A gene GhMYOB7 promoting the early maturity trait of upland cotton and its application

Abstract

The present invention discloses a gene GhMYOB7 for promoting the early maturity trait of upland cotton and its application, belonging to the field of genetic engineering technology. The nucleotide sequence of the upland cotton GhMYOB7 gene of the present invention is shown in SEQ ID NO.1. The present invention uses VIGS technology to silence the GhMYOB7 gene in upland cotton plants, which can delay budding and flowering of upland cotton plants, confirming that GhMYOB7 positively regulates the early maturity trait of cotton, and provides important gene resources for gene editing early maturity molecular breeding and early maturity variety identification of upland cotton.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to a gene GhMYOB7 for promoting the early maturity trait of upland cotton and its application. Background Art

[0002] Upland cotton is a widely cultivated cotton and is the main source of natural fiber in the world. Early maturity is an important excellent trait of upland cotton, which can effectively avoid the influence of low temperature, thus facilitating the expansion of upland cotton cultivation and realizing large-scale mechanized planting and harvesting.

[0003] The early maturity of upland cotton is a complex trait, mainly including traits such as the whole growth period, seedling stage, budding stage, flowering and boll stage, the position of the first fruiting branch, the height of the first fruiting branch, and the percentage of bolls opened before frost. These traits are all quantitative traits, controlled by multiple quantitative trait loci, with a complex genetic mechanism and are easily affected by environmental factors. Therefore, the progress of traditional breeding methods is slow and the efficiency is low.

[0004] Previous studies have shown that histone methylation regulates flowering by modulating the key flowering gene FLC. However, upland cotton lacks the FLC gene, so it is more difficult to study the genes regulating the flowering time of upland cotton through histone methylation. Exploring genes controlling the early maturity trait of upland cotton is of great significance for cultivating upland cotton varieties with early maturity traits. Summary of the Invention

[0005] The object of the present invention is to provide a gene GhMYOB7 for promoting the early maturity trait of upland cotton and its application to solve the problems existing in the above-mentioned prior art. The present invention uses the VIGS technology to silence the GhMYOB7 gene in upland cotton plants, which can delay the budding and flowering of upland cotton plants, demonstrating that GhMYOB7 positively regulates the early maturity trait of cotton, and providing an important gene resource for gene-editing early maturity molecular breeding and early maturity variety identification of upland cotton.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an upland cotton GhMYOB7 gene, and the nucleotide sequence of the GhMYOB7 gene is as shown in SEQ ID NO.1.

[0008] The present invention provides an application of the above upland cotton GhMYOB7 gene or its related biological material in regulating the early maturity trait of upland cotton. The regulation of the early maturity trait of upland cotton means that the GhMYOB7 gene positively regulates the early maturity trait; the early maturity trait includes the budding time and the flowering time;

[0009] The biological material includes a recombinant vector and a recombinant bacterium containing the GhMYOB7 gene.

[0010] The present invention provides an application of the above-mentioned upland cotton GhMYOB7 gene or its related biological materials in cultivating early-maturing upland cotton varieties, and the biological materials include a recombinant vector containing the GhMYOB7 gene and a recombinant bacterium.

[0011] The present invention provides a method for cultivating early-maturing upland cotton varieties. The above-mentioned GhMYOB7 gene is transferred into upland cotton plants through genetic transformation technology to stably overexpress the GhMYOB7 gene, so that the upland cotton plants bud and flower in advance, and the early-maturing upland cotton varieties are obtained.

[0012] The present invention provides an application of the above-mentioned upland cotton GhMYOB7 gene or its related biological materials in cultivating late-maturing upland cotton varieties, and the biological materials include a recombinant vector for silencing the GhMYOB7 gene and a recombinant bacterium for silencing the GhMYOB7 gene.

[0013] The present invention provides a recombinant vector for silencing the GhMYOB7 gene. By using virus-induced gene silencing technology, a silencing fragment of the GhMYOB7 gene is cloned onto an expression vector to obtain the recombinant vector;

[0014] The nucleotide sequence of the silencing fragment of the GhMYOB7 gene is shown in SEQ ID NO.2.

[0015] The present invention provides a recombinant bacterium for silencing the GhMYOB7 gene, and the recombinant bacterium contains the above-mentioned recombinant vector.

[0016] The present invention provides a method for cultivating late-maturing upland cotton varieties. By using the above-mentioned recombinant vector or the above-mentioned recombinant bacterium, the GhMYOB7 gene in upland cotton is silenced, so that the upland cotton delays budding and flowering, and late-maturing upland cotton varieties are obtained; the nucleotide sequence of the GhMYOB7 gene is shown in SEQ ID NO.1.

