100%. 6 days after inoculation, the disease incidence rate in the treatment group was 62.5%, and the lesion diameter was significantly smaller than that in the control group. Calculations showed that the preventive effect of HBF12 was 80.57%. This indicates that strain HBF12 has a good preventive effect against sour rot in Newhall navel oranges.

[0122] Example 4

[0123] Prevention of sour rot in Wenzhou mandarin oranges with different concentrations of HBF12 bacterial solution

[0124] After surface disinfecting the Wenzhou mandarin oranges with a 1:50 diluted solution of commercially available 84 disinfectant, they were rinsed with distilled water. Three 3 mm deep wounds were then inserted into the equatorial side of the oranges. The oranges were then divided into a control group and three treatment groups, and the following treatments were performed:

[0125] Group 1 (1×10) 7 The inoculation concentration at the wound site on its equatorial surface was 10 μL (1×10⁻⁶). 7 HBF12 bacterial suspension (number of cells / mL), air-dried, then inoculated with 10 μL of 1×10⁻⁶ cells / mL. 6 spores / mL of acid-rot bacteria strain Z-1;

[0126] Group 2 (1×10) 8 The inoculation concentration at the wound site on its equatorial surface was 10 μL (1×10⁻⁶). 8 HBF12 bacterial suspension (number of cells / mL), air-dried, then inoculated with 10 μL of 1×10⁻⁶ cells / mL. 6 spores / mL of acid-rot bacteria strain Z-1;

[0127] Group 3 (1×10) 9 The inoculation concentration at the wound site on its equatorial surface was 10 μL (1×10⁻⁶). 9 HBF12 bacterial suspension at a concentration of / mL cells / mL was dried and then inoculated with 10 μL of 1×10⁻⁶ cells / mL. 6spores / mL of acid-rot bacteria strain Z-1;

[0128] Control group (Z-1): 10 μL of 1×10⁻⁶ cells was inoculated at the equatorial wound site. 6 spores / mL of acid-rot bacteria strain Z-1;

[0129] The oranges were cultured at 25℃ with a moist environment. The surface of the oranges was treated with double-distilled water every 24 hours to maintain moisture. Disease incidence was recorded 3 days after inoculation. The incidence rate, lesion diameter, and preventative effect were statistically analyzed. Results are as follows: Figures 16-19 As shown, " "This indicates that multiple comparisons were performed between the treatments." P <0.1 level significant difference, "This indicates that multiple comparisons were performed between the treatments." P <0.05 indicates a significant difference, and ns represents no significant difference among treatments after multiple comparisons.

[0130] Prevention effect = (diameter of control lesion - diameter of treated lesion) / diameter of control lesion × 100%.

[0131] Depend on Figures 16-19 It was found that 3 days after inoculation, the disease incidence rates of citrus in the first, second, and third groups were 87.5%, 50.0%, and 37.5%, respectively, with preventive effects of 28.40%, 66.61%, and 73.89%, respectively. This indicates that strain HBF12 has a good preventive effect against sour rot in Satsuma mandarins, and the HBF12 bacterial concentration of 1×10⁻⁶ is effective. 8 / cells / mL and 1×10 9 At a concentration of cells / mL, there was no significant difference in preventative efficacy.

[0132] Example 5

[0133] Fruit dipping with strain HBF12 for the prevention of sour rot in Satsuma mandarins

[0134] After surface disinfecting the Wenzhou mandarins with a 1:50 diluted commercially available 84 disinfectant, they were rinsed thoroughly with distilled water. Three 3 mm deep wounds were then inserted into the equatorial surface of each mandarin orange. The oranges were divided into a control group (Z-1) and a treatment group (Z-1+HBF12), with 10 mandarin oranges per group as replicates. The treatment was carried out as follows:

[0135] Treatment group: using 1×10 9 Soak the cells in HBF12 bacterial suspension for 1 min, air dry, and then inoculate 10 μL of 1×10⁶ cells / mL at the wound site on the equatorial side. 6 spores / mL of the acid rot fungus strain Z-1;

[0136] Control group: 10 μL of 1×10⁻⁶ cells was inoculated at the equatorial wound site.6 spores / mL of the acid rot fungus strain Z-1;

[0137] The oranges were cultured at 25℃ with a moist environment, and the surface was treated with double-distilled water every 24 hours. Disease incidence was recorded 3 days after inoculation. Results are as follows: Figures 20-23 As shown.

[0138] Depend on Figures 20-23 It can be seen that the incidence rate of citrus in the control group was 100%, while that in the treatment group was 25%. The HBF12 strain showed a preventive effect of 85.74% against sour rot, indicating that the HBF12 strain has a good preventive effect against sour rot in Wenzhou mandarin oranges.

[0139] Example 6

[0140] Strain HBF12 for the prevention of green mold in Newhall navel oranges

[0141] Green mold strain N-1 was cultured on PDA medium at 28℃ for 7 days; 5 mL of sterile distilled water was applied to the surface of the N-1 colonies to wash off conidia, and the concentration was adjusted to 1×10⁻⁶. 5 / mL.

