Application of GhNSRB in Regulating Early Maturity Traits of Upland Cotton

Through VIGS technology, the GhNSRB gene was silent, and the upland cotton plants appeared buds and blossomed early, solving the problem that traditional breeding methods were difficult to regulate the premature maturity traits of upland cotton, achieving significant early flowering and bud emergence, and providing gene resources for early maturity breeding.

CN118726462BActive Publication Date: 2025-06-24GANSU AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411048945.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-01
Publication Date
2025-06-24
Estimated Expiration
2044-08-01

AI Technical Summary

Technical Problem

The premature traits of upland cotton are complex and susceptible to environmental factors. Traditional breeding methods are progressing slowly. They lack genes to effectively regulate flowering time, making it difficult to cultivate premature upland cotton varieties.

Method used

VIGS technology silencing the GhNSRB gene in upland cotton plants, which prompted the early budding and flowering of upland cotton, verifying the negative regulatory function of GhNSRB in regulating the premature maturity traits of upland cotton.

Benefits of technology

The average budding time of plants that silenced the GhNSRB gene was 5.5 days earlier than the control plants, and the flowering time was significantly reduced by 4.5 days, providing an important genetic resource for the breeding of gene-edited premature molecular inland cotton.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118726462B_ABST
    Figure CN118726462B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of GhNSRB in regulating the early maturity traits of upland cotton, belonging to the technical field of genetic engineering. The present invention provides the application of the GhNSRB gene or its related biological materials in regulating the early maturity traits of upland cotton. The nucleotide sequence of the GhNSRB gene is shown as SEQ ID NO.1; the regulation of the early maturity traits of upland cotton means that the GhNSRB gene is silenced to enable the upland cotton to bud and flower earlier; the biological materials include a recombinant vector for silencing the GhNSRB gene and a recombinant bacterium for silencing the GhNSRB gene. By using the VIGS technology to silence the GhNSRB gene in upland cotton plants, the present invention can promote the upland cotton plants to bud and flower earlier, demonstrating that GhNSRB negatively regulates the early maturity traits of cotton, and providing important gene resources for gene-edited early maturity molecular breeding and early maturity variety identification of upland cotton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of GhNSRB in regulating the early maturity traits of upland cotton. Background Art

[0002] Upland cotton is a widely cultivated cotton and is the main source of natural fibers in the world. Early maturity is an important excellent trait of upland cotton, which can effectively avoid the influence of low temperature, thus being beneficial to expanding the planting of upland cotton and realizing large-scale mechanized planting and harvesting.

[0003] The early maturity of upland cotton is a complex trait, mainly including traits such as the whole growth period, seedling stage, bud stage, flowering and boll stage, the position of the first fruiting branch, the height of the first fruiting branch, and the percentage of bolls opened before frost. These traits are all quantitative traits, controlled by multiple quantitative trait loci, with a complex genetic mechanism and being easily affected by environmental factors. Therefore, the progress of traditional breeding methods is slow and the efficiency is low.

[0004] Previous studies have shown that histone methylation regulates flowering by regulating the key flowering gene FLC. However, upland cotton lacks the FLC gene, so it is more difficult to study the genes regulating the flowering time of upland cotton through histone methylation. Mining the genes controlling the early maturity traits of upland cotton is of great significance for cultivating early-maturing upland cotton varieties. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of GhNSRB in regulating the early maturity traits of upland cotton to solve the problems existing in the above-mentioned prior art. The present invention uses the VIGS technology to silence the GhNSRB gene in upland cotton plants, which can prompt the upland cotton plants to bud and flower earlier, confirming that GhNSRB negatively regulates the early maturity traits of cotton, and providing an important gene resource for gene editing early molecular breeding and early variety identification of upland cotton.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] The present invention provides the application of the GhNSRB gene or its related biological materials in regulating the early maturity traits of upland cotton, and the nucleotide sequence of the GhNSRB gene is as shown in SEQ ID NO.1;

[0008] The regulation of the early maturity traits of upland cotton means that silencing the GhNSRB gene in upland cotton causes the upland cotton to bud and flower earlier;

[0009] The biological materials include a recombinant vector for silencing the GhNSRB gene and a recombinant bacterium for silencing the GhNSRB gene.

[0010] The present invention provides the application of the GhNSRB gene or its related biological materials in cultivating early-maturing varieties of upland cotton, and the nucleotide sequence of the GhNSRB gene is as shown in SEQ ID NO.1;

[0011] The biological materials include a recombinant vector for silencing the GhNSRB gene and a recombinant bacterium for silencing the GhNSRB gene.

[0012] The present invention provides a recombinant vector for silencing the GhNSRB gene, and the nucleotide sequence of the GhNSRB gene is as shown in SEQ ID NO.1;

[0013] The construction method of the recombinant vector is to clone the silencing fragment of the GhNSRB gene onto an expression vector by using virus-induced gene silencing technology to obtain the recombinant vector.

[0014] Preferably, the nucleotide sequence of the silencing fragment of the GhNSRB gene is as shown in SEQ ID NO.2.

[0015] The present invention provides a recombinant bacterium for silencing the GhNSRB gene, and the recombinant bacterium contains the above recombinant vector.

