A mutant of dioxygenase for biocatalytic synthesis of vanillin, a preparation method thereof, and applications thereof

Abstract

The present invention discloses a mutant of a dioxygenase for biocatalytic synthesis of vanillin, a preparation method thereof and applications. The mutant is such that at least one of the 332nd, 401st, and 553rd positions in the amino acid sequence shown in SEQ ID NO.1 is mutated; by mutating the aromatic dioxygenase sequence of 4-vinylguaiacol and through screening, this series of mutants can efficiently catalyze the formation of vanillin from 4-vinylguaiacol, and it has a yield 5 to 7 times higher than that of the template.

Description

Technical Field

[0001] The present invention relates to the technical fields of enzyme engineering and genetic engineering, and particularly relates to a mutant of dioxygenase for biocatalytic synthesis of vanillin, a preparation method thereof, and an application thereof. Background Art

[0002] Vanillin is the most characteristic flavor compound of vanilla, with a pleasant, sweet and rich aroma, having a vanilla-like taste, and is considered to be one of the most important flavors in the world, and is widely used in the food, beverage, perfume and pharmaceutical industries. In particular, vanillin is a high-grade flavor additive in the food industry, with a high sweetness intensity and a creamy vanilla flavor. In addition, due to its antibacterial, antimutagenic and antioxidant activities, it is used as a biopreservative. Vanillin is also used in the production of household products such as deodorants, air fresheners, floor polishers and herbicides. At present, the market demand for vanillin is about 20,000 tons, while the natural supply is less than 2,000 tons. Natural vanillin cannot meet the market demand due to its high cost and low yield. Natural vanillin is generally extracted from the vanilla plant vanilla pod, but it faces high plant cultivation costs and extremely low yields, resulting in expensive natural vanillin and restricting industrial applications. Chemically synthesized vanillin has the disadvantages of complex processes, expensive raw materials, high energy consumption, large pollution, and failure to meet the qualified requirements in terms of human health and the environment, so its use in the food and pharmaceutical industries is strictly restricted by most food safety control agencies in the world. Therefore, the biotechnological production of "nature-identical" vanillin has rapidly become important.

[0003] Vanillin biotechnologically synthesized from natural substances is considered to be the same as natural vanillin because of its pure aroma and environmental health friendliness, and has received wide attention. Biotechnological methods for vanillin production usually rely on microbial fermentation processes or use customized microbial cells or enzymes to biotransform natural precursors into vanillin. Some natural microorganisms have the ability to synthesize a small amount of vanillin. However, these processes face common challenges such as low conversion efficiency, high degradation rate, and product cytotoxicity, which limit the application of vanillin in large-scale production. The production of vanillin by biocatalysis is highly efficient and environmentally friendly, with mild reaction conditions, and vanillin is catalyzed by substrates from various sources, such as ferulic acid, 4-vinylguaiacol, eugenol, isoeugenol, etc. However, the enzyme activity of the key enzyme plays a crucial role in the overall yield, which is the current bottleneck for the industrial production of vanillin by the enzyme method. Summary of the Invention

[0004] Object of the Invention: The first object of the present invention is to provide mutants of dioxygenase for biocatalytic synthesis of vanillin. Aiming at the problems of poor stability and low activity of the existing aromatic dioxygenase for 4-vinylguaiacol, through site-directed mutagenesis, the yield of vanillin produced by catalysis is improved, providing a new way for the industrial production of vanillin; the second object of the present invention is to provide a preparation method for the mutants of the dioxygenase; the third object of the present invention is to provide the application of the mutants of the dioxygenase in biocatalytic synthesis of vanillin.