[0017] The present invention provides a qRT-PCR primer set for detecting the expression level of the GhMYOB7 gene in upland cotton plants. The qRT-PCR primer set includes a forward primer shown in SEQ ID NO.5 and a reverse primer shown in SEQ ID NO.6; the nucleotide sequence of the GhMYOB7 gene is shown in SEQ ID NO.1.

[0018] The present invention provides an application of the above-mentioned qRT-PCR primer set in the early identification of early-maturing upland cotton varieties.

[0019] The present invention discloses the following technical effects:

[0020] In the research of this invention, it was found that the GhMYOB7 gene was significantly highly expressed in cotton organs. By cloning the target gene and constructing a VIGS silencing vector of the target gene, the biological function of its regulation of early maturity was studied. The results showed that the silencing of the GhMYOB7 gene led to the delay of budding and flowering time, affecting the early maturity traits such as the flowering time of upland cotton. This confirmed that the GhMYOB7 gene positively regulated the early maturity of upland cotton, improved the phenotypic growth and development traits such as flowering and budding of upland cotton, and provided an important gene resource for the early maturity breeding and early identification of upland cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1 is the QTL information of cotton early maturity-related traits reported by predecessors; (A) The QTL distributions of early maturity-related traits are different; (B) The distribution of QTLs on the chromosomes of upland cotton;

[0023] Figure 2 is the marker distribution of the original QTL consensus genetic map of cotton early maturity-related traits; The density of markers on the chromosome gradually decreases from high to low, and the color changes from black to blue;

[0024] Figure 3 is the basic information of MQTL obtained through meta-analysis; (A) The number of MQTLs containing different numbers of QTLs; (B) The number of MQTLs on different chromosomes and the average number of initial QTLs in each MQTL; The color gradient from red to green indicates the decrease in the number of QTLs in the MQTL; (C) The reduction of the confidence interval (95% CI) of the initial QTL; The average length (cM) of the CIs of MQTLs and initial QTLs on each chromosome is represented by orange and gray bars respectively; The green solid line indicates that the CI size of the MQTL has been reduced by 1 / 2;

[0025] Figure 4 is the chromosomal distribution of the identified MQTLs; The circles from the innermost to the outermost represent the confidence interval, R 2 value, the number of initial QTLs, the physical position of the MQTL, the gene density, and the physical map (Mb) in turn;

[0026] Figure 5GWAS validation results for significant SNPs related to cotton earliness traits; the innermost layer represents QTL clusters that make up different MQTLs; around the core layer are significant SNPs identified through genome-wide association studies (GWAS) conducted on different natural populations; different colors on the periphery indicate changes in the number of juxtaposed SNPs;

[0027] Figure 6 Identification results of the expression patterns of candidate genes related to cotton earliness traits; (A) Fold change in relative expression of 75 candidate genes between early-maturing (ZMS50) and late-maturing (GXM11) plants; (B) Expression patterns of 9 genes in 16 Gossypium hirsutum tissues; (C) Relative expression levels of GhMYOB7 in the three-leaf stage of early-maturing and late-maturing varieties;

[0028] Figure 7 Phenotypic statistics results of Gossypium hirsutum plants with silenced GhMYOB7; (A) Bud-set status diagram of TRV:GhMYOB7 plants (day 50) and TRV:00 plants (day 44); (B) Flowering status diagram of TRV:GhMYOB7 plants (day 64) and TRV:00 plants (day 59); (C) Difference in bud-set time between TRV:00 and TRV:GhMYOB7 plants; (D) Difference in flowering time between TRV:00 and TRV:GhMYOB7 plants; *p < 0.05, **p < 0.01 indicate statistically significant differences. Detailed implementation manners

[0029] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0031] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0032] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention's specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0033] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0034] General description: The vectors TRV:00 (i.e., pYL156), pYL192, and TRV:GhCLA1 used in the embodiments of the present invention were all gifts from the Transgenic Research Group of the Institute of Cotton Research, Chinese Academy of Agricultural Sciences.

[0035] Example 1

[0036] I. Materials and Methods

[0037] 1. Collection of original QTLs related to early maturity traits in cotton

[0038] Through screening, previous studies on QTL mapping of early maturity traits in cotton were retrieved. The criteria for the collection of original QTLs were as follows: the traits related to the original QTLs, the type of mapping population, the population size, the LOD value, the R 2 or the phenotypic variance explained (PVE) value, and the peak position of the original QTL. If the peak position of the original QTL was missing, the average value of the surrounding markers was used instead. Similarly, when R 2 and LOD were missing, 3% and 10% were used respectively. If the confidence interval (CI) of the original QTL could not be determined, the following formula was used:

[0039] Recombinant inbred lines (RILs): CI = 163 / (population size × R 2 );

[0040] F 2 and backcross populations (BC): CI = 530 / (population size × R 2 ).

