A SNP molecular marker related to the body weight trait of sheep, a primer set, a kit and application thereof

Abstract

This invention belongs to the field of SNP molecular marker technology, specifically relating to an SNP molecular marker, primer set, kit, and application related to sheep weight traits. The SNP molecular marker described in this invention is located at locus 59193510 bp on chromosome 13 of the sheep genome, and the SNP molecular marker exhibits a T / A base mutation. The SNP molecular marker described in this invention shows a significant correlation with sheep weight traits, enriching the sheep weight molecular marker database. Furthermore, studies have found that adult sheep with the TT genotype have significantly higher weights than sheep with the TA and AA genotypes. In sheep breeding, homozygous TT individuals with an adult weight advantage can be selected, especially in the lamb stage, demonstrating potential application value for large-scale molecular breeding of sheep.

Description

Technical Field

[0001] This invention belongs to the field of SNP molecular marker technology, specifically relating to an SNP molecular marker, primer set, kit, and application related to sheep weight traits. Background Technology

[0002] Currently, most sheep breeds are small in size and slow in growth. In recent years, with the increasing market demand for mutton, the contradiction between the growing demand for mutton and the low production efficiency of mutton sheep has become increasingly prominent. Mutton sheep enterprises and breeders have tried to use various methods to improve the production efficiency of mutton sheep, among which molecular marker-assisted selection technology can effectively accelerate the genetic progress of sheep.

[0003] In sheep farming, body weight reflects a sheep's meat production capacity and is an important economic indicator for measuring sheep production performance. Studies have shown that body weight has moderate heritability, is genetically controlled, and can be effectively improved through selection. Therefore, screening for major genes or molecular genetic markers related to sheep body weight has become a hot topic in modern molecular breeding. However, currently, molecular markers for sheep body weight traits are scarce, making it difficult to meet the needs of sheep breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker, primer set, kit, and application related to sheep weight traits. The SNP molecular marker has a significant correlation with sheep weight traits, thus enriching the sheep weight molecular marker database.

[0005] This invention provides a SNP molecular marker associated with sheep weight traits, wherein the SNP molecular marker is located at the 59193510bp site on chromosome 13 of the sheep genome, and the SNP molecular marker has a T / A base mutation.

[0006] The present invention also provides a primer set for detecting the SNP molecular marker described in the above technical solution, the primer set including an upstream primer, a downstream primer and an extension primer; the nucleotide sequences of the upstream primer, the downstream primer and the extension primer are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0007] The present invention also provides a kit comprising the primer set and PCR amplification reagents described in the above technical solution.

[0008] Preferably, the PCR amplification reagent includes dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, shrimp alkaline phosphatase, and iplex reaction reagent;

[0009] The kit also includes standard positive template DNA.

[0010] This invention also provides the application of the SNP molecular markers, primer sets, or kits described in the above technical solutions in marker-assisted breeding of sheep body weight.

[0011] Preferably, the sheep weight molecular marker-assisted breeding includes the prediction of the dominance of weight traits in adult sheep.

[0012] The present invention also provides a method for predicting whether an adult sheep has an advantage in terms of body weight, comprising the following steps:

[0013] Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using the upstream and downstream primers in the primer set described in the above technical solution to obtain PCR amplification products;

[0014] The PCR amplification product is digested to obtain the digested PCR amplification product;

[0015] Using the digested PCR amplification product as a template, an extension reaction is performed using the extension primers in the primer set described in the above technical solution to obtain the extension product;

[0016] The extended product was genotyped to obtain genotype results;

[0017] Based on the genotype results, the adult weight of the sheep to be tested is predicted: when the genotype at the 59193510bp site on chromosome 13 of the sheep genome is the TT genotype, the sheep to be tested will be a large-weight type in adulthood and have a weight advantage.

[0018] When the genotype at the 59193510bp site on chromosome 13 of the sheep genome is TA or AA, the sheep to be tested will be small-weight adults and will not have a weight advantage.

[0019] Preferably, the PCR amplification reaction system, in 5 μL units, comprises the following components: 1 μL of 20–50 ng / μL genomic DNA, 0.5 μL of PCR reaction buffer, 0.4 μL of 25 mmol / L MgCl2, 0.1 μL of 25 μmol / L dNTPs, 1 μL of 0.5 μmol / L PCR primer mixture, 0.2 μL of 5 U / μL Taq DNA polymerase, and 1.8 μL of deionized water;

[0020] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 45 cycles; 72℃ hold for 5 min.