[0142] The Newhall navel oranges were disinfected with a 1:50 diluted commercially available 84 disinfectant solution, rinsed thoroughly with distilled water, and three 3 mm deep wounds were made on their equatorial side. They were then divided into a control group (N-1) and a treatment group (HBF12), with 10 oranges per group as replicates. Treatment was performed as follows:

[0143] Treatment group: 10 μL of 1×10⁻⁶ phosphate was first inoculated at the wound site on the equatorial surface. 8 After drying, inoculate 10 μL of HBF12 bacterial suspension (1×10⁶ cells / mL) with 1×10⁶ cells / mL. 5 spores / mL of Penicillium finger spores;

[0144] CK group: 10 μL of 1×10⁻⁶ cells was injected into the wound on the equatorial surface. 5 spores / mL of Penicillium finger spores;

[0145] The oranges were cultured at 25℃ with a moist environment, and the surface was treated with double-distilled water every 24 hours. Disease incidence was recorded 3 days after inoculation, and the incidence rate, lesion diameter, and preventative effect were statistically analyzed. Results are as follows: Figures 24-26 As shown.

[0146] Prevention effect = (diameter of control lesion - diameter of treated lesion) / diameter of control lesion × 100%.

[0147] Depend on Figures 24-26It was found that 3 days after inoculation, the incidence rate of citrus in both the treatment and control groups was 100%, and the preventive effect of HBF12 was 56.56%. This indicates that strain HBF12 has a certain preventive effect against green mold in Newhall navel oranges.

[0148] Example 7

[0149] Prevention of Green Mold Disease in Wenzhou Tangerines with Different Concentrations of HBF12 Bacterial Solution

[0150] After disinfecting the surface of Wenzhou mandarin oranges with a 1:50 diluted solution of commercially available 84 disinfectant, they were rinsed with distilled water. Then, three 3 mm deep wounds were inserted into the equatorial surface of the oranges. The oranges were then divided into a control group and three treatment groups, and were treated as follows:

[0151] Group 1 (1×10) 7 ): Inoculate 10 μL (1×10) at the wound site on its equatorial surface. 7 HBF12 bacterial suspension (1 × 10⁶ cells / mL) was dried and then inoculated with 10 μL of 1 × 10⁶ cells / mL. 5 / mL of Penicillium finger spores;

[0152] Group 2 (1×10) 8 ): Inoculate 10 μL (1×10) at the wound site on its equatorial surface. 8 HBF12 bacterial suspension (1 × 10⁶ cells / mL) was dried and then inoculated with 10 μL of 1 × 10⁶ cells / mL. 5 / mL of Penicillium finger spores;

[0153] Group 3 (1×10) 9 ): Inoculate 10 μL (1×10) at the wound site on its equatorial surface. 9 HBF12 bacterial suspension (1 × 10⁶ cells / mL) was dried and then inoculated with 10 μL of 1 × 10⁶ cells / mL. 5 / mL of Penicillium finger spores;

[0154] Control group (N-1): 10 μL of 1×10⁻⁶ cells was inoculated at the equatorial wound site. 5 / mL of Penicillium finger spores;

[0155] Incubate at 25℃ with humidity, and treat the surface of the navel oranges with double-distilled water every 24 hours. Record the disease incidence 3 days after inoculation. Figures 27-30 As shown.

[0156] Depend on Figures 27-30 It can be seen that 3 days after inoculation, the citrus disease incidence rate in all three treatment groups was 100%, with the first group (1×10⁻⁶) showing the highest incidence. 7 The preventive effect of the first group (1×10) was 16.92%, and the second group (1×10) 8 The preventive effect of ) was 18.96%, and the third group (1×10) 9The preventive effect of HBF12 strain was 43.34%, indicating that HBF12 strain has a certain preventive effect against green mold.

[0157] Example 8

[0158] Control of Green Mold Disease in Satsuma Mandarins by Dipping Fruit with HBF12 Strains

[0159] After disinfecting the surface of Wenzhou mandarins with a 1:50 diluted commercially available 84 disinfectant, they were rinsed with distilled water. Three 3 mm deep wounds were then inserted into the equatorial side of the mandarins. The mandarins were divided into a control group (N-1) and a treatment group (N-1 + HBF12), with 10 mandarin fruits in each group as replicates. The treatment was carried out as follows:

[0160] Treatment group: using 1×10 9 Soak the cells in HBF12 bacterial suspension for 1 min, air dry, and then inoculate 10 μL of 1×10⁶ cells / mL at the wound site on the equatorial side. 5 spores / mL of Penicillium finger spores;

[0161] Control group: 10 μL of 1×10⁻⁶ cells was inoculated at the equatorial wound site. 5 spores / mL of Penicillium finger spores;

[0162] Incubate at 25℃ with humidity, and treat the surface of the navel oranges with double-distilled water every 24 hours. Record the disease incidence 3 days after inoculation. Figures 31-34 As shown.