[0016] The present invention provides a method for regulating the early-maturing traits of upland cotton. By using the above recombinant vector or the above recombinant bacterium to silence the GhNSRB gene in upland cotton plants, the upland cotton plants can bud and flower earlier; the nucleotide sequence of the GhNSRB gene is as shown in SEQ ID NO.1.

[0017] The present invention provides a method for cultivating early-maturing upland cotton plants. By using the above recombinant vector or the above recombinant bacterium to silence the GhNSRB gene in upland cotton plants, early-maturing upland cotton plants are obtained; the nucleotide sequence of the GhNSRB gene is as shown in SEQ ID NO.1.

[0018] The present invention provides a qRT-PCR primer set for detecting the expression level of the GhNSRB gene in upland cotton plants. The primer set includes a forward primer as shown in SEQ ID NO.5 and a reverse primer as shown in SEQ ID NO.6; the nucleotide sequence of the GhNSRB gene is as shown in SEQ ID NO.1.

[0019] The present invention provides the application of the above primer set in the early identification of early-maturing varieties of upland cotton.

[0020] The present invention discloses the following technical effects:

[0021] The GhNSRB gene was cloned from Gossypium hirsutum for the first time. By using the VIGS technology to silence this gene in late-maturing cotton materials, it was found that the average budding time of the gene-silenced plants was 5.5 days earlier than that of the control plants, and the average flowering time was significantly reduced by 4.5 days. This verified the function of this gene in regulating the early-maturing traits of Gossypium hirsutum and its negative regulatory mechanism, providing important gene resources for the gene-editing early-maturing molecular breeding of Gossypium hirsutum and having extremely high application value. The present invention also provides a primer set for detecting the expression level of the GhNSRB gene, providing technical guidance for the early identification of early-maturing varieties of Gossypium hirsutum. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0023] Figure 1 is the QTL information of cotton early-maturing related traits reported by predecessors; (A) The QTL distributions of early-maturing related traits are different; (B) The distributions of QTLs on the chromosomes of Gossypium hirsutum;

[0024] Figure 2 is the marker distribution of the original QTL consensus genetic map of cotton early-maturing related traits; The density of markers on the chromosome gradually decreases from high to low, and the color changes from black to blue;

[0025] Figure 3 is the basic information of the MQTL obtained through meta-analysis; (A) The number of MQTLs containing different numbers of QTLs; (B) The number of MQTLs on different chromosomes and the average number of initial QTLs in each MQTL; The color gradient from red to green indicates the decrease in the number of QTLs in the MQTL; (C) The narrowing of the confidence interval (95% CI) of the initial QTL; The average lengths (cM) of the CIs of the MQTL and the initial QTL on each chromosome are represented by orange and gray bars respectively; The green solid line indicates that the CI size of the MQTL is reduced by 1 / 2;

[0026] Figure 4 is the chromosomal distribution of the identified MQTL; The circles from the innermost to the outermost represent the confidence interval, R 2 value, the number of initial QTLs, the physical position of the MQTL, the gene density, and the physical map (Mb);

[0027] Figure 5GWAS validation results for significant SNPs related to cotton early maturity traits; the innermost layer represents QTL clusters that make up different MQTLs; around the core layer are significant SNPs identified through genome-wide association studies (GWAS) conducted on different natural populations; different colors on the periphery represent changes in the number of juxtaposed SNPs;

[0028] Figure 6 Identification results of the expression patterns of candidate genes related to cotton early maturity traits; (A) Fold change in relative expression of 75 candidate genes between early-maturing (ZMS50) and late-maturing (GXM11) plants; (B) Expression patterns of 9 genes in 16 upland cotton tissues; (C) Relative expression levels of GhNSRB at the three-leaf stage of early-maturing and late-maturing varieties;

[0029] Figure 7 Phenotypic statistics results of GhNSRB-silenced upland cotton plants; (A) Bud appearance status diagram of TRV:GhNSRB plants (day 55) and TRV:00 plants (day 62); (B) Difference in bud appearance time between TRV:00 and TRV:GhNSRB plants; (C) Flowering status diagram of TRV:GhNSRB plants (day 78) and TRV:00 plants (day 83); (D) Difference in flowering time between TRV:00 and TRV:GhNSRB plants; *p < 0.05, **p < 0.01 indicate statistically significant differences. Detailed implementation manners

[0030] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0033] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the description of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the description of the present invention are obvious to those skilled in the art. The description and examples of the present invention are merely exemplary.

[0034] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0035] General description: The vectors TRV:00 (i.e., pYL156), pYL192 and TRV:GhCLA1 used in the embodiments of the present invention were all donated by the Transgenic Research Group of the Cotton Research Institute, Chinese Academy of Agricultural Sciences.

[0036] Example 1

[0037] I. Materials and methods

[0038] 1. Collection of original QTLs related to early maturity traits in cotton

[0039] Through screening, previous studies on QTL mapping of early maturity traits in cotton were retrieved. The criteria for the collection of original QTLs are as follows: original QTL-related traits, mapping population type, population size, LOD value, R 2 or phenotypic variance explained (PVE) value, and the peak position of the original QTL. If the peak position of the original QTL is missing, the average value of the surrounding markers is used instead. Similarly, when R 2 and LOD are missing, 10% and 3 are used respectively. If the confidence interval (CI) of the original QTL cannot be determined, the following formula is adopted:

[0040] Recombinant inbred lines (RILs): CI = 163 / (population size × R 2 );

[0041] F2 and backcross populations (BC): CI = 530 / (population size × R 2 ).