[0005] Technical Solution: The mutants of the dioxygenase for biocatalytic synthesis of vanillin in the present invention are mutants in which at least one of the amino acid sequences shown in SEQ ID NO.1 is mutated at positions 332, 401, and 553; the valine (Val) at position 332 of the amino acid is mutated to any one of glycine (Gly), alanine (Ala), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), proline (Pro), tryptophan (Try), methionine (Met), serine (Ser), or aspartic acid (Asp); the glutamic acid (Glu) at position 401 of the amino acid is mutated to any one of asparagine (Asn), aspartic acid (Asp), glutamine (Gln), arginine (Arg), alanine (Ala), serine (Ser), threonine (Thr), or leucine (Leu); the leucine (Leu) at position 553 of the amino acid is mutated to any one of glycine (Gly), valine (Val), alanine (Ala), isoleucine (Ile), phenylalanine (Phe), proline (Pro), tryptophan (Try), methionine (Met), serine (Ser), or aspartic acid (Asp).

[0006] By amplifying the aromatic dioxygenase gene of 4-vinylguaiacol from Thermothelomyces thermophilus and using rational design to perform directed evolution and transformation on it, a mutant of the aromatic dioxygenase with high yield of vanillin was finally obtained.

[0007] Preferably, the amino acid sequence of the mutant is any one of the sequences shown in SEQ ID No.2 to 18.

[0008] The gene encoding the mutant protein of the dioxygenase for biocatalytic synthesis of vanillin in the present invention.

[0009] Preferably, the nucleotide sequence of the gene is as shown in SEQ ID No.20 to 36.

[0010] The cloning vector or expression vector of the gene in the present invention.

[0011] The preparation method of the mutants of the dioxygenase for biocatalytic synthesis of vanillin in the present invention includes the following steps:

[0012] (1) Design site - directed mutagenesis primers. Using the plasmid carrying the aromatic dioxygenase gene with 4 - vinylguaiacol as the template, perform PCR reactions separately with the site - directed mutagenesis primers. After purification, obtain the mutant gene fragment and the linearized plasmid.

[0013] (2) Connect the mutant gene fragment with the linearized plasmid to construct an expression vector. After transferring the expression vector into the host bacterium, perform induced expression.

[0014] (3) Collect the host bacterium expressing the dioxygenase mutant. Resuspend the bacterial cells and then break the cells. Centrifuge and take the supernatant to obtain the crude enzyme solution containing the dioxygenase mutant.

[0015] Preferably, the site - directed mutagenesis primers are:

[0016]

[0017]

[0018] Preferably, the PCR reaction system is:

[0019]

[0020]

[0021] The application of the mutant of the dioxygenase described in the present invention in the biocatalytic synthesis of vanillin. The catalytic mechanism is as follows:

[0022]

[0023] Preferably, the application method is: using the wet bacterial cells after induced expression of the recombinant engineering bacterium containing the gene encoding the dioxygenase mutant as a catalyst, using 4 - vinylguaiacol as a substrate to catalytically synthesize vanillin, and the conditions are that the pH range is 7 - 10 and the temperature range is 15 - 35 °C.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: By mutating the sequence of the aromatic dioxygenase of 4 - vinylguaiacol, after screening, this series of mutants can efficiently catalyze 4 - vinylguaiacol to generate vanillin, and its yield is 5 - 7 times higher than that of the template. Brief Description of the Drawings

[0025] Figure 1 It is the yield diagram of different mutants at the V332 site of the aromatic dioxygenase Ado in Example 1;

[0026] Figure 2 It is the yield diagram of different mutations at the E401 site of the aromatic dioxygenase Ado in Example 2;

[0027] Figure 3 Yield diagram of different mutations at the L553 site of the aromatic dioxygenase Ado in Example 3;

[0028] Figure 4 Yield diagram of the triple-round evolved mutants of the aromatic dioxygenase Ado in Examples 1-5;

[0029] Figure 5 Simulation diagram of the kinetic parameters of the aromatic dioxygenase Ado;

[0030] Figure 6 Optimum pH diagram of the aromatic dioxygenase Ado;

[0031] Figure 7 Optimum temperature diagram of the aromatic dioxygenase Ado. Detailed implementation manners

[0032] The technical solutions of the present invention will be further described below in conjunction with the examples.