[0021] Preferably, the digestion system for the digestion reaction comprises, in 2 μL: 0.17 μL of shrimp alkaline phosphatase buffer, 0.3 μL of 1.7 U / μL shrimp alkaline phosphatase, and 1.53 μL of deionized water;

[0022] The digestion reaction procedure is as follows: 37℃ for 40 min, 85℃ for 5 min.

[0023] Preferably, the extension system for the extension reaction comprises, in 2 μL, 0.2 μL of iplex Buffer Plus, 0.2 μL of iplex Terminator, 0.94 μL of extension primer, 0.041 μL of iplex enzyme, and 0.619 μL of deionized water;

[0024] The procedure for the extended reaction is: 94℃ for 30s;

[0025] [94℃ 5s, (52℃ 5s, 80℃ 5s)], wherein (52℃ 5s, 80℃ 5s) is performed for 5 cycles, and [94℃ 5s, (52℃ 5s, 80℃ 5s)] is performed for 40 cycles; 72℃ 3min.

[0026] Beneficial effects:

[0027] This invention provides a SNP molecular marker associated with sheep weight traits. The SNP molecular marker is located at position 59193510 bp on chromosome 13 of the sheep genome and exhibits a T / A base mutation. The SNP molecular marker described in this invention shows a significant correlation with sheep weight traits, enriching the sheep weight molecular marker database. Furthermore, studies have found that sheep individuals with the TT genotype have significantly higher weights than sheep with the TA and AA genotypes. In sheep breeding, homozygous TT individuals with a weight advantage in adulthood can be selected, especially in lambs, demonstrating potential application value for large-scale molecular breeding of sheep.

[0028] Based on this, the present invention also provides primer sets, kits, and methods for detecting the SNP molecular markers and / or sheep weight traits. Based on the primer sets or kits, the SNP loci can be genotyped to predict whether the adult weight of the sheep being tested will be advantageous at the lamb stage. The method has high accuracy, cost-effectiveness, and sensitivity, and can automate the detection of the SNP loci. It can simultaneously detect dozens to hundreds of SNP loci in hundreds to thousands of samples, providing technical support for molecular-assisted breeding of sheep weight. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0030] Figure 1 In Example 1, Sequenom was used SNP technology was used to genotype three types of SNP loci in 379 sheep individuals. Detailed Implementation

[0031] This invention provides a SNP molecular marker associated with sheep weight traits, wherein the SNP molecular marker is located at the 59193510bp site on chromosome 13 of the sheep genome, and the SNP molecular marker has a T / A base mutation.

[0032] The preferred version number of the sheep genome sequence information in this invention is ARS-UI_Ramb_v2.0. The preferred nucleotide sequence containing the SNP molecular marker in this invention is as shown in SEQ ID NO.1 or SEQ ID NO.2, that is, the base at position 201 bp of the nucleotide shown in SEQ ID NO.1 or SEQ ID NO.2 is T or A, specifically as follows, where the positions of the bold italicized and underlined bases indicate the positions of the SNP molecular marker.

[0033] SEQ ID NO.1: 5'-CCTGAAGAATTCCATGGACGGAGGAGCCTAATGGGC TACAGTCTATGGAATTGCAAGGGGTCGGACTTGACTGAAGCAACTGACACTTTCACTGCTTGACTCTAATGTGCCACAGAAGTACAATTCAGTGTTTTTTTTTTAGTATATTCAGAGTTGTGCAACCATCACCACTATTTAATTTCAGAACTTC ATCACCCCAA T GAGAAAGACGATATCTATCAGCAGTCACTCCTTTTTCTCCTCTCCACACTGGCAACCACTGTTTCTATTGTATTGAAAAAAAGTAGAAAGGCTGGACAAACTTGCTCAAATGATGAACAGATATAGACTCTGAACCCAAGTCTCCTGGAAAAGACAACAGATAGATTTCACGCCAATTCAAGTTTGGATGGTTCCCATC-3';