[0042] 2. Construction of a consensus genetic map

[0043] To more effectively integrate the original QTLs, two commonly used multi-marker genetic maps were combined to construct a reference genetic map. These maps included "CCRI 12-4×(AD)5-7,F2" and "TM-1x 3-79,RIL(v3)". For MQTL studies, the R package LPmerge was used to generate the reference map. This method can effectively solve the position conflicts caused by inconsistent marker orders in different maps. Twenty-five different independent genetic maps were collected from 37 QTL studies. Through the iterative map editing tool in BioMercator v4.2.3, using the published genetic maps and the synthesized reference map, a consensus map was integrated.

[0044] 3. Meta-QTL Identification

[0045] All the collected QTLs were plotted into a consensus map using BioMercator V4.2.3, considering the CI, peak position, LOD score, and R 2 information of each QTL. The QTL projection process was mainly controlled by two parameters: the uniformity of the P-values of the flanking markers and the minimum distance ratio between maps. By default, these parameters were set to 0.25 and 0.50, respectively. The original QTLs that did not meet the criteria were excluded. After projection onto the consensus map, MQTL analysis was performed using BioMercator V4.2.3. According to the number of predicted QTLs, two methods were used for meta-analysis. If the number of predicted QTLs ≤ 10, the method proposed by Goffinet and Gerber, (2000) was adopted. Or, if the number of predicted QTLs exceeded 10, the method introduced by Veyrieras et al. (2007) was used. Using the optimal model selected in the first step, the vertex position and CI were determined. The average R 2 and LOD of the MQTLs containing the initial QTLs were considered as the R 2 and LOD values of the MQTLs.

[0046] 4. MQTL Genome Localization and GWAS Validation

[0047] To determine the physical positions of MQTLs, the genomic positions of MQTL flanking markers were retrieved using the cotton genome database (CottonGen: https: / / www.cottongen.org / ). These markers were then mapped to the reference genome of Gossypium hirsutum TM-1. Any MQTL flanking markers for which no position was detected were excluded from further analysis. To verify the accuracy of the identified MQTL regions, ten genome-wide association studies related to cotton earliness published between 2016 and 2023 were identified. The sizes of the cotton populations studied in these GWASs ranged from 169 to 436, including Gossypium hirsutum and Gossypium barbadense. The physical positions of the relevant loci with the target traits obtained from these studies were similar to the determined MQTL physical positions.

[0048] 5. Candidate gene mining and expression pattern analysis

[0049] When the MQTL physical CI ≤ 2 Mb, gene information annotated directly from the genomic region was retrieved using the cotton functional genome database (https: / / cottonfgd.net / ). For MQTLs with a physical CI exceeding 2 Mb, a region of 1 Mb above and below the vertex position calculated using the physical peak calculation formula was used as the candidate segment, and all genes within this segment were annotated. To identify candidate genes (CGs) related to earliness, the expression patterns of the annotated genes were analyzed using transcriptome data. The relative expression levels of these genes at the three-leaf stage of early-maturing cotton (Zhongmiansuo 50 variety) and late-maturing cotton (Guoxinmian 11 variety) were compared. To comprehensively explore the transcriptional levels of differentially expressed genes in different tissues, the RNA-seq data of 16 tissues of Gossypium hirsutum published were used to study the expression patterns of DEGs.

[0050] II. Results and analysis

[0051] 1. Identification of original QTLs related to cotton earliness

[0052] Among the 37 published papers on QTL mapping of cotton early-maturing related traits, these mappings mainly rely on biparental populations. The publication years of the papers were from 2002 to 2022, and a systematic analysis of the reported QTLs related to early maturity was carried out. The year with the most published QTL mapping studies was 2013, accounting for 16.22% (6 / 37) of the total, followed by 2017, accounting for 13.51% (5 / 37). It is worth noting that QTL studies before 2007 and after 2017 were relatively few, and this trend is closely related to the progress of genotyping technology. Among the 37 literatures, 28 (75.68%) were F2 segregation populations, 7 (18.92%) were recombinant inbred line (RIL) populations, and 2 (5.41%) were backcross (BC) populations.

[0053] Through collection and analysis, 1096 QTLs related to cotton early maturity were identified in 37 independent studies. After manual screening, there were differences in the number of QTLs distributed on 26 chromosomes of Gossypium hirsutum, showing great heterogeneity. A t sub-genome accounted for 40.15% (440 / 1096) of the total QTLs, and D t sub-genome accounted for 59.85% (656 / 1096). The chromosome with the most QTLs was D03, accounting for 16.74% (179), and chromosome D08 accounted for 6.64% (71). Only 13 and 14 QTLs were found on D04 and A04 respectively ( Figure 1 of B). These original QTLs were mainly divided into 9 groups according to their target traits, namely WGP, BOD, FBP, SP, FT, BOR, BP, FFBN, and HFFBN. Among them, the QTLs of FFBN, FT, and WGP had the highest proportions, 23.36% (256), 17.79% (195), and 17.24% (189) respectively, and were expected to become QTLs determining the key traits of cotton early maturity ( Figure 1 of A). Some key chromosomes related to FFBN, FT, and WGP have been determined. Specifically, the QTLs of FFBN were the most abundant on chromosomes D01, D03, D08, and D11. Similarly, the QTLs of FT were mainly mapped on chromosomes A02, A11, D03, and D12. In addition, QTLs related to WGP were observed on chromosomes A12, D03, D07, and D10. More notably, more QTLs related to early-maturing traits were found on D03. These results indicate that chromosome D03 is the focal region related to cotton early maturity.

