TaCAMTA2 protein related to wheat kernel starch content and application thereof

The development of KASP molecular markers related to TaCAMTA2 protein through KASP technology has solved the problem of regulating grain starch content in wheat breeding, achieved efficient and low-cost starch content identification and breeding-assisted selection, and improved the yield and quality of wheat varieties.

CN118725064BActive Publication Date: 2025-10-17CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410744007.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-11
Publication Date
2025-10-17
Estimated Expiration
2044-06-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to regulate grain starch content efficiently and at low cost in wheat breeding, resulting in high breeding costs and long breeding cycles.

Method used

KASP technology was used to develop KASP molecular markers related to the TaCAMTA2 protein. Competitive allele-specific PCR was used to detect specific single nucleotide variant sites in the TaCAMTA2 gene and develop dedicated primers for genotype analysis, thereby achieving high-precision starch content identification and breeding-assisted selection.

Benefits of technology

It significantly reduces breeding costs, shortens identification cycles, improves the efficiency and accuracy of grain starch content identification, provides a screening tool for high-yield, stable-yield, and high-quality wheat varieties, and realizes molecular-assisted selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118725064B_ABST
    Figure CN118725064B_ABST
Patent Text Reader

Abstract

The present application relates to wheat grain starch content related TaCAMTA2 protein and its application, the applicant excavates the excellent haplotype of TaCAMTA2, is composed of 1 single nucleotide marker (SNP), and based on the information development KASP marker and primer pair, for realizing the new gene resource and effective molecular marker of wheat quality breeding are provided.Specifically, according to the key variation site of the gene, functional molecular markers are developed, and the precise molecular markers are applied to breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of crop genetic breeding, and relates to a wheat grain starch content related TaCAMTA2 protein and application thereof. BACKGROUND

[0002] Wheat is one of the most important and widely planted food crops in the world, and its importance is not only reflected in food production and global economy, but also has a profound impact on society, culture and history. Wheat is one of the main food sources for people all over the world, and it provides about 20% of the dietary heat of the world, and is the main source of human starch and energy, in addition, it also provides human beings with nutrients including protein, vitamins, dietary fiber, etc. Wheat can be used to make bread, noodles, biscuits, cakes and various foods to meet the main energy needs of billions of people due to its characteristics. In addition, wheat plays a key role in the global food supply chain and can provide a large amount of raw materials for various food processing and human consumption. With the improvement of consumption level, improving wheat yield and quality has become an important goal of wheat breeding work. Grain starch content is an important trait affecting wheat yield and quality, and genetic analysis of its regulation mechanism is of great significance to wheat breeding work.

[0003] Starch is usually produced in the form of semi-crystalline insoluble particles in the plastids of leaves, seeds and storage organs, and is unique to plants and algae. According to the degree of glucose polymerization and branching, starch particles can be divided into two kinds of glucose polymers, amylose and amylopectin, wherein amylose is composed of linear glucan chains connected by α-(1→4) bonds, accounting for 25% to 30% of the total starch particles; amylopectin is composed of branched glucan polymers formed by α-(1→6) bonds between adjacent linear glucan chains, accounting for about 70% to 75% of the total starch particles.

[0004] Starch particles are composed of amorphous and semi-crystalline regions, and amylose mainly exists in the amorphous region of starch particles, and the semi-crystalline particle matrix is mainly composed of amylopectin, and the chains of adjacent amylopectin can form double helixes, further forming crystalline lamellae. The two kinds of glucose polymers work together to make the starch particles have the correct structure and composition. The physicochemical properties of starch such as hardness, digestibility, crystallinity and elasticity are key factors determining the production and functional properties of starch food and industrial raw materials.