[0033] Example 1

[0034] The preparation method of the mutant is as follows:

[0035] 1. Obtaining of the pET22b-ADO plasmid

[0036] According to the coding sequence of the aromatic dioxygenase of 4-vinylguaiacol from Thermothelomyces thermophilus in the GenBank database (NCBI Reference Sequence: XP_003665585.1), a gene fragment was synthesized by Suzhou Genewiz Biotechnology Co., Ltd. and constructed on the pET22b vector, and the vector was transformed into the E. coli DH5α strain. The ADO gene was named as shown in SEQ ID NO.2, and its corresponding amino acid sequence was as shown in EQ ID NO.1.

[0037] 2. Construction of the recombinant E. coli BL21(DE3) / pET22b-ADO mutant

[0038] The recombinant bacterium E. coli DH5α / pET22b-ADO derived from Thermothelomyces thermophilus was inoculated into a 5 mL test tube with a medium loading volume and cultured at 37°C and 220 rpm for 12 h. After the culture was completed, the cells were centrifuged at 12,000 rpm for 1 min and collected. Using a high-purity plasmid miniprep kit, the plasmid was extracted from E. coli DH5α / pET22b-ADO as a template for iterative mutation to construct the plasmid pET22b-ADO mutant.

[0039] Through molecular docking and rational design, 47 amino acid sites were selected at the active site of the enzyme for site-directed saturation mutagenesis, and the yields of vanillin produced by the mutants were detected. Among the selected mutation sites, the 68th, 80th, 82nd, 81st, 143rd, 156th, 158th, 189th, 191st, 203rd, 242nd, 243rd, 245th, 246th, 306th, 308th, 332nd, 333rd, 334th, 335th, 357th, 400th, 401st, 402nd, 437th, 438th, 439th, 551st, 552nd, and 553rd sites were all subjected to saturation mutagenesis, and the original amino acids were mutated into 19 other amino acids respectively.

[0040] Preferably among the above results, the valine Val (gtg) at the 332nd amino acid position was mutated into any one of glycine Gly (ggc), alanine Ala (gct), leucine Leu (ctc), isoleucine Ile (atc), and phenylalanine Phe (ttc). The amino acid sequences of the mutants are shown in SEQ ID No. 2-6 in sequence, and the gene sequences are shown in SEQ ID No. 20-24 in sequence.

[0041] The method for constructing V332G, V332A, V332L, V332I, and V332F mutants is as follows:

[0042] The gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene, and the primers are shown in the following table:

[0043] Table 1 Primers for V332 mutant gene fragments and linearized plasmid primers

[0044]

[0045]

[0046] Note: The underlined part in the primer is the mutation site, "F" represents the upstream primer, and "R" represents the downstream primer.

[0047] The PCR system is shown in Table 2.

[0048] Table 2 PCR reaction system

[0049]

[0050] The PCR reaction conditions are shown in Table 3.

[0051] Table 3 PCR reaction conditions

[0052]

[0053] Digest the gene fragment after PCR with DpnI to remove the template, and then perform recombination with recombinase. Transform the recombination product into E. coli DH5α competent cells, coat it on the surface of LB solid medium containing 100 μg / mL ampicillin, culture at 37 °C for 12 h, pick single colonies into LB liquid culture, identify the successfully constructed positive transformants by PCR method, and verify the correctness of the mutation sites by sequencing. After verification, add sterile glycerol to a final concentration of 25%, number, and store at -80 °C for standby. Extract the plasmid from a part of the bacteria using a plasmid extraction kit, and store the recombinant plasmid in a -20 °C refrigerator.

[0054] Transfer the successfully sequenced recombinant expression plasmid pET22b into E. coli BL21(DE3) as the expression host to construct the recombinant mutant expression strain E. coli BL21(DE3) / pET22b-ADO. After overnight culture, use a sterilized pipette tip to pick single colonies into a 96-well shallow plate containing sterilized LB medium (ampicillin: 100 μg / mL), use the wild type as a control, culture overnight at 37 °C for 16 h, add sterilized glycerol to a final concentration of 20%, pipette evenly, and store at -80 °C for use.