[0054] 2. Construction of a consensus genetic map of original QTLs related to cotton early-maturing traits

[0055] To improve the effective integration of QTLs, the individual genetic maps from previous studies were aligned with the reference map to facilitate the construction of a high-quality consensus genetic map. This map consists of 5051 markers and has an area of 4192.58 cM. The chromosome average is 161.25 cM, and the individual chromosome lengths range from 86.58 cM (A09) to 256.01 cM (D11)( Figure 2 ). Chromosome A05 contains the most markers, and chromosome A04 has the shortest genetic distance. The marker density in the middle of the chromosome is significantly higher than that at both ends. This difference may be due to the use of different genetic maps in constructing the consensus map, which contains different markers and represents the most comprehensive integration of the existing marker information.

[0056] 3. Meta-analysis of Initial QTLs Related to Early Maturity in Cotton

[0057] Among the 1069 initial QTLs, 772 initial QTLs were successfully mapped onto the consensus map. After excluding the MQTLs with only one QTL, 84 identified MQTL subsets were distributed on 24 chromosomes, accounting for 10.88% (84 / 772) of the total number of mapped QTLs. Notably, these 84 MQTLs were unevenly distributed across different subgenomes, with 47.62% (40) on chromosome A t and 52.38% (44) on chromosome D t . Similarly, the 84 MQTLs were also unevenly distributed across different chromosomes. Chromosome D08 had the largest number of MQTLs (7); both A07 and D01 contained 6 MQTLs; chromosomes A01, A05, A11, A12, D02, D03, D04, and D12 each contained 2 MQTLs, while no MQTLs were detected on A02 and D13( Figure 3 B).

[0058] Among the identified MQTLs, 80.95% (68 / 84) contained 3 - 10 QTLs, and 15.47% (13 / 84) contained 11 - 20 QTLs. These 13 QTLs included MQTL-D02.2, MQTL-D08.3, MQTL-D12.1, MQTL-A12.1, MQTL-A11.1, MQTL-D12.2, MQTL-A12.2, MQTL-D08.1, MQTL-A08.1, MQTL-D01.2, MQTL-D02.1, MQTL-D10.3, MQTL-D07.3, and MQTL-D10.1. More significantly, there were 3 MQTLs, MQTL-D02.2 (26), MQTL-D03.1 (57), and MQTL-D03.2 (43), which contained more than 20 QTLs, indicating that these 3 MQTLs are reliable and stable QTLs related to early maturity traits in cotton. Figure 3A). Each MQTL contains multiple QTLs from different populations, indicating that the identified MQTLs are highly associated with cotton early maturity-related traits.

[0059] To evaluate the reliability and accuracy of the MQTL results, the average number of QTLs on each chromosome MQTL was calculated. The results showed that there were differences in the distribution of MQTLs and QTLs on different chromosomes. Although the number of MQTLs integrated on chromosomes A12, D02, and D03 was small, they contained many QTLs ( Figure 3 C). These findings imply a high confidence in these MQTLs, which contain many validated QTLs.

[0060] 4. Genomic mapping of MQTLs and GWAS validation

[0061] To match MQTLs in the GWAS results, the physical MQTL regions in the TM-1 upland cotton genome were determined. Among the 84 identified MQTLs, 39 had a physical CI less than 2 Mb. Subsequently, the physical vertex positions of the 84 MQTLs were calculated using the corresponding formula. For MQTLs containing more than three QTLs, precise genomic mapping and confidence analysis were performed. Notably, although D t had a shorter physical length, it showed more MQTLs and higher confidence ( Figure 4 ). Most MQTLs were located in gene-dense regions, providing a more reliable basis for identifying candidate genes. These 4 MQTLs, namely MQTL-A08.1, MQTL-D03.1, MQTL-D03.2, and MQTL-D12.1, were notable because they had more initial QTL numbers, larger R 2 values, and lower CIs. In contrast, it was notable that MQTL-D05.1 and MQTL-D06.1 had overly wide confidence intervals, large inclusion intervals, and low confidence levels. After determining the physical intervals of MQTLs, it was observed that multiple MQTLs shared overlapping physical intervals. For example, MQTL-A07.1 and MQTL-A07.2 had a common physical interval of 14.76 - 20.98 Mb, while the physical interval of MQTL-D08.6 was within that of MQTL-D08.7. In addition, the physical interval of MQTL-A01.2 was part of the repeat in MQTL-A01.1, MQTL-A07.5, and MQTL-A07.6. These MQTLs were evaluated based on factors such as confidence intervals, R 2 values, and the number of QTLs to determine their effective physical intervals.