[0041] 2. Construction of a consensus genetic map

[0042] To more effectively integrate the original QTLs, two commonly used multi - marker genetic maps were combined to construct a reference genetic map. These maps included "CCRI 12 - 4×(AD)5 - 7, F 2” and “TM-1x 3-79, RIL(v3)”. For MQTL studies, the reference map was generated using the R package LPmerge. This method can effectively solve the position conflicts caused by inconsistent marker orders in different maps. Twenty-five different independent genetic maps were collected from 37 QTL studies. Through the iterative map editing tool in BioMercator v4.2.3, a consensus map was integrated using the published genetic maps and the synthetic reference map.

[0043] 3. Meta-QTL Identification

[0044] All the collected QTLs were plotted onto a consensus map using BioMercator V4.2.3, considering the CI, peak position, LOD score, and R 2 information of each QTL. The QTL projection process is mainly controlled by two parameters: the uniformity of the P-values of the flanking markers and the minimum distance ratio between maps. By default, these parameters are set to 0.25 and 0.50, respectively. The original QTLs that do not meet the criteria will be excluded. After projection onto the consensus map, MQTL analysis was performed using BioMercatorV4.2.3. Depending on the number of predicted QTLs, two methods were used for meta-analysis. If the number of predicted QTLs ≤ 10, the method proposed by Goffinet and Gerber, (2000) was used. Or, if the number of predicted QTLs exceeds 10, the method introduced by Veyrieras et al. (2007) was used. Using the optimal model selected in the first step, the vertex position and CI were determined. The average R 2 and LOD of the MQTLs containing the initial QTLs were considered as the R 2 and LOD values of the MQTLs.

[0045] 4. MQTL Genome Mapping and GWAS Validation

[0046] To determine the physical positions of MQTLs, the genomic positions of MQTL flanking markers were retrieved using the cotton genome database (CottonGen: https: / / www.cottongen.org / ). These markers were then mapped to the reference genome of Gossypium hirsutum TM-1. Any MQTL flanking markers for which no position was detected were excluded from further analysis. To verify the accuracy of the identified MQTL regions, ten genome-wide association studies related to cotton earliness published between 2016 and 2023 were identified. The sizes of the cotton populations studied in these GWASs ranged from 169 to 436, including Gossypium hirsutum and Gossypium barbadense. The physical positions of the relevant loci with the target traits obtained from these studies were similar to the determined MQTL physical positions.

[0047] 5. Candidate gene mining and expression pattern analysis

[0048] When the MQTL physical CI ≤ 2 Mb, gene information annotated directly from the genomic region was retrieved using the cotton functional genome database (https: / / cottonfgd.net / ). For MQTLs with a physical CI exceeding 2 Mb, a region of 1 Mb above and below the vertex position calculated using the physical peak calculation formula was used as the candidate segment, and all genes within this segment were annotated. To identify candidate genes (CGs) related to earliness, the expression patterns of the annotated genes were analyzed using transcriptome data. The relative expression levels of these genes at the three-leaf stage of early-maturing cotton (Zhongmiansuo 50 variety) and late-maturing cotton (Guoxinmian 11 variety) were compared. To comprehensively explore the transcriptional levels of differentially expressed genes in different tissues, the RNA-seq data of 16 tissues of Gossypium hirsutum published were used to study the expression patterns of DEGs.

[0049] II. Results and analysis

[0050] 1. Identification of original QTLs related to cotton earliness

[0051] Among the 37 published papers on QTL mapping of cotton earliness-related traits, these mappings mainly relied on biparental populations. The publication years of the papers were from 2002 to 2022, and a systematic analysis of the reported QTLs related to earliness was carried out. The year with the most published QTL mapping studies was 2013, accounting for 16.22% (6 / 37) of the total, followed by 2017, accounting for 13.51% (5 / 37). It is worth noting that QTL studies before 2007 and after 2017 were relatively few, and this trend is closely related to the progress of genotyping technology. Among the 37 papers, 28 (75.68%) were F 2Segregating populations, 7 articles (18.92%) were recombinant inbred line (RIL) populations, and 2 articles (5.41%) were backcross (BC) populations.

[0052] Through collection and analysis, 1096 QTLs related to early maturity in cotton were identified in 37 independent studies. After manual screening, the number of QTLs distributed on 26 chromosomes of upland cotton varied, showing significant heterogeneity. The At subgenome accounted for 40.15% (440 / 1096) of the total QTLs, and the t D subgenome accounted for 59.85% (656 / 1096). Chromosome D03 had the most QTLs, accounting for 16.74% (179), and chromosome D08 accounted for 6.64% (71). Only 13 and 14 QTLs were found on D04 and A04 respectively ( Figure 1 of B). These original QTLs were mainly divided into 9 groups according to their target traits, namely WGP, BOD, FBP, SP, FT, BOR, BP, FFBN, and HFFBN. Among them, the QTLs of FFBN, FT, and WGP had the highest proportions, 23.36% (256), 17.79% (195), and 17.24% (189) respectively, and were expected to be the QTLs determining the key traits of early maturity in cotton ( Figure 1 of A). Some key chromosomes related to FFBN, FT, and WGP have been identified. Specifically, the QTLs of FFBN were most abundant on chromosomes D01, D03, D08, and D11. Similarly, the QTLs of FT were mainly located on chromosomes A02, A11, D03, and D12. In addition, QTLs related to WGP were observed on chromosomes A12, D03, D07, and D10. More notably, more QTLs related to early maturity traits were found on D03. These results indicate that chromosome D03 is the focal region related to early maturity in cotton.