[0055] Example 2

[0056] Preparation of mutants E401G, E401D, E401Q, E401R, and E401A of the monooxygenase ADO.

[0057] The glutamic acid Glu (gaa) at the 401st amino acid is mutated to any one of glycine Gly (ggc), aspartic acid Asp (gac), glutamine Gln (cac), arginine Arg (cgt), and alanine Ala (gcc). The amino acid sequences of the mutants are shown in SEQ ID No. 7-11 in sequence, and the gene sequences are shown in SEQ ID No. 25-29.

[0058] The gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene. Except for the primers, the other operations were the same as in Example 1. The primers are shown in Table 4.

[0059] Table 4 Primers for the gene fragment of the E401 mutant and primers for the linearized plasmid

[0060]

[0061] Note: The underlined part in the primer is the mutation site, "F" represents the upstream primer, and "R" represents the downstream primer.

[0062] Example 3

[0063] Preparation of mutants L553G, L553V, L553A, L553R, and L553I of monooxygenase ADO.

[0064] The leucine Leu (ggc) at amino acid position 553 was mutated to glycine Gly (ggc), valine Val (gtg), alanine Ala (gct), and isoleucine Ile (atc). The amino acid sequences of the mutants are shown in SEQ ID No. 12 - 16, and the gene sequences are shown in SEQ ID No. 30 - 34 in sequence. Gene mutation was performed by the method of whole plasmid PCR to obtain the target mutant gene. Except for the primers, the other operations were the same as those in Example 1. The primers are shown in Table 5.

[0065] Table 5 Primers for L553 mutant gene fragments and linearized plasmid primers

[0066]

[0067] Note: The underlined sites in the primers are the mutation sites. "F" represents the upstream primer, and "R" represents the downstream primer.

[0068] Example 4

[0069] Preparation of mutant L553V / V332L of dioxygenase ADO.

[0070] L553V / V332L is a double mutant and is the optimal mutant obtained through multiple rounds of saturation mutagenesis and iterative mutagenesis. The construction method of L553V / V332L is based on V332L as a template and is constructed by the method of whole plasmid PCR. The amino acid sequence of the mutant is shown in SEQ ID No. 17, and the gene sequence is shown in SEQ ID No. 35.

[0071] Gene mutation was performed by the method of whole plasmid PCR to obtain the target mutant gene. Except for the primers, the other operations were the same as those in Example 1. The primers are shown in Table 6.

[0072] Table 6 Primers for L553V / V332L mutant gene fragments and linearized plasmid primers

[0073]

[0074] Example 5

[0075] Preparation of mutant L553V / V332L / E401G of trioxygenase ADO.

[0076] L553V / V332L / E401G is a double mutant and triple mutant base, which is the optimal mutant obtained through multiple rounds of saturation mutagenesis and iterative mutagenesis. The construction method of L553V / V332L / E401G is based on L553V / V332L as a template, and constructed by the method of whole plasmid PCR on this basis. The amino acid sequence of the mutant is shown in SEQ ID No.18, and the gene sequence is shown in SEQ ID No.36.

[0077] Due to the use of the whole plasmid PCR method for gene mutation, the target mutant gene was obtained. Except for the primers, the rest of the operations were the same as in Example 1. The primers are shown in Table 7:

[0078] Table 7 Primers for L553V / V332L mutant gene fragments and linearized plasmid primers

[0079]

[0080] Example 6

[0081] Activity verification of mutant strains with high vanillin production of dioxygenase ADO:

[0082] The bacteria and mutants constructed in Examples 1-5 were transferred with an inoculum of 1% into a 500 mL deep well plate containing resistant LB medium. When the OD 600 reached about 0.6, IPTG with a final concentration of 0.5 mM was added, and induction was carried out at 18 °C for about 14 h. After induction, the deep well plate was centrifuged and resuspended with an appropriate buffer to obtain cells containing the mutant of dioxygenase ADO.

[0083] The reaction system was 100 mM 4-vinylguaiacol, 10% DMSO, and reacted overnight at 25 °C. After the reaction, 0.5 ml of ethyl acetate was used to extract the product.