[0062] In the published GWAS studies, a total of 741 significant SNPs related to early maturity traits were identified. These SNPs were co-located with the physical intervals of 84 identified MQTLs, and 37 MQTLs were mapped to 140 SNPs. Finally, 5 MQTLs with high initial QTL number, high R 2 high, low CI, and strong co-association, namely MQTL-A08.1, MQTL-D01.2, MQTL-D03.1, MQTL-D03.2, and MQTL-D12.1, were successfully identified. This indicates that the key regions of these MQTLs can be used to identify CGs related to cotton early maturity ( Figure 5 ).

[0063] 5. Mining of candidate genes and analysis of expression patterns based on the transcriptome in MQTL regions

[0064] To identify candidate genes related to early maturity, five MQTL regions (A08.1: 43.81 - 45.81 Mb, D01.2: 36.41 - 38.41 Mb, D03.1: 26.73 - 28.73 Mb, D03.2: 25.13 - 27.13 Mb, and D12.2: 27.37 - 29.37 Mb) were focused on. The results showed that a total of 118 genes were annotated within the five MQTL regions. The candidate genes were aligned with the TM-1_NBI genome using BLAST (Basic Local Alignment Search Tool), and genes with an overall transcriptional level close to zero were excluded. This process finally identified 75 candidate genes. Using the published transcriptome data, the gene expression characteristics of these genes at the three-leaf stage of the early-maturing variety ZMS50 and the late-maturing variety GXM11 were analyzed. By adopting the criterion of a 1.5-fold relative expression difference between early-maturing and late-maturing materials, 9 DEGs were determined (see Figure 6 A, DEGs marked in blue and yellow). In addition, by performing RNA sequencing on 16 samples of the upland cotton line TM-1, the transcriptional levels of these DEGs were analyzed. Finally, it was found that GH_D03G0847 (GhNSRB) was highly expressed in stems and stamens and lowly expressed in ovules and fibers ( Figure 6 B).

[0065] Example 2

[0066] I. Materials and Methods

[0067] 1. Real-time fluorescence quantitative PCR technology

[0068] To verify the results of DEG in Example 1, samples of the third true leaves and shoot apical meristems of two early-maturing varieties (CCRI 50 and CCRI 113) and two late-maturing varieties (Guoxin Cotton 11 and Guoxin Cotton 3) were collected. The differentially expressed gene GhNSRB was selected, and qRT-PCR specific primers for the target gene were designed using Primer Premier 5.0 for qRT-PCR verification. The expression level of the target gene was normalized using the transcription level of the housekeeping gene GhActin. The relative expression levels of each template were calculated using the 2 -ΔΔCT method. SPSS 26 software was used for significance testing.

[0069] 2. Virus-induced gene silencing (VIGS) technology

[0070] Primer Premier 5 was used to generate primer pairs for the GhNSRB gene silencing experiment, and the silencing fragment was amplified. The silencing fragment was cloned into the TRV:00 expression vector to obtain an expression vector containing TRV:GhNSRB. TRV:GhNSRB, TRV:00 (negative control), and TRV:GhCLA1 (positive control), as well as the helper vector pYL192, were respectively transformed into the Agrobacterium strain GV3101. After the cotton cotyledons flattened, the bacterial solution was injected into the cotyledons using a sterile syringe. Subsequently, it was placed in the dark for 24 hours and then transferred to a normal photoperiod incubator at 25°C. Once the positive control plants showed an albino phenotype after 7 days, RNA was extracted from the gene-silenced plants and control plants. The relative expression levels of the target gene in the gene-silenced plants and control plants were detected by qRT-PCR. According to the qRT-PCR expression data, 80% of the plants successfully achieved gene silencing. The gene-silenced plants were placed in the greenhouse, and the budding and flowering times were recorded.

[0071] II. Test methods

[0072] 1. Primer design

[0073] NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to design cloning primers, qRT-PCR primers, and VIGS silencing primers for the GhNSRB gene (the product fragment size of the VIGS silencing primers was 300 - 500 bp). The primer sequences are shown in Table 1:

[0074] Table 1 Primer sequence information

[0075] Name Sequence (5’-3’) Remarks GhNSRB-F TCCATCTGCCGGCATTTTTG (SEQ ID NO.3) Gene cloning GhNSRB-R CCACCACTCCAATAAACATCTTCAG (SEQ ID NO.4) Gene cloning GhNSRB-F AAGGCATAGAGATGAATCCTGGAG (SEQ ID NO.5) qRT-PCR GhNSRB-R ATTCCCATGAAGAACCGGGC (SEQ ID NO.6) qRT-PCR GhNSRB-F AGAACTTCAAGGACCTCGGC (SEQ ID NO.7) Silencing fragment cloning GhNSRB-R GCCCAGGAGACAAAATCCCT (SEQ ID NO.8) Silencing fragment cloning

[0076] 2. RNA extraction

[0077] 2.1 RNA extraction and reverse transcription

[0078] Extract the RNA of plant samples according to the instruction manual of the Polysaccharide Polyphenol Total Plant RNA Extraction Kit. Reverse transcribe the RNA. Reverse transcription (synthesis of the first strand of cDNA):

[0079] a. Take out the aliquoted RNA from the -80 °C refrigerator according to your own needs and melt it on ice. Take out the 5×FastKing-RT SuperMix reagent and RNase-Free ddH2O from the -20 °C refrigerator and melt them on ice. Gently shake and mix well;

[0080] b. The reaction system is shown in Table 2:

[0081] Table 2 Reverse transcription reaction system

[0082] Composition Volume (μL) Total RNA 2 5×FastKing-RT SuperMix 4 <![CDATA[RNase - Free ddH2O]]> Make up to 20 μL

[0083] c. The reaction program is shown in Table 3:

[0084] Table 3 Reaction program

[0085] Temperature (℃) Time (min) 42 15 95 3

[0086] d. After the reaction is completed, detect the purity and concentration of the cDNA, aliquot it, and store it at -20 °C.