[0005] Amylose content (AC) is the most classic parameter to reflect the composition of starch, which is negatively correlated with the starch viscosity, digestibility and transparency of milled rice. According to the average size of starch granules, starch granules can be divided into A-type starch granules and B-type starch granules. A-type starch granules are disc-shaped or lenticular, with an average diameter of 10-35 μm, accounting for more than 70% of the total weight of endosperm starch and 3% of the total number of wheat endosperm starch granules; B-type starch granules are mostly spherical or polygonal, including starch granules with an average diameter of 5-10 μm and C-type starch granules with a smaller size (<5 μm), accounting for more than 90% of the total number of wheat endosperm starch granules, but less than 30% of the total weight of starch. A-type starch granules appear 4-6 days after wheat pollination, and as the grain volume increases during the grain filling period, the number of A-type starch granules also increases. Around 20 days after pollination, the number of A-type starch granules stops increasing and the volume starts to increase; B-type starch granules, which have a smaller average size, appear later than A-type starch granules, gradually forming around 8 days after pollination and continuing until the late grain filling period. Therefore, mature wheat endosperm starch granules have a bimodal size distribution. Studies have shown that A-type and B-type starch granules in wheat have different chemical compositions and functional properties. Compared with B-type starch granules, A-type starch granules contain more amylose, less amylopectin, and a higher amylose / amylopectin ratio. In addition, smaller B-type starch granules can bind more lipids and proteins, form non-covalent bonds with the endosperm protein matrix, and produce a harder endosperm. An increase in the content of B-type starch granules can increase the water absorption of wheat dough, increase the elasticity of the dough, and affect the baking quality of wheat flour. In hard wheat, there is usually a higher proportion of B-type starch granules.

[0006] Starch is mainly synthesized in the seeds, tubers, corms and roots of plants, and is the main form of carbohydrate storage in plants. In cereal crops, the endosperm is the main site for starch storage. Starch metabolism is the most important energy source for all living organisms, and is also an important industrial raw material and additive. The synthesis pathway of endosperm starch in cereal crops is highly conserved, including the transportation of sucrose from source tissues and the conversion of sucrose to starch. Various starch synthesis-related enzymes, such as ADP-glucose pyrophosphorylase (AGPase), soluble starch synthase (SS), starch branching enzyme (SBE), and debranching enzyme (DBE), are precisely involved in each step of the enzymatic reaction. Each starch synthesis-related enzyme (SSRE) has multiple isozymes, which can form heteromultimeric complexes with other isozymes in vivo to exert their functions. Starch synthesis is regulated by multiple upstream pathways, including transcription factors and epigenetic regulation. In studies of rice, maize, barley and wheat, etc., various transcription factors, including bZIP, NAC, MADS-box, AP2, DOF, etc., were found to be involved in the regulation of the expression of SSRGs.

[0007] Competitive allele-specific PCR, commonly known as KASP technology, is an innovative method based on the PCR process for detecting SNPs (single nucleotide polymorphisms). This technology is based on the specific pairing of primer ends, enabling high-precision analysis of genotypes, while also having high productivity, low cost, high efficiency, high accuracy, and strong genetic stability. KASP technology shows excellent economy and high scalability in small to medium-sized marker applications. Therefore, exploring and identifying excellent haplotype KASP molecular markers suitable for CAMTA2 based on KASP technology has important strategic significance for the assisted selection of wheat breeding. SUMMARY

[0008] Therefore, the purpose of the present application is to provide a wheat grain starch content related TaCAMTA2 protein and its application.

[0009] To achieve the above purpose, the present application provides the following technical solutions:

[0010] 1. A wheat grain starch content related TaCAMTA2 protein, the amino acid sequence of which is shown in SEQ ID NO. 1.

[0011] 2. A gene TaCAMTA2 encoding the aforementioned protein, the nucleotide sequence of which is shown in SEQ ID NO. 2.

[0012] 3. Application of the aforementioned TaCAMTA2 protein or its homologous protein in increasing the starch content of wheat grains.

[0013] 4. Application of the aforementioned gene TaCAMTA2 in increasing the starch content of wheat grains.

[0014] 5. Application of the aforementioned TaCAMTA2 protein or its homologous protein in wheat breeding.

[0015] 6. Application of the aforementioned gene TaCAMTA2 in wheat breeding.