[0053] 2. Construction of a consensus genetic map of original QTLs related to early maturity in cotton

[0054] To improve the effective integration of QTLs, the individual genetic maps from previous studies were aligned with the reference map to facilitate the construction of a high-quality consensus genetic map. This map consisted of 5051 markers, with an area of 4192.58 cM. The average chromosome length was 161.25 cM, and the individual chromosome lengths ranged from 86.58 cM (A09) to 256.01 cM (D11) ( Figure 2 ). Chromosome A05 contained the most markers, and chromosome A04 had the shortest genetic distance. The marker density in the middle of the chromosomes was significantly higher than that at both ends. This difference may be due to the use of different genetic maps in constructing the consensus map, which included different markers and represented the most comprehensive integration of existing marker information.

[0055] 3. Meta-analysis of Initial QTLs for Early Maturity-related Traits in Cotton

[0056] Among the 1069 initial QTLs, 772 initial QTLs were successfully mapped onto the consensus map. After excluding MQTLs with only one QTL, 84 identified MQTL subsets were distributed on 24 chromosomes, accounting for 10.88% (84 / 772) of the total number of mapped QTLs. Notably, these 84 MQTLs were unevenly distributed on different subgenomes, accounting for 47.62% (40) on At chromosomes and 52.38% (44) on Dt chromosomes. Similarly, the 84 MQTLs were also unevenly distributed on different chromosomes. Chromosome D08 had the largest number of MQTLs (7); both A07 and D01 contained 6 MQTLs; chromosomes A01, A05, A11, A12, D02, D03, D04, and D12 each contained 2 MQTLs, while no MQTLs were detected on A02 and D13( Figure 3 B).

[0057] Among the identified MQTLs, 80.95% (68 / 84) contained 3 - 10 QTLs, and 15.47% (13 / 84) contained 11 - 20 QTLs. These 13 QTLs included MQTL-D02.2, MQTL-D08.3, MQTL-D12.1, MQTL-A12.1, MQTL-A11.1, MQTL-D12.2, MQTL-A12.2, MQTL-D08.1, MQTL-A08.1, MQTL-D01.2, MQTL-D02.1, MQTL-D10.3, MQTL-D07.3, and MQTL-D10.1. More significantly, three MQTLs, MQTL-D02.2 (26), MQTL-D03.1 (57), and MQTL-D03.2 (43), contained more than 20 QTLs, indicating that these three MQTLs are reliable and stable QTLs for early maturity-related traits in cotton( Figure 3 A). Each MQTL contained multiple QTLs from different populations, indicating that the identified MQTLs were highly associated with early maturity-related traits in cotton.

[0058] To evaluate the reliability and accuracy of the MQTL results, the average QTL count of MQTLs on each chromosome was calculated. The results showed that there were differences in the distribution of MQTLs and QTLs on different chromosomes. Although the number of MQTLs integrated on chromosomes A12, D02, and D03 was small, they contained many QTLs( Figure 3 C). These findings implied a high confidence in these MQTLs, which contained many authenticated QTLs.

[0059] 4. Genomic Location of MQTLs and GWAS Validation

[0060] To match MQTLs in the GWAS results, the physical MQTL regions in the TM-1 Gossypium hirsutum genome were determined. Among the 84 MQTLs identified, 39 had a physical CI less than 2 Mb. Subsequently, the physical vertex positions of the 84 MQTLs were calculated using the corresponding formula. For MQTLs containing more than three QTLs, precise genomic localization and confidence analysis were performed. Notably, although Dt has a shorter physical length, it exhibits more MQTLs and higher confidence ( Figure 4 ). Most MQTLs are located in gene-dense regions, providing a more reliable basis for identifying candidate genes. These four MQTLs, namely MQTL-A08.1, MQTL-D03.1, MQTL-D03.2, and MQTL-D12.1, are noteworthy because they have a larger number of initial QTLs, a larger R 2 value, and a lower CI. In contrast, it is worth noting that MQTL-D05.1 and MQTL-D06.1 have an overly high confidence interval, a large inclusion interval, and a low confidence level. After determining the MQTL physical intervals, it was observed that multiple MQTLs share overlapping physical intervals. For example, MQTL-A07.1 and MQTL-A07.2 have a common physical interval of 14.76 - 20.98 Mb, while the physical interval of MQTL-D08.6 is within MQTL-D08.7. In addition, the physical interval of MQTL-A01.2 is part of the repeat in MQTL-A01.1, MQTL-A07.5, and MQTL-A07.6. These MQTLs are evaluated based on factors such as confidence interval, R 2 value, and number of QTLs to determine their effective physical intervals.