[0084] Hue chromatograph detection conditions: Agilent HP-5 chromatographic column (30 m * 0.32 mm * 0.25 μm), the gas phase program was 60 °C for 2 min, programmed heating at 55 °C / min to 250 °C, and programmed heating at 45 °C / min to 300 °C, lasting for 2 min. The yield was calculated based on the detected sample peak area. The test results are shown in Figures 1 to 4 .

[0085] From Figure 1 it can be seen that the V332G, V332A, V332L, V332I, and V332F mutants all showed an increase compared to WT. Among them, the V332G mutant had the most obvious improvement, with a catalytic activity increase of about 10% compared to the WT strain; from Figure 2It can be seen that among the mutants E401G, E401D, E401Q, E401R, and E401A, E401G has a significant improvement compared to WT, with an increase of about 12%; from Figure 3 It can be seen that among the mutants L553G, L553V, L553A, L553R, and L553I, L553G has an increase of about 12%; from Figure 4 It can be seen that L553V / V332L / E401G is the mutant with the highest improvement, with a 27% increase compared to WT; the best mutant obtained is L553V / V332L / E401G.

[0086] Example 7

[0087] Preparation of pure enzyme solution of aromatic dioxygenase for 4-vinylguaiacol and determination of kinetic parameters

[0088] The best mutant strain L553V / V332L / E401G in Example 6 was cultured in a large flask, and after centrifugation to obtain the cells, they were resuspended with buffer and ultrasonically disrupted in an ice bath (working for 2 s, interval of 5 s, working time of 30 min), and centrifuged at 12,000 rpm / min at 4°C for 20 min. After collecting the supernatant, it was filtered through a 0.22 μm aqueous filter head as a sample, and then purified by a nickel column enzyme. According to the amino acid sequence of ADO, the molar extinction coefficient ε of the protein was calculated, and the absorbance of the purified protein was measured by the A280 method to calculate the protein concentration.

[0089] The specific activity of the best mutant L553V / V332L / E401G was measured under different concentrations of 4-vinylguaiacol, and the kinetic parameters were simulated and calculated based on the specific activity and substrate concentration as shown in Figure 5 .

[0090] From Figure 5 It can be seen that the kinetic parameters of L553V / V332L / E401G for 4-vinylguaiacol are K m is 7.88 mM, K cat is 8.33 S -1 .

[0091] Example 8

[0092] Optimal pH for the catalytic synthesis of vanillin by aromatic dioxygenase for 4-vinylguaiacol and its mutants

[0093] The engineered bacteria capable of expressing aromatic dioxygenase ADO and its mutants constructed and cultured according to Example 5 were used as catalysts, and the whole cells obtained were used.

[0094] The reaction system was 100 mM of 4-vinylguaiacol, 10% DMSO, and reacted overnight at 25 °C. The pH values were 7, 8, 8.8, 9, 9.5, and 10. After the reaction, 0.5 ml of ethyl acetate was used to extract the product, and the yield was measured. The results are shown in Figure 6 .

[0095] It can be seen from Figure 6 that the optimal pH for the enzyme activity of ADO is 9, but as the pH increases to 10, the activity basically disappears.

[0096] Example 9

[0097] Optimal temperature for the catalytic synthesis of vanillin by aromatic dioxygenase ADO from 4-vinylguaiacol and its mutants

[0098] The reaction system was 100 mM of 4-vinylguaiacol, 10% DMSO, and the temperatures were set at 15 °C, 20 °C, 25 °C, 30 °C, and 35 °C for overnight reaction. After the reaction, 0.5 ml of ethyl acetate was used to extract the product, and the yield was measured. The results are shown in Figure 7 .

[0099] It can be seen from Figure 7 that different temperatures have a significant effect on the catalysis of ADO, and its reaction activity shows a skewed normal trend with the change of temperature. The best catalytic effect was observed at 25 °C, and the enzyme activity was relatively low below or above this temperature.