[0016] 7. KASP molecular marker special primers for detecting the aforementioned gene TaCAMTA2, comprising:

[0017] KASP-CAMTA2-FAM-F:

[0018] GAAGGTGACCAAGTTCATGCTCAGATATTTATTCGGGAGGAGCCG, shown in SEQ ID NO. 3;

[0019] KASP-CAMTA2-HEX-F:

[0020] GAAGGTCGGAGTCAACGGATTCAGATATTTATTCGGGAGGAGCCA, as shown in SEQ ID NO. 4;

[0021] KASP-CAMTA2-RKASP-CAMTA2-: TGGTGGCACTTACCTACAGAT, as shown in SEQ ID NO. 5.

[0022] 8. Use of the aforementioned KASP molecular marker specific primers in identifying whether a wheat variety carries the gene TaCAMTA2.

[0023] 9. A method for identifying whether a wheat variety carries the gene TaCAMTA2, comprising the following specific steps:

[0024] (1) Extracting genomic DNA from the wheat variety to be tested as template DNA;

[0025] (2) Using the aforementioned KASP molecular marker specific primers to perform PCR amplification on the template DNA to obtain an amplification product;

[0026] (3) Performing genotyping on the PCR amplification product and reading the data after genotyping.

[0027] As one of the preferred technical solutions, in step (2), the reaction system of PCR amplification is as follows: 100 ng / μL template DNA 1 μL, 2x KASP reaction mix 4.0 μL, primer mixed reagent 2.0 μL, and double-distilled water 1.0 μL.

[0028] As one of the preferred technical solutions, in step (2), the reaction conditions of PCR amplification are as follows: first, pre-denaturation at 95℃ for 10 minutes; then, Touch down program, including: denaturation at 95℃ for 20 seconds, then annealing and extension at 61℃ for 40 seconds, a total of 10 cycles, and the annealing temperature in each cycle decreases by 0.6℃; finally, amplification program, including: denaturation at 95℃ for 20 seconds, then annealing at 55℃ for 40 seconds, a total of 33 cycles.

[0029] As one of the preferred technical solutions, in step (3), a real-time quantitative instrument commonly used in the field, such as Bio-Rad C1000 Touch Thermal Cycler, is used to perform genotyping according to the fluorescence signal; then, a fluorescence genotyping software commonly used in the field, such as Bio-Rad CFX Maestro software, is used to read the data after genotyping.

[0030] The present application has the following beneficial effects:

[0031] The application discloses a wheat grain starch content related TaCAMTA2 protein, and the gene TaCAMTA2 which is really in control of the starch trait in the chromosome segment is mined through reverse genetics.

[0032] Traditional methods are usually costly and time-consuming for variety identification or seed quality evaluation. However, KASP technology can effectively solve these two problems, greatly reducing the cost of breeding, and significantly shortening the identification period. Therefore, KASP technology is widely regarded as the preferred technology for variety identification and seed quality control in molecular breeding work.

[0033] The applicant mines the excellent haplotype of TaCAMTA2, which is composed of one single nucleotide marker (SNP), and develops KASP markers and primer pairs based on this information, providing new genetic resources and effective molecular markers for wheat quality breeding. Specifically, a functional molecular marker is developed according to the key variation site of the gene, and the precise molecular marker is applied to breeding.

[0034] The application discloses a variation site related to the grain weight trait of wheat, and develops KASP markers and special primers based on the site. Using the KASP markers and special primers, the genotype of the wheat to be tested can be determined, i.e., the CAMTA2A genotype (variation site is A / A) or the CAMTA2G genotype (variation site is G / G). The haplotype analysis results of 433 wheat samples show that according to the genotype of the wheat to be tested, the wheat varieties with the CAMTA2A genotype can be determined as genetic resources for high-yield breeding, which helps to screen wheat varieties with high yield, provides a theoretical basis for breeding wheat varieties with high yield, stable yield and high quality, and provides a tool for molecular assisted selection.