[0061] In the published GWAS studies, a total of 741 significant snps related to early maturity traits were identified. These snps were co-localized with the physical intervals of the 84 identified MQTLs, and 37 MQTLs were mapped to 140 snps. Finally, five MQTLs, namely MQTL-A08.1, MQTL-D01.2, MQTL-D03.1, MQTL-D03.2, and MQTL-D12.1, with a high number of initial QTLs, a high R 2 value, a low CI, and strong co-localization, were successfully identified. This indicates that the key regions of these MQTLs can be used to identify CGs related to cotton early maturity ( Figure 5 ).

[0062] 5. Mining of candidate genes and analysis of expression patterns based on the transcriptome in the MQTL region

[0063] To identify candidate genes associated with early maturity, five MQTL regions (A08.1: 43.81-45.81 Mb, D01.2: 36.41-38.41 Mb, D03.1: 26.73-28.73 Mb, D03.2: 25.13-27.13 Mb, and D12.2: 27.37-29.37 Mb) were focused on. The results showed that a total of 118 genes were annotated within the five MQTL regions. The candidate genes were aligned with the TM-1_NBI genome using BLAST (Basic Local Alignment Search Tool), and genes with an overall transcriptional level close to zero were excluded. This process finally identified 75 candidate genes. Using the published transcriptome data, the gene expression profiles of these genes at the three-leaf stage of the early-maturing variety ZMS50 and the late-maturing variety GXM11 were analyzed. By adopting the criterion of a 1.5-fold relative expression difference between early-maturing and late-maturing materials, 9 DEGs were determined (see Figure 6 A, DEGs marked in blue and yellow). In addition, by performing RNA sequencing on 16 samples of the upland cotton line TM-1, the transcriptional levels of these DEGs were analyzed. Finally, it was found that GH_A08G1018 (GhMYOB7) was highly expressed in stems and stamens and lowly expressed in ovules and fibers ( Figure 6 B).

[0064] Example 2

[0065] I. Materials and Methods

[0066] 1. Real-time fluorescence quantitative PCR technology

[0067] To verify the results of the DEGs in Example 1, samples of the third true leaves and shoot apical meristems of 2 early-maturing varieties (Cotton Research Institute 50 and Cotton 113) and 2 late-maturing varieties (Guoxin Cotton 11 and Guoxin Cotton 3) were collected. The differentially expressed gene GhMYOB7 was selected, and specific primers for the target gene were designed using Primer Premier 5.0 for qRT-PCR verification. The transcriptional level of the housekeeping gene GhActin was used to normalize the expression level of the target gene. The 2 -ΔΔCT -method was used to calculate the relative expression levels of each template. SPSS26 software was used for significance testing.

[0068] 2. Virus-induced gene silencing (VIGS) technology

[0069] The coding sequence of the GhMYOB7 gene was obtained from the TM-1v2.1 genome, and primer pairs for cloning and silencing the GhMYOB7 gene were generated using Primer Premier 5. The silencing fragment was cloned into the TRV:00 (pYL156) expression vector to obtain an expression vector containing TRV:GhMYOB7. TRV:GhMYOB7, TRV:00 (negative control), and TRV:GhCLA1 (positive control), along with the helper vector pYL192, were transformed into the Agrobacterium strain GV3101. After the cotton cotyledons flattened, the bacterial suspension was injected into the cotyledons using a sterile syringe. Subsequently, it was placed in the dark for 24 hours and then transferred to a normal photoperiod incubator at 25°C. Once the positive control plants showed an albino phenotype after 7 days, RNA was extracted from the gene-silenced plants and control plants. The relative expression levels of the target gene in the gene-silenced plants and control plants were detected by qRT-PCR. According to the qRT-PCR expression data, the gene-silenced plants were placed in the greenhouse, and the germination and flowering times were recorded.