[0034] SEQ ID NO.2: 5'-CCTGAAGAATTCCATGGACGGAGGAGCCTAATGGGC TACAGTCTATGGAATTGCAAGGGGTCGGACTTGACTGAAGCAACTGACACTTTCACTGCTTGACTCTAATGTGCCACAGAAGTACAATTCAGTGTTTTTTTTAGTATATTCAGAGTTGTGCAACCATCACCACTATTTAATTTCAGAACTTCATCACCCCAA A GAGAAAGACGATATCTATCAGCAGTCACTCCTTTTTCTCCTCTCCACACTGGCAACCACTGTTTTCTATTGTATTGAAAAAAAGTAGAAAGGCTGGACAAACTTGCTCAAATGATGAACAGATATAGACTCTGAACCCAAGTCTCCTGGAAAAGACAACAGATAGATTTCACGCCAATTCAAGTTTGGATGGTTCCCATC-3'.

[0035] The SNP molecular markers described in this invention are significantly correlated with sheep weight traits, with individuals having the TT genotype having significantly higher weights than individuals with the TA and AA genotypes.

[0036] The present invention also provides a primer set for detecting the SNP molecular marker described in the above technical solution, the primer set including an upstream primer, a downstream primer and an extension primer; the nucleotide sequences of the upstream primer, the downstream primer and the extension primer are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0037] The nucleotide sequences shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 of this invention are as follows:

[0038] SEQ ID NO.3: 5'-ACGTTGGATGAGAGTTGTGCAACCATCACC-3';

[0039] SEQ ID NO.4: 5'-ACGTTGGATGGGAGAAAAAGGAGTGACTGC-3';

[0040] SEQ ID NO. 5: 5'-GATATCGTCTTTCTC-3'.

[0041] The present invention also provides a kit comprising the primer set and PCR amplification reagents described in the above technical solution.

[0042] The PCR amplification reagents described in this invention preferably include Sequenom MassARRAY SNP genotyping reagents, and more preferably include, but are not limited to, dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, shrimp alkaline phosphatase (SAP), and iplex reaction reagents. This invention does not impose specific dosage limitations on the components of the PCR amplification reagents; combinations can be made as needed. The preferred independent concentrations of the upstream and downstream primers are 0.45–0.55 μmol / L, more preferably 0.50 μmol / L; the preferred concentration of the extension primer in the primer set is 0.6–1.3 μmol / L. The preferred concentration of dNTPs used in this invention is 20–30 μmol / L, more preferably 25 μmol / L; the preferred concentration of Taq DNA polymerase is 4–6 U / μL, more preferably 5 U / μL; the preferred concentration of MgCl2 is 20–30 mmol / L, more preferably 25 mmol / L; the preferred PCR reaction buffer is 10× PCR reaction buffer; and the preferred enzyme activity of shrimp alkaline phosphatase is 1.7 U / μL. The iplex reaction reagent of this invention preferably includes iplex Buffer Plus, iplex Terminator, and iplex enzyme. The kit of this invention preferably also includes shrimp alkaline phosphatase buffer. The kit of this invention preferably also includes standard positive template DNA; the genotype of the standard positive template DNA is preferably TT, and the standard positive template DNA serves as a positive control to increase the accuracy of SNP site detection.

[0043] This invention also provides the application of the SNP molecular markers, primer sets, or kits described in the above-mentioned technical solutions in marker-assisted breeding of sheep body weight. The marker-assisted breeding of sheep body weight according to this invention preferably includes the prediction of adult sheep body weight traits, more preferably the prediction of whether sheep have an advantage in adult body weight traits at the lamb stage. This invention preferably selects sheep with the SNP molecular marker site being a T base for subsequent breeding, more preferably selects homozygous sheep individuals with the TT genotype of the SNP site for subsequent breeding, preserving the sheep's body weight advantage, body weight sheep, and growth performance.

[0044] Specifically, the present invention also provides a method for predicting whether the weight of an adult sheep is advantageous, comprising the following steps:

[0045] Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using the upstream and downstream primers in the primer set described in the above technical solution to obtain PCR amplification products;

[0046] The PCR amplification product is digested to obtain the digested PCR amplification product;

[0047] Using the digested PCR amplification product as a template, an extension reaction is performed using the extension primers in the primer set described in the above technical solution to obtain the extension product;

[0048] The extended product was genotyped to obtain genotype results;

[0049] Based on the genotype results, the adult weight of the sheep to be tested is predicted: when the genotype at the 59193510bp site on chromosome 13 of the sheep genome is the TT genotype, the sheep to be tested will be a large-weight type in adulthood and have a weight advantage.