[0035] The application also discloses corresponding PCR primers, which can amplify a wheat genomic DNA fragment, wherein the wheat TaCAMTA2 gene includes the 580th nucleotide, and the nucleic acid mutation from G to A is used as a characteristic feature of the substance in identification or assisted identification of the grain weight trait of wheat. The method is expected to significantly improve the identification efficiency and accuracy of the grain weight trait of wheat.

[0036] The KASP genotyping in the application refers to a special competitive allele-specific PCR for high-precision double-allele genotyping, which can be used for various genomic DNA samples, including complex genomic samples, and can also be used for verifying candidate markers obtained through trait positioning, such as SNPs and InDels, and resequencing data.

[0037] The primer end base specific matching is the basis of the KASP technology, and is used for SNP typing and InDels detection. Because the SNP technology has excellent flexibility, it is widely applied, and is suitable for various genotyping researches. Whether it is a low-throughput research project, SNP verification after NGS, or agricultural population research, the SNP technology can be used. BRIEF DESCRIPTION OF DRAWINGS

[0038] In order to make the purposes, technical solutions and beneficial effects of the present application clearer, the present application is described below with the help of the following drawings:

[0039] Figure 1 A map of a CRISPR-Cas9 knockout vector.

[0040] Figure 2 A schematic diagram of the position of a CRISPR-Cas9 target in the coding region of a gene, and four types of gene mutations in a TaCAMTA2 knockout transgenic line.

[0041] Figure 3 A phenotype of grain and starch content of a TaCAMTA2 knockout transgenic line, wherein A is a grain length actual picture, B is a grain width actual picture, C is a grain width statistical result, D is a grain length statistical result, E is a thousand grain weight statistical result, and F is a starch content determination result.

[0042] Figure 4 A schematic diagram of difference information of amino acid sequences of three haplotypes of TaCAMTA2.

[0043] Figure 5 Distribution of three haplotypes of TaCAMTA2 in cultivars and landraces, wherein the left side is cultivars, and the right side is landraces.

[0044] Figure 6 Comparison between grain length, grain width and thousand grain weight of Hap1 and Hap3, wherein A is thousand grain weight, B is grain length, C is grain width, and D is an EMSA diagram of recombinant proteins of Hap1 and Hap3 and a target gene TaSus2.

[0045] Figure 7 KASP marker development of an excellent haplotype Hap3 of TaCAMTA2. DETAILED DESCRIPTION

[0046] The preferred embodiments of the present application will be described in detail below with the help of the accompanying drawings.

[0047] In the present application, the grain weight trait of wheat is expressed in the form of high and low thousand grain weight, and therefore, the wheat with excellent grain weight trait refers to a wheat variety with relatively high thousand grain weight.

[0048] In the present application, “CAMTA2G The terms "genotype" and "G / G genotype" have the same meaning and can be used interchangeably.

[0049] In the present invention, "CAMTA2 A The terms "genotype" and "A / A genotype" have the same meaning and can be used interchangeably.

[0050] Example 1:

[0051] Based on the identification of wheat quality-related genes, a protein interacting with histone acetyltransferase TaGCN5, TaCAMTA2, was cloned from wheat. This gene encodes a calmodulin transcription factor. A TaCAMTA2 gene knockout vector was constructed using the CRISPR / Cas9 system ( Figure 1 ).

[0052] To knockout all three TaCAMTA2 homologous genes, a target site was designed at a conserved position within the first exon of each of the three homologous genes. A sgRNA (sgRNA sequence: CCGGCGCTACGGGATCGCGCCGC) carrying this target site was constructed into the pBUE414 vector (Xing et al., 2014) and successfully transformed into the wheat variety Fielder using Agrobacterium tumefaciens. PCR amplification and sequencing of the sgRNA target sites of the three homologous genes, TaCAMTA2-A, TaCAMTA2-B, and TaCAMTA2-D, in transgenic plants revealed four independent homozygous knockout mutants: Tacamta2-1, Tacamta2-2, Tacamta2-3, and Tacamta2-4. In the Tacamta2-1 and Tacamta2-2 gene knockout mutants, all three homologous genes of TaCAMTA2 underwent frameshift mutations, causing their protein translation to terminate prematurely. In the Tacamta2-3 gene knockout mutant, TaCAMTA2-A and TaCAMTA2-B underwent frameshift mutations, resulting in premature protein translation termination, and the mutation of TaCAMTA2-D resulted in the deletion of two amino acids. In the Tacamta2-4 gene knockout mutant, TaCAMTA2-A was missing two amino acids, and TaCAMTA2-B and TaCAMTA2-D underwent frameshift mutations, resulting in premature protein translation termination. Figure 2 ).