[0070] II. Experimental Methods

[0071] 1. Primer Design

[0072] The cloning primers, qRT-PCR primers, and VIGS silencing primers (the product fragment size of the VIGS silencing primers was 300 - 500 bp) of the GhMYOB7 gene were designed using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The primer sequences are shown in Table 1:

[0073] Table 1 Primer Sequence Information

[0074] Name Sequence (5’-3’) Remarks GhMYOB7-F CGGACCTGCTTGCTTGACAT(SEQ ID NO.3) Gene cloning GhMYOB7-R ACCGATGTCACTATTGCTTGCT(SEQ ID NO.4) Gene cloning GhMYOB7-F GCCTTCGCTTTTTCCCACAG(SEQ ID NO.5) qRT-PCR GhMYOB7-R TTGAAGTCAACCGAGCGTGG(SEQ ID NO.6) qRT-PCR GhMYOB7-F GCGGTGTCCCAAAGTACCAG(SEQ ID NO.7) Silencing fragment cloning GhMYOB7-R TAGTCGGGATCGGGATCGG(SEQ ID NO.8) Silencing fragment cloning

[0075] 2. RNA Extraction

[0076] 2.1 RNA Extraction and Reverse Transcription

[0077] Plant sample RNA was extracted according to the instructions of the polysaccharide polyphenol plant total RNA extraction kit. The RNA was reverse transcribed. Reverse transcription (synthesis of the first strand of cDNA):

[0078] a. The aliquoted RNA was taken out of the -80°C refrigerator according to your own needs and melted on ice. The 5×FastKing-RT SuperMix reagent and RNase-Free ddH 2 O were taken out of the -20°C refrigerator and melted on ice, and gently shaken and mixed;

[0079] b. The reaction system is shown in Table 2:

[0080] Table 2 Reverse transcription reaction system

[0081] Composition Volume (μL) Total RNA 2 5×FastKing-RTSuperMix 4 <![CDATA[RNase - Free ddH 2 O]]> Make up to 20μL

[0082] c. The reaction program is shown in Table 3:

[0083] Table 3 Reaction program

[0084] Temperature (℃) Time (min) 42 15 95 3

[0085] d. After the reaction is completed, detect the purity and concentration of cDNA, aliquot, and store at -20 °C.

[0086] 3. qRT-PCR

[0087] Using the third true leaf and shoot apical meristem of CCRI 50, CCRI 113, Guoxin Cotton 11, and Guoxin Cotton 3 as samples, dilute the cDNA in "2. RNA extraction" to 100 ng / μL. Detect the expression level of the target gene using the qRT-PCR primer pairs in Table 1. The reaction system of qRT-PCR is shown in Table 4.

[0088] Table 4 Reaction system

[0089] Composition Volume (μL) cDNA (100ng / μL) 2 BrightCycleUniversalSYBRGreenqPCR 10 Forward primer 2.4 Reverse primer 2.4 <![CDATA[RNase - Free ddH 2 O]]> Make up to 20μL

[0090] The reaction program of qRT-PCR is shown in Table 5.

[0091] Table 5 Reaction program

[0092]

[0093]

[0094] 4. Amplification of the target fragment, ligation to the cloning vector, and transformation

[0095] 4.1 Amplification of the target fragment

[0096] Using the cDNA of CCRI 113 as a template, amplify the target gene using the Taq 2×PCR Mix with Dye V2 premix (containing dye) kit and the gene cloning primer pairs in Table 1. The amplification system is shown in Table 6:

[0097] Table 6 Amplification system

[0098] Composition Volume (μL) Taq2×PCRMixwithDyeV2 (dyepius) 12.5 cDNA template (100ng / μl) Final concentration < 500 ng Primer-F (2.5μM) 2 Primer-R (2.5μM) 2 <![CDATA[ddH 2 O]]> Make up to 25μL

[0099] After adding the reaction solution according to the above system, gently shake and mix, centrifuge briefly, and perform the reaction according to the reaction program in Table 7:

[0100] Table 7 Amplification reaction program

[0101]

[0102] After the reaction was completed, 1% agarose gel electrophoresis was used to detect whether the size of the target gene was appropriate. Through sequencing, a gene fragment of GhMYOB7 from upland cotton was cloned, and its nucleotide sequence is shown in SEQ ID NO.1.

[0103] SEQ ID NO.1:

[0104]

[0105] 4.2 Ligation of the target gene and the cloning vector pEASY-T5 Zero

[0106] a. After taking out the pEASY-T5 Zero vector from the -80 °C refrigerator, thaw it on ice.

[0107] b. Calculate the volume of the added target fragment (the molar ratio of the vector to the target fragment = 1:5), and add the reaction system shown in Table 8 to a sterile 1.5 mL centrifuge tube (the whole operation is completed on ice):

[0108] Table 8 Ligation system

[0109] Component Volume (μL) pEASYR-T5ZeroCloningVector 1 Target PCR fragment 0.5-4 <![CDATA[ddH 2 O]]> Make up to 10μL

[0110] c. Gently shake and mix it, briefly centrifuge, and then ligate at 25 °C for 5 min.

[0111] 4.3 Transformation of DH5α E. coli competent cells

[0112] Use the heat shock method to transform the vector ligated with the target gene into DH5α E. coli competent cells, and verify and sequence the bacterial liquid PCR with the primers of the target gene sequence (completed by Shanghai Sangon Biotech Co., Ltd.).