[0087] 3. qRT-PCR

[0088] Using the third true leaves and shoot apical meristems of CCRI 50, CCRI 113, Guoxin Cotton 11, and Guoxin Cotton 3 as samples, dilute the cDNA in "2. RNA Extraction" to 100 ng. Detect the expression level of the target gene using the qRT-PCR primer pairs in Table 1. The reaction system of qRT-PCR is shown in Table 4:

[0089] Table 4 Reaction system

[0090] Composition Volume (μL) cDNA (100 ng / μL) 2 BrightCycle Universal SYBR Green qPCR 10 Forward primer 2.4 Reverse primer 2.4 <![CDATA[RNase - Free ddH2O]]> Make up to 20 μL

[0091] The reaction program of qRT-PCR is shown in Table 5.

[0092] Table 5 Reaction program

[0093]

[0094] 4. Amplification of the target fragment, ligation with the cloning vector, and transformation

[0095] 4.1 Amplification of the target fragment

[0096] Using the cDNA of CCRI 113 as a template, the target gene was amplified using the Taq 2×PCR Mix with Dye V2 premix (containing dye) kit and the gene cloning primer pairs in Table 1. The amplification system is shown in Table 6:

[0097] Table 6 Amplification system

[0098] Composition Volume (μL) Taq 2×PCR Mix with Dye V2 (dye plus) 12.5 cDNA template (100 ng / μl) Final concentration < 500 ng Primer-F (2.5 μM) 2 Primer-R (2.5 μM) 2 <![CDATA[ddH2O]]> Make up to 25 μL

[0099] After adding the reaction solution according to the above system, gently shake and mix well, briefly centrifuge, and carry out the reaction according to the reaction program in Table 7:

[0100] Table 7 Amplification reaction program

[0101]

[0102] After the reaction, 1% agarose gel electrophoresis was used to detect whether the size of the target gene was appropriate. After sequencing, the gene fragment of GhNSRB in upland cotton was cloned, and its nucleotide sequence is shown in SEQ ID NO.1.

[0103] SEQ ID NO.1:

[0104] CCATCTGCCGGCATTTTTGTCCTCTTAACTTTCCTTGTATTCTCCCTACTTGGTTTCAAAATTCAACATGGATTCATCAGATTTTCCTACAAGTAGATCACCTAGAAAAGAACTTCAAGGACCTCGGCCGGCTCCTTTGAAGGTCCGTAAAGACTCGTACAAGATCAAGAAACCTCCATTGGCACCACAACCACTGCTGCAGCAGCAACAACAACAACAACCAATCCAGATAAGGCCTCCCGTAATCATCTACACTGTGTCACCAAAGGTGATCCATACTAACCCTAGCGACTTCATGAACCTAGTGCAACGCCTTACAGGATCAACATCATCATCGTCTTCGGGATCTTCAACGCTTCCGCCATCAACATCCGATCACCCAATATTCAGTGATACTACCAGTGGTGCGATCTCACCAGCAGCAAGGTTTGCTACAATAGAGAAAACCAAGCCACCTGCAGAAGTGAAACGACAACAAATTTATGAAGAAAACTATGGATTTGTACAAGGCATAGAGATGAATCCTGGAGTTGAAAGGATAAGTTTGTTTCCAGGGATTTTGTCTCCTGGGCCAACCTCACTGCCTCGGATATCACCAAACTTCTTCTCACCACCGTCTGATCCAAACTCAATCGGTTTCTTCCATGATTTGAGCCCGGTTCTTCATGGGAATAGGAATTTCATAGAAGGTAGTTTCATGCCTAGTCCTTCAAGCTTTAATATTTCACCTTTTTCCATACCGTCTCCTACTACTCCATCAATAGACCTTTTCAACAATTTCTTTGACCTTTAAAGAAATATTTTTTCTTTAGGAAGATATACAAATAGAAATTCATTTCCCTTTGATTTATGGGGTTTCTGAAGATGTTTATTGGAGTGGTGG。

[0105] 4.2 Ligation of the target gene and the cloning vector pEASY-T5 Zero

[0106] a. After taking out the pEASY-T5 Zero vector from the -80 °C refrigerator, thaw it on ice.

[0107] b. Calculate the volume of the added target fragment (the molar ratio of vector to target fragment = 1:5), and add the reaction system shown in Table 8 to a sterile 1.5 mL centrifuge tube (the whole operation is completed on ice):

[0108] Table 8 Ligation system

[0109] Component Volume (μL) pEASY-T5 Zero Cloning Vector 1 Target PCR fragment 0.5-4 <![CDATA[ddH2O]]> Make up to 10 μL

[0110] c. Gently shake and mix it, briefly centrifuge, and then ligate at 25 °C for 5 min.