[0053] The results of the test showed that compared with the wild type, the mutant system had smaller grains, with grain length, grain width and thousand-grain weight significantly reduced ( Figure 3 The starch content was determined to be significantly reduced in the mutant ( Figure 3 Middle F).

[0054] Example 2:

[0055] Mining superior haplotypes of TaCAMTA2

[0056] The applicant used 445 wheat germplasm resources, including 377 modern cultivars and 68 local varieties, to analyze the genetic variation of TaCAMTA2-A, TaCAMTA2-B, and TaCAMTA2-D in natural populations. The analysis results showed that the coding region of TaCAMTA2-A has three haplotypes, named Hap1, Hap2, and Hap3. Compared with Hap1, Hap2 and Hap3 have variations in the nucleotide sequence at positions 347 and 580 in the coding region, respectively, resulting in variations in the amino acid sequence at positions 116 and 194 among the three haplotypes ( Figure 4 In addition, no different types of nucleotide and amino acid variations were found in the coding regions of TaCAMTA2-B and TaCAMTA2-D.

[0057] The applicant conducted a statistical analysis of the distribution frequencies of the three haplotypes of TaCAMTA2-A in 445 wheat germplasm resources. The results showed that the distribution of the three haplotypes of TaCAMTA2-A was different in modern cultivars and landraces ( Figure 5 Hap1 (Ser116-Gly194), Hap 2 (Asn116-Gly194), and Hap3 (Ser116-Arg194) account for 64.2%, 2.7%, and 33.1% of modern cultivars, respectively; and 76.5%, 2.9%, and 20.6% of local varieties, respectively. Compared with local varieties, the distribution frequency of Hap1 in modern cultivars is significantly lower, while the distribution frequency of Hap3 in modern cultivars is significantly higher.

[0058] In order to clarify whether different haplotypes have an impact on wheat yield, the applicant conducted a statistical analysis of grain length, grain width and thousand-grain weight of 445 wheat germplasm resources ( Figure 5 Considering that there are few wheat germplasm resources carrying the Hap2 (n=12) allele, there may be data analysis errors. The applicant focused on the statistical analysis of the test results of wheat germplasm resources carrying the Hap1 (n=294) and Hap3 (n=139). The results showed that the grain length, grain width and 1000-grain weight of wheat germplasm resources carrying the Hap3 allele were significantly higher than those of wheat germplasm resources carrying the Hap1 allele ( Figure 6 AC). EMSA results showed that both Hap1 and Hap3 could bind to the TaSus2 promoter, and Hap3 had a stronger binding ability to the TaSus2 promoter than Hap1 ( Figure 6Medium D), which was closely related to the larger grain size and higher 1000-grain weight of wheat germplasm resources carrying Hap3 allelic variation. In summary, these results indicated that Hap3 might be an excellent allelic variation type for increasing the starch content and grain weight of wheat. And the designed KASP194 marker could effectively distinguish Hap3 from the other two haplotypes, which could be used in subsequent molecular marker-assisted selection breeding.

[0059] Example 3:

[0060] Application of molecular marker KASP-CAMTA2 in high-yield wheat breeding

[0061] A total of 455 different wheat varieties were used as test materials, which were all conventional varieties and available at the Wheat Research Center of China Agricultural University.

[0062] Genomic DNA was extracted from each wheat variety as a template for PCR amplification.