[0113] 5. Construction of the silencing vector

[0114] Using the positive plasmid with successful sequencing in 4.3 as a template, use the silencing fragment cloning primers in Table 1 with the restriction enzyme cleavage sites and protection bases of EcoR I and Kpn I added to amplify the silencing fragment, and the sequence of the amplified silencing fragment is shown in SEQ ID NO.2.

[0115] SEQ ID NO.2:

[0116] GCGGTGTCCCAAAGTACCAGTCCAAGAGCAAAACTTCCCCCTAAATGTCAAAGAATAAAAACTTGTGAAGGTTCATCAGAGAAAGCCACTCCAAATTCTGCCAATTCTTCTAACACTGTTCATGATGTATTTGAAGTCCATTGCAAATTTGAAGTTCCAGAAAGCAGTGAAAGAAAAAAAAATTGTTTTAAAGGGGAAATGAACAAAGGGAAGTCATATGTGGAAGAAGATAATAGGCTTAATAAGCCAGATTTGTTCCTGATTGGATCACCTGTAGATGATGATAGTGACTGGTTCAGCAAGGACGACTTTCAAAGTCTAAAGCCTGGGAAAAAGGGATATAAACTGATTGACGAAATGAATCCTGATCCCGATCCCGATCCCGACTA。

[0117] The silencing fragment of GhMYOB7 was inserted into the silencing vector pYL156 (also known as TRV:00) by double digestion to construct the TRV:GhMYOB7 silencing vector. The specific digestion system is shown in Table 9:

[0118] Table 9 Digestion System

[0119] Component Volume (μL) Silencing fragment / TRV:00 2μg 10×QuickCutGreenBuffer 5μL EcoRI 2μL KpnI 2μL <![CDATA[ddH 2 O]]> Make up to 50μL

[0120] After reacting at 37°C for 15 min according to the above system, the PCR product of the target gene fragment was recovered by gel extraction, and the large fragment of the vector was recovered by digestion. The target fragment was ligated with the silencing vector, and the ligation product was transformed into competent Escherichia coli cells. Bacterial liquid PCR and double digestion identification were carried out. After completion, the positive plasmid was sequenced (Sangon Biotech, Shanghai) and transferred into competent Agrobacterium tumefaciens GV3101.

[0121] The steps for transforming Agrobacterium tumefaciens GV3101 are as follows:

[0122] a. Take out the competent GV3101 cells from the -80°C ultra-low temperature refrigerator, thaw them on ice, divide them into two tubes, pipette 2 μL of the successfully sequenced plasmid, add it to the centrifuge tube, and carry out the transformation.

[0123] b. After completing the above steps, add 350 μL of LB liquid medium (without antibiotics), shake and culture for 2 h (28°C, 200 rpm), and evenly coat the bacterial liquid on the solid medium (adding Kan + and Rif antibiotics), and culture for 2 d under dark conditions at 28°C.

[0124] c. After the cultivation is completed, pick a single colony into 5 mL of LB liquid medium (added with Kan + and Rif antibiotics), and cultivate for 16 h according to the shaking culture conditions in step b;

[0125] d. After the cultivation is completed, store the bacterial liquid with 50% glycerol (bacterial liquid: glycerol = 1:1, V:V), and store it at -80 °C for later use; perform bacterial liquid PCR to confirm the positive vector.

[0126] 6. VIGS silencing of target genes in upland cotton

[0127] Perform VIGS silencing on the seedlings of CCRI 113, and the specific method is as follows:

[0128] a. Plant the seeds of CCRI 113. When it grows to the seventh day and the cotyledons are fully unfolded, soak it in water until the nutrient soil in the flower pot absorbs the water to the surface, then stop soaking and set it aside for later use.

[0129] b. Add Kan+ and Rif to the LB liquid medium for later use, and the final concentrations of Kan+ and Rif are 50 μg / mL and 25 μg / mL respectively. Thaw the VIGS vector system and the bacterial liquid of the target gene taken out from -80 °C on ice, and activate it at 28 °C and 200 rpm for 16 h (bacterial liquid: LB liquid medium = 1:10, V:V). After the activation is completed, perform expansion propagation in the same proportion.

[0130] c. After the bacterial liquid expansion propagation is completed, centrifuge at a speed of 5000 rpm for 10 min, pour off the supernatant, retain the bacterial cells, and use a spectrophotometer to suspend the bacterial cells with the resuspension solution, and adjust the OD 600 to 1.8.

[0131] d. After the resuspension is completed, place it in the dark for 3 h to allow the bacterial cells to recover. Then, mix PYL192 with the resuspended bacterial cell solutions containing TRV:00 (as the blank control group), TRV:GhCLA1 (as the positive control group), and TRV:GhMYOB7 (as the experimental group) at a ratio of 1:1, and mix them well.