[0100] Example 10

[0101] Optimization of the conditions for the catalytic synthesis of vanillin by aromatic dioxygenase ADO from 4-vinylguaiacol and its mutants.

[0102] Under the optimal conditions, that is, at pH 9 and reaction temperature of 25 °C, different whole-cell concentrations and substrate concentrations were set, and the yields were tested. The test results are shown in Table 8.

[0103] Table 8 Optimization of substrate and cell concentrations for dioxygenase ADO

[0104]

[0105]

[0106] It can be seen from Table 3 that when the OD is 40 and the substrate concentration is 100 mM, the highest yield is reached, which is 71%.

Claims

1. A mutant of dioxygenase for biocatalytic synthesis of vanillin, characterized in that, The mutant is mutated on the basis of the amino acid sequence shown in SEQ ID NO.1, and the mutant is selected from L553G, L553V, L553R, L553I, L553V / V332L or L553V / V332L / E401G.

2. A gene encoding a mutant protein of the dioxygenase for biocatalytic synthesis of vanillin as claimed in claim 1.

3. A cloning vector or expression vector containing the gene as claimed in claim 2.

4. The preparation method of the mutant of the dioxygenase for biocatalytic synthesis of vanillin according to claim 1, characterized in that, Comprising the following steps: (1) Design site-directed mutagenesis primers, using the plasmid of the aromatic dioxygenase gene SEQ ID NO.19 with 4-vinylguaiacol as a template, and perform PCR reactions respectively with the site-directed mutagenesis primers. After purification, obtain the mutant gene fragment and the linearized plasmid. (2) Connect the mutant gene fragment with the linearized plasmid to construct an expression vector, transfer the expression vector into a host bacterium and then perform induction expression. (3) Collect the host bacterium expressing the dioxygenase mutant, resuspend the bacterial cells and then break the cells, and centrifuge to take the supernatant to obtain the crude enzyme solution containing the dioxygenase mutant. The site-directed mutagenesis primers are: L553G_F ccaacggc GGC tttagccgcattgatgatcgctatgtgacc; L553G_R caatgcggctaaa GCC gccgttggtcggccaggtcagcgc; L553V_F ccaacggc GAC tttagccgcattgatgatcgctatgtgacc L553V_R caatgcggctaaa GTC gccgttggtcggccaggtcagcgc; L553R_F caatgcggctaaa GTG gccgttggtcggccaggtcagcgc; L553R_R caatgcggctaaa ACG gccgttggtcggccaggtcagcgc; L553I_F ccaacggc GCC tttagccgcattgatgatcgctatgtgacc; L553I_R caatgcggctaaa GGC gccgttggtcggccaggtcagcgc; V332L_F gatggcaac CTC tttttcttttttccgccggatg; V332L_R gaaaaaagaaaa GAG gttgccatccgccaccgtc; E401G_F ccaacggc GGC tttagccgcattgatgatcgctatgtgacc; E401G_R caatgcggctaaa GCC gccgttggtcggccaggtcagcgc。 5. The method for preparing the mutant of the dioxygenase according to claim 4, characterized in that, The PCR reaction system is: the components are 10×Buffer for KOD-Plus-, 2 mM dNTP, 25 mM MgSO4, DMSO, 10 pmol / μL Forward Primer, 10 pmol / μL Reverse Primer, DNA template, KOD-Plus-, ddH2O, and the volumes are 2.5 μL, 2.5 μL, 1.5 μL, 1 μL, 0.75 μL, 0.75 μL, <100 ng, 1 μL, up to 25 μL respectively.

6. An application of the mutant of the dioxygenase as claimed in claim 1 in the biocatalytic synthesis of vanillin.

7. The application according to claim 6, wherein The application method is: using the wet bacterial cells after induction expression of the recombinant engineering bacterium containing the gene encoding the dioxygenase mutant as a catalyst, using 4-vinylguaiacol as a substrate to catalytically synthesize vanillin, and the conditions are that the pH range is 7-10 and the temperature range is 15-35°C.

Images