[0063] PCR amplification was performed using the designed KASP-CAMTA2 molecular marker-specific primers, including primers KASP-CAMTA2-FAM-F, KASP-CAMTA2-HEX-F, and KASP-CAMTA2-RKASP-CAMTA2-.

[0064] The PCR reaction program (8 μL system) was as follows: 1 μL (100 ng / μL) of template DNA, 2x KASP reaction mix 4.0 μL, primer mix reagent 2.0 μL, and double-distilled water 1.0 μL.

[0065] First, pre-denaturation at 95°C for 10 minutes; then, Touch down program, including denaturation at 95°C for 20 seconds, followed by annealing and extension at 61°C for 40 seconds, with a decrease of 0.6°C in annealing temperature for each cycle, and a total of 10 cycles; finally, amplification program, including denaturation at 95°C for 20 seconds, followed by annealing at 55°C for 40 seconds, with a total of 33 cycles. The PCR product needs to be stored at 4°C in the dark. Finally, the sample was stored at 4°C and protected from light.

[0066] After completing the PCR amplification, real-time quantitative instruments commonly used in the field, such as Bio-Rad C1000 Touch Thermal Cycler, can be used to genotype according to the fluorescence signal. Then, the fluorescence typing software commonly used in the field, such as Bio-Rad CFX Maestro software, is used to read the data after typing.

[0067] Genotyping is performed based on the fluorescence signal of the PCR amplification product. Figure 7 In the figure, PCR amplification products carrying the fluorescent sequence FAM are shown in orange, while PCR amplification products carrying the fluorescent sequence HEX are shown in blue. You can perform genotyping in the following ways:

[0068] If the analysis result shows orange, then the TaCAMTA2 gene ( Figure 4 ) with all bases at position 580 being A. This wheat genotype is called CAMTA2 A Genotype, also known as A / A genotype.

[0069] If only the blue image is displayed, then the TaCAMTA2 gene ( Figure 4 ) with all bases at position 580 being G. This wheat genotype is called CAMTA2 G Genotype, also known as G / G genotype.

[0070] This process can help determine the TaCAMTA2 genotype of wheat and distinguish different genotypes based on the differences in fluorescence signals.

[0071] According to the fluorescent signal of the PCR product, the type of the 580th nucleotide of the TaCAMTA2 gene of the wheat to be identified can be determined, thereby identifying the grain weight trait of the wheat.

[0072] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. Used to detect the gene with nucleotide sequence as shown in SEQ ID NO.2 TaCAMTA2 The KASP molecular marker special primer for the 580th SNP site in the middle base is characterized by: include: KASP-CAMTA2-FAM-F: GAAGGTGACCAAGTTCATGCTCAGATATTTATTCGGGAGGAGCCG, as shown in SEQ IDNO.3; KASP-CAMTA2-HEX-F: GAAGGTCGGAGTCAACGGATTCAGATATTTATTCGGGAGGAGCCA, as shown in SEQ IDNO.4; KASP-CAMTA2-RKASP-CAMTA2-:TGGTGGCACTTACCTACAGAT, as shown in SEQ ID NO. 5; The genotype of the SNP site is A / A genotype or G / G genotype.

2. The KASP molecular marker primers according to claim 1 are used to identify the gene with the nucleotide sequence shown in SEQ ID NO. 2 in wheat varieties. TaCAMTA2 The genotype of the SNP site at the 580th base is A / A genotype or G / G genotype.

3. A method for identifying a gene with a nucleotide sequence as shown in SEQ ID NO. 2 in a wheat variety TaCAMTA2 The method of the invention wherein the genotype of the 580th SNP site in the middle base is an A / A genotype or a G / G genotype, characterized in that: The specific steps are as follows: (1) Extract genomic DNA from the wheat variety to be tested as template DNA; (2) using the KASP molecular marker-specific primers described in claim 1 to perform PCR amplification on the template DNA to obtain an amplified product; (3) Perform genotyping on the PCR amplification products and read the typing data.