[0132] e. On the seventh day of the growth of upland cotton seedlings, soak them in water according to the method in step a. On the eighth day of the growth of upland cotton seedlings, perform VIGS injection. The specific operation is as follows: Make a cut on the back of the cotyledon with a 1 mL syringe needle (note that the wound should not be too large, just the size of the needle tip), and inject the mixed bacterial liquid in step d into the cotyledon of upland cotton, and try to make the bacterial liquid fill the entire cotyledon as much as possible.

[0133] f. After the injection is completed, in order to achieve a better infection effect, wrap it with a plastic bag, place it in the dark at 25 °C for 24 h, and then cultivate it under normal growth conditions.

[0134] 7. Identification of Silenced Plants

[0135] After the albino appearance of positive control Gossypium hirsutum seedlings, young leaves of G. hirsutum in the experimental group and the blank group were taken for fluorescence quantitative experiments to detect their silencing efficiency, and phenotypic observations were carried out in a timely manner.

[0136] III. Results and Analysis

[0137] 1. Expression Differences of GhMYOB7 Gene among Different Gossypium hirsutum Varieties

[0138] The transcriptional levels of GhMYOB7 gene at the three-leaf stage of early-maturing (CCRI 50 and CCRI 113) and late-maturing (Guoxinmian 11 and Guoxinmian 3) Gossypium hirsutum varieties were compared by qRT-PCR, and the results were as Figure 6 shown in C. It can be seen that at this developmental stage, there were significant differences in the relative transcriptional levels of GhMYOB7 between early-maturing and late-maturing varieties. The results indicate that this gene may be a candidate gene related to early-maturing traits.

[0139] 2. Functional Analysis of GhMYOB7 in Gossypium hirsutum

[0140] To confirm the function of key CGs in cotton, the endogenous expression level of GhMYOB7 was inhibited by VIGS technology, and its effect on cotton early maturity was evaluated. Based on the results of qRT-PCR, the expression levels of GhMYOB7 in two early-maturing varieties were relatively high, so CCRI 113 was selected as the target plant for VIGS. To determine the effect of target gene transcriptional inhibition on plant traits, plants with a 50% reduction in transcriptional level were selected for target gene silencing. The results showed that compared with TRV:00 plants, the plants with silenced GhMYOB7 showed a delayed flowering phenotype. The budding states of the two types of plants were as Figure 7 shown in A, and the flowering states were as Figure 7 shown in B. The average budding time of TRV:GhMYOB7 plants (the 50th day) was 6.17 days later than that of TRV:00 plants (the 44th day) Figure 7 shown in C. The average flowering time of TRV:GhMYOB7 plants (the 64th day) was significantly delayed by 5.57 days compared with that of TRV:00 plants (the 59th day) Figure 7 shown in D.

[0141] The above results indicate that the GhMYOB7 gene is a key gene related to flowering time, and GhMYOB7 may have a positive regulatory effect on cotton early-maturing traits.

[0142] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the design of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A type of upland cotton 7Gh The application of genetic biomaterials in regulating the early maturity traits of upland cotton is characterized by: The regulation of the early maturity trait of upland cotton refers to silencing the 7Gh Genetic delayed early maturity trait; the early maturity trait refers to budding time and flowering time; Said 7Gh The nucleotide sequence of the gene is shown in SEQ ID NO.1; The biological material is a silencing 7Gh Gene recombinant vector or silencing 7Gh Genetic recombinant bacteria.

2. A type of upland cotton 7Gh The application of the biomaterial containing the gene in breeding late-maturing varieties of upland cotton is characterized in that: The biological material is a silencing 7Gh Gene recombinant vector or silencing 7Gh Genetic recombinant bacteria; Said 7Gh The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A kind of silence 7Gh A recombinant vector of a gene, characterized in that Using virus-induced gene silencing technology, 7Gh The gene silencing fragment is cloned into the expression vector to obtain the recombinant vector; Said 7Gh The nucleotide sequence of the gene silencing fragment is shown in SEQ ID NO.

2.

4. A kind of silence 7Gh A recombinant bacterium containing a gene, characterized in that The recombinant bacteria comprises the recombinant vector according to claim 3.

5. A method for cultivating late-maturing varieties of upland cotton, characterized in that: Using the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4, silencing 7Gh Gene, which delays the budding and flowering of the upland cotton, thereby obtaining the upland cotton late-maturing variety; 7Gh The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. Detection of upland cotton plants 7Gh The application of qRT-PCR primer sets for gene expression level in early identification of late-maturing varieties of upland cotton is characterized in that: The qRT-PCR primer set includes a forward primer as shown in SEQ ID NO.5 and a reverse primer as shown in SEQ ID NO.6; 7Gh The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images