[0163] Depend on Figures 31-34 It can be seen that 3 days after inoculation, the incidence rate of citrus in the control group was 100%, while the incidence rate of citrus in the treatment group (N-1+HBF12) was 50%. The preventive effect of strain HBF12 against green mold was 76.37%, indicating that strain HBF12 has a good preventive effect against green mold in Wenzhou mandarin oranges.

[0164] Example 9

[0165] HBF12 strain for the prevention of postharvest diseases in Newhall navel oranges

[0166] This study was conducted at Huazhong Agricultural University in Wuhan, Hubei Province. The Newhall navel oranges used in the study were harvested in February 2024 from Zigui County, Hubei Province. The pesticide information used in this example is as follows: 45% imazalil: water-in-oil emulsion, active ingredient content 45%, produced by Jiangxi Zhengbang Biochemical Co., Ltd.; 40% propiconazole: wettable powder, active ingredient content 40%, produced by Jiangsu Longdeng Chemical Co., Ltd.

[0167] Strains HBF12 were cultured in YPD medium at 28°C and 150 rpm for 24 h with shaking, and the concentration was adjusted to 1×10⁻⁶. 9 per mL.

[0168] The harvested Newhall navel oranges were divided into a water control group (water), a blank control group (CK), a bacterial solution treatment group (HBF12), and a pesticide treatment group (prochloraz + chlorpyrifos). Each group had 3 replicates, with 80 fruits per replicate, and the treatments were carried out as follows:

[0169] Bacterial suspension treatment group (HBF12): Concentration used was 1×10 9 Soak Newhall navel oranges in HBF12 bacterial solution (number per mL) for 1 minute, then air dry and bag each fruit individually.

[0170] Pesticide treatment group (prochloraz + bacalil): Newhall navel oranges were soaked in a mixed solution of prochloraz (300 ppm) and bacalil (300 ppm) for 1 min, then dried and bagged individually.

[0171] Water control group (water): Newhall navel oranges were soaked in water for 1 minute, dried, and then individually bagged.

[0172] Blank control group (CK): single fruit bagging directly.

[0173] After fruit bagging, the fruit was stored in a ventilated environment at room temperature. The incidence of postharvest diseases was statistically analyzed and the diseases identified weekly for each group of fruit. Since the symptoms and disease progression of Penicillium and Green mold on citrus fruit are basically the same, the two diseases were statistically analyzed together in this experiment. After 6 weeks of storage, the incidence of each disease was calculated. The incidence rate in the water control group was 10% (Penicillium and Green mold incidence rate was 8.75%, and sickle stem rot incidence rate was 1.25%); the incidence rate in the blank control group was 3.75% (Penicillium and Green mold incidence rate was 3.33%, and sickle stem rot incidence rate was 0.42%); the incidence rate in the pesticide treatment group was 0.42% (Penicillium and Green mold incidence rate was 0.42%); and the incidence rate in the HBF12 bacterial solution treatment group was 4.17% (Penicillium and Green mold incidence rate was 3.75%, and black rot incidence rate was 0.42%). The results are as follows: Figure 35 and Figure 36 As shown.

[0174] Depend on Figure 35 and Figure 36 It was found that after 6 weeks of room temperature and ventilation storage, compared with the water control group, the incidence of Penicillium mold, green mold, and Fusarium stem rot were all reduced in each treatment group. The preventive effect of HBF12 bacterial solution reached 62.50%, while the preventive effect of pesticides reached 95.80%. The main postharvest diseases of citrus are Penicillium mold and green mold, and strain HBF12 has a good preventive effect on postharvest storage diseases of Newhall navel oranges.

[0175] As can be seen from the above embodiments, the Omkoda ( Kodamaea ohmeriThe strain HBF12 has a significant inhibitory effect on citrus sour rot fungus and Penicillium fingernail, and has a good biocontrol effect on postharvest sour rot, Penicillium rot and green mold of citrus.

[0176] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An Omcorda strain ( Kodamaea ohmeri HBF12, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 20241462.

2. An inoculant characterized in that, The bacterial agent comprises the Kodamaea ohmeri strain HBF12 of claim 1.

3. The bacterial agent of claim 2, wherein The concentration of the strain HBF12 of Aureobasidium pullulans in the bacterial agent is 1 x 10 7 ~ 1 x 10 9 individuals / mL.

4. Use of the Aureobasidium strain HBF12 of claim 1 or of the microbial agent of claim 2 or 3 for inhibiting citrus pathogenic fungi; the citrus pathogenic fungi being Geotrichum candidum (Linn) Link and / or Penicillium digitatum (Sacc.) Thom. Geotrichum citri-aurantii . Penicillium digitatum ​ 5. Use of the Kodamaea ohmeri strain HBF12 of claim 1 or the bacterial agent of claim 2 or 3 for preventing postharvest green mold and / or sour rot of citrus fruits.

6. A method of preventing postharvest green mold and / or sour rot of citrus, characterized in that, comprising the steps of: immersing postharvest citrus fruits in the bacterial agent of claim 2 or 3 and then storing.

7. The method of claim 6, wherein, The time of immersion is from 1 to 2 minutes.