[0111] 4.3 Transformation of DH5α E. coli competent cells

[0112] Use the heat shock method to transform the vector ligated with the target gene into DH5α E. coli competent cells, and verify and sequence the bacterial liquid PCR with the primers of the target gene sequence (completed by Shanghai Sangon Biological Engineering Co., Ltd.).

[0113] 5. Construction of the silencing vector

[0114] Using the positive plasmid with successful sequencing in 4.3 as the template, use the silencing fragment cloning primers in Table 1 that add the restriction enzyme cleavage sites and protection bases of EcoR I and Kpn I to amplify the silencing fragment, and the sequence of the amplified silencing fragment is shown in SEQ ID NO.2.

[0115] SEQ ID NO.2:

[0116] AGAACTTCAAGGACCTCGGCCGGCTCCTTTGAAGGTCCGTAAAGACTCGTACAAGATCAAGAAACCTCCATTGGCACCACAACCACTGCTGCAGCAGCAACAACAACAACAACCAATCCAGATAAGGCCTCCCGTAATCATCTACACTGTGTCACCAAAGGTGATCCATACTAACCCTAGCGACTTCATGAACCTAGTGCAACGCCTTACAGGATCAACATCATCATCGTCTTCGGGATCTTCAACGCTTCCGCCATCAACATCCGATCACCCAATATTCAGTGATACTACCAGTGGTGCGATCTCACCAGCAGCAAGGTTTGCTACAATAGAGAAAACCAAGCCACCTGCAGAAGTGAAACGACAACAAATTTATGAAGAAAACTATGGATTTGTACAAGGCATAGAGATGAATCCTGGAGTTGAAAGGATAAGTTTGTTTCCAGGGATTTTGTCTCCTGGGC。

[0117] The silencing fragment of GhNSRB was inserted into the silencing vector pYL156 (also known as TRV:00) by double digestion to construct the TRV:GhNSRB silencing vector. The specific digestion system is shown in Table 9:

[0118] Table 9 Digestion System

[0119] Component Volume (μL) Silencing fragment / TRV:00 2 μg 10×QuickCut Green Buffer 5 μL EcoRI 2 μL KpnI 2 μL <![CDATA[ddH2O]]> Make up to 50 μL

[0120] After reacting at 37°C for 15 min according to the above system, the target gene fragment PCR product was recovered by gel extraction, and the large fragment of the vector was recovered by digestion. The target fragment was ligated with the silencing vector, and the ligation product was transformed into Escherichia coli competent cells. Bacterial liquid PCR and double digestion identification were carried out. After completion, the positive plasmid was sequenced (Sangon Biotech, Shanghai) and transferred into Agrobacterium tumefaciens GV3101 competent cells.

[0121] The steps for transforming Agrobacterium tumefaciens GV3101 are as follows:

[0122] a. Take out the GV3101 competent cells from the -80°C ultra-low temperature freezer, thaw them on ice, divide them into two tubes, pipette 2 μL of the successfully sequenced plasmid, add it to the centrifuge tube, and carry out the transformation.

[0123] b. After completing the above steps, add 350 μL of LB liquid medium (without antibiotics), and incubate with shaking for 2 h (at 28 °C, 200 rpm). Then evenly spread the bacterial solution on the solid medium (supplemented with Kan + and Rif antibiotics), and culture for 2 d under dark conditions at 28 °C.

[0124] c. After the culture is completed, pick a single colony into 5 mL of LB liquid medium (supplemented with Kan + and Rif antibiotics), and culture according to the shaking culture conditions in step b for 16 h;

[0125] d. After the culture is completed, store the bacterial solution with 50% glycerol (bacterial solution:glycerol = 1:1, V:V) at -80 °C for later use; perform bacterial solution PCR to confirm the positive vector.

[0126] 6. Silencing the target gene in upland cotton by VIGS

[0127] Perform VIGS silencing on Guoxin cotton 3 seedlings, and the specific method is as follows:

[0128] a. Plant Guoxin cotton 3 seeds. When it grows to the seventh day and the cotyledons are fully unfolded, soak it in water until the nutrient soil in the flower pot absorbs the water to the surface, then stop soaking and set it aside for later use.

[0129] b. Add Kan+ and Rif to the LB liquid medium for later use, with the final concentrations of Kan+ and Rif being 50 μg / mL and 25 μg / mL respectively. Thaw the VIGS vector system and the bacterial solution of the target gene taken out from -80 °C on ice, and activate at 28 °C, 200 rpm for 16 h (bacterial solution:LB liquid medium = 1:10, V:V). After activation, perform expansion propagation at the same ratio.

[0130] c. After the bacterial solution expansion propagation is completed, centrifuge at a speed of 5000 rpm for 10 min, pour off the supernatant, retain the bacterial cells, and resuspend the bacterial cells with the resuspension solution using a spectrophotometer, and adjust the OD 600 to 1.8.

[0131] d. After resuspension is completed, place it in the dark for 3 h to allow the bacterial cells to recover. Then mix PYL192 with the resuspended bacterial cell solutions containing TRV:00 (as the blank control group), TRV:GhCLA1 (as the positive control group), and TRV:GhNSRB (as the experimental group) at a ratio of 1:1, and mix them well.