[0050] When the genotype at the 59193510bp site on chromosome 13 of the sheep genome is TA or AA, the sheep to be tested will be small-weight adults and will not have a weight advantage.

[0051] This invention preferably extracts genomic DNA from the sheep to be tested. The sheep to be tested is preferably a lamb. This invention does not have specific requirements regarding the breed of sheep; any breed of sheep can be used for testing using the method of this invention. In one embodiment of this invention, Huameng meat sheep is used. This invention does not have specific limitations on the method for extracting the genome of the sheep to be tested; conventional animal cell genome extraction methods in the art can be used. In one embodiment of this invention, red blood cells without DNA are lysed using red blood cell lysis buffer, and nuclear lysis buffer is used to lyse the red blood cells to release genomic DNA. Then, protein is selectively precipitated using protein sedimentation buffer to remove proteins. Finally, the DNA is precipitated with isopropanol and redissolved in a DNA dissolving solution to obtain pure genomic DNA.

[0052] After obtaining the genomic DNA of the sheep to be tested, the present invention uses the genomic DNA of the sheep to be tested as a template and performs PCR amplification reaction using the upstream and downstream primers in the primer set described in the above technical solution to obtain PCR amplification products. The PCR amplification reaction system of the present invention, in 5 μL units, preferably includes the following components: 1 μL of 20–50 ng / μL genomic DNA, 0.5 μL of PCR reaction buffer, 0.4 μL of 25 mmol / L MgCl2, 0.1 μL of 25 μmol / L dNTPs, 1 μL of 0.5 μmol / L PCR primer mixture, 0.2 μL of 5 U / μL Taq DNA polymerase, and 1.8 μL of deionized water. The preferred PCR amplification reaction program of the present invention is: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 45 cycles; 72℃ holding for 5 min. The present invention preferably stores the obtained PCR amplification products at 4℃. After the PCR amplification reaction, the PCR amplification product contains the DNA fragment where the SNP site is located.

[0053] After obtaining the PCR amplification product, the present invention digests the PCR amplification product with shrimp alkaline phosphatase to obtain the digested PCR amplification product. The digestion system of the present invention preferably comprises, in 2 μL increments: 0.17 μL shrimp alkaline phosphatase buffer, 0.3 μL 1.7 U / μL shrimp alkaline phosphatase, and 1.53 μL deionized water. The preferred digestion reaction program of the present invention is: 37℃ for 40 min, 85℃ for 5 min. The digested PCR amplification product of the present invention is preferably stored at 25℃. The purpose of the digestion reaction of the present invention is to digest the primer sequences and remaining dNTPs in the PCR amplification reaction system.

[0054] After obtaining the digested PCR amplification product, the present invention uses the digested PCR amplification product as a template and performs an extension reaction using the extension primers in the primer set described in the above technical solution to obtain the extension product. The extension system of the present invention, in 2 μL units, preferably includes: 0.2 μL of iplex Buffer Plus, 0.2 μL of iplex Terminator, 0.94 μL of extension primer, 0.041 μL of iplex enzyme, and 0.619 μL of deionized water. The preferred program for the extension reaction of the present invention is: 94℃ for 30 s; [94℃ for 5 s, (52℃ for 5 s, 80℃ for 5 s)], wherein the (52℃ for 5 s, 80℃ for 5 s) cycle is performed for 5 cycles, and the [94℃ for 5 s, (52℃ for 5 s, 80℃ for 5 s)] cycle is performed for 40 cycles; 72℃ for 3 min. The iplex Buffer Plus, iplex Terminator, and iplex enzyme in the extension system of the present invention are preferably derived from... Gold Reagent Set kit. In the extension reaction described in this invention, single-base extension is performed on the target SNP site in the extension system. The site-specific extension primers extend by one base at the mutation site and terminate. Different ddNTPs are linked to the extension primers according to the mutation type, resulting in molecular weight differences. After obtaining the extension product, this invention preferably purifies the extension product using resin. This invention does not specifically limit the method of resin purification; conventional resin purification methods in the art are acceptable.