[0132] e. On the 7th day of the growth of Gossypium hirsutum seedlings, immerse them in water according to the method in step a. On the 8th day of the growth of Gossypium hirsutum seedlings, perform VIGS injection on them. The specific operation is as follows: Make incisions on the back of the cotyledons with a 1 mL syringe needle (note that the wound should not be too large, just the size of the needle tip), and inject the mixed bacterial solution in step d into the cotyledons of Gossypium hirsutum, making the bacterial solution fill the entire cotyledon as much as possible.

[0133] f. After the injection is completed, in order to achieve a better infection effect, wrap it with a plastic bag, place it in the dark at 25 °C for 24 h, and then culture it under normal growth conditions.

[0134] 7. Identification of silenced plants

[0135] After the positive control Gossypium hirsutum seedlings show albinism, take the young leaves of the experimental group and the blank group of Gossypium hirsutum for fluorescence quantitative experiments to detect their silencing efficiency, and observe the phenotypes in a timely manner.

[0136] III. Results and analysis

[0137] 1. Expression differences of GhNSRB gene among different Gossypium hirsutum varieties

[0138] The transcriptional levels of GhNSRB gene in the three-leaf stage of early-maturing (Cotton Research Institute 50 and CCRI 113) and late-maturing (Guoxin Cotton 11 and Guoxin Cotton 3) Gossypium hirsutum varieties were compared by qRT-PCR. The results are as Figure 6 shown in Figure C. It can be seen that at this developmental stage, there are significant differences in the relative transcriptional levels of GhNSRB between early-maturing and late-maturing varieties. The results indicate that this gene may be a candidate gene related to the early-maturing trait.

[0139] 2. Functional analysis of GhNSRB in Gossypium hirsutum

[0140] To confirm the function of GhNSRB in cotton, the endogenous expression level of GhNSRB was inhibited by VIGS technology, and its effect on the early maturity of cotton was evaluated. Based on the results of qRT-PCR, the expression levels of GhNSRB in two late-maturing varieties were relatively high. Therefore, Guoxin Cotton 3 was selected as the receptor plant for VIGS. To determine the effect of target gene transcriptional inhibition on plant traits, plants with a transcriptional level reduced by half were selected for target gene silencing. The results show that the TRV:GhNSRB plants showed budding earliest (on the 55th day), followed by the TRV:00 plants (on the 62nd day). The budding states of the two types of plants are as Figure 7 shown in Figure A. Through statistical analysis of the budding times of the two types of plants, it was determined that the average budding time of the TRV:GhNSRB plants was 5.5 days earlier than that of the control plants ( Figure 7C). The average flowering time of the TRV:GhNSRB plants was the shortest (the 78th day), and the average flowering time of the TRV:00 plants was extended (the 83rd day). The flowering states of the two types of plants are as shown in Figure 7 Figure B. Through statistical analysis of the flowering times of the two types of plants, it was determined that the average flowering time of the TRV:00 plants was 4.5 days longer than that of the TRV:GhNSRB plants ( Figure 7 Figure D).

[0141] The above results indicate that GhNSRB has a negative regulatory effect on the early-maturing traits of cotton.

[0142] The embodiments described above are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. GJ The application of a gene or its related biological material in regulating the early maturity trait of upland cotton is characterized in that: Said GJ The nucleotide sequence of the gene is shown in SEQ ID NO.1; The regulation of the early maturity trait of upland cotton refers to silencing the GJ Genes that cause upland cotton to bud and flower earlier; The biological material is a silencing GJ Recombinant vector and gene silencing GJ Genetic recombinant bacteria.

2. GJ The application of the gene or its related biological material in breeding early-maturing varieties of upland cotton is characterized in that: Said GJ The nucleotide sequence of the gene is shown in SEQ ID NO.1; The method for cultivating early-maturing varieties of upland cotton is as follows: GJ Genes to obtain early maturing varieties of upland cotton with early budding and flowering; The biological material is a silencing GJ Recombinant vector and gene silencing GJ Genetic recombinant bacteria.

3. A method for regulating the early maturity trait of upland cotton, characterized in that: Using Silence GJ Gene recombinant vector or silencing GJ Gene-silencing bacteria silence the gene in upland cotton plants GJ Gene, so that the upland cotton plant buds and blooms earlier; GJ The nucleotide sequence of the gene is shown in SEQ ID NO.1; The method for constructing the recombinant vector is to use virus-induced gene silencing technology to GJ The silencing fragment of the gene is cloned into an expression vector to obtain the recombinant vector; GJ The nucleotide sequence of the silent fragment of the gene is shown in SEQ ID NO.2; The recombinant bacteria contain the recombinant vector.

4. A method for cultivating early-maturing plants of upland cotton, characterized in that: Using Silence GJ Gene recombinant vector or silencing GJ Gene-silencing bacteria silence the gene in upland cotton plants GJ Gene, to obtain early-maturing plants of upland cotton; GJ The nucleotide sequence of the gene is shown in SEQ ID NO.1; The method for constructing the recombinant vector is to use virus-induced gene silencing technology to GJ The silencing fragment of the gene is cloned into an expression vector to obtain the recombinant vector; GJ The nucleotide sequence of the silent fragment of the gene is shown in SEQ ID NO.2; The recombinant bacteria contain the recombinant vector.