[0055] After obtaining the extended products, this invention uses matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALS) to genotype the extended products and obtain genotyping results. Preferably, the extended products are spotted onto a target slide, and the molecular weight differences of different extended products are detected using a mass spectrometer. Through data analysis, the specific genotype of each mutation site in the test sample is determined. Specifically, in the process of genotyping using MALS, mass spectrometry spotting is preferably performed using a MassARRAY Nanodispenser RS1000; mass spectrometry analysis is preferably performed using a MassARRAY Compact System. After mass spectrometry analysis, this invention preferably uses Typer 4.0 software to detect mass spectral peaks and interprets the genotype of each target site based on the mass spectral peak diagram.

[0056] The method described in this invention is actually based on Sequenom Based on SNP technology, the Sequenom The basic principle of SNP technology is as follows: First, upstream and downstream primers are used to amplify the DNA fragment containing the target SNP site. SAP enzyme is added to the amplification product to digest the primer sequences and remaining dNTPs in the reaction system. Then, extension primers are used to simultaneously extend the target SNP site by one base. Site-specific extension primers will extend by one base at the mutation site and terminate. The extension products will ligate different ddNTPs according to the mutation type, resulting in molecular weight differences. After purification with resin, the extension products are spotted onto a target slide, and the molecular weight differences of different extension products are detected using mass spectrometry. Through data analysis, the specific genotype of each mutation site can be obtained.

[0057] After obtaining the genotype results, the present invention determines the adult weight of the sheep to be tested based on the genotype results: when the genotype at the 59193510bp site on chromosome 13 of the sheep genome is the TT genotype, the sheep to be tested will be a large-weight type in adulthood and have a weight advantage; when the genotype at the 59193510bp site on chromosome 13 of the sheep genome is the TA or AA genotype, the sheep to be tested will be a small-weight type in adulthood and will not have a weight advantage.

[0058] That is, the present invention uses the method described above to achieve Sequenom Based on SNP technology, sheep with the TT genotype at the SNP locus are screened for subsequent breeding. The method described in this invention can select homozygous individuals with the TT genotype who have a weight advantage, improving sheep growth performance and having significant application value for large-scale molecular breeding of sheep.

[0059] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0060] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or as recommended by the manufacturer's instructions.

[0061] Example 1

[0062] A method using Sequenom SNP technology is a method for detecting the genotype at locus 59193510 on sheep chromosome 13 and predicting whether adult sheep will have a weight advantage.

[0063] 1. Experimental materials

[0064] 379 Inner Mongolia Huameng meat sheep with adult sheep weight records were selected.

[0065] 2. Reagents and Instruments

[0066] Reagent: Complete Genotyping ReagentKit for Compact 384; Gene Amplification: ABI 9700384 Dual;

[0067] Mass spectrometry spotting: MassARRAY Nanodispenser RS1000;

[0068] Mass spectrometry analysis: MassARRAY Compact System;

[0069] All reagents and instruments were purchased from Beijing Genenode Biotech Co., Ltd.

[0070] 3. Extraction of genomic DNA

[0071] One mL of blood was collected from the jugular vein of sheep at one month of age and treated with EDTA anticoagulation. First, red blood cells were lysed with red blood cell lysis buffer to remove red blood cells without DNA. Then, red blood cells were lysed with nuclear lysis buffer to release genomic DNA. Next, protein precipitation buffer was used to selectively precipitate and remove proteins. Finally, the purified genomic DNA was precipitated with isopropanol and redissolved in DNA lysis buffer.

[0072] 4. Sequenom SNP technology for genotyping

[0073] Primer combinations were designed targeting the 59193510 bp site on sheep chromosome 13 (based on sheep genome sequence information version number ARS-UI_Ramb_v2.0):

[0074] The nucleotide sequences of the PCR amplification primers are as follows:

[0075] Upstream primer F: 5'-ACGTTGGATGAGAGTTGTGCAACCATCACC-3' (SEQ ID

[0076] No. 3)

[0077] Downstream primer R: 5'-ACGTTGGATGGGAGAAAAAGGAGTGACTGC-3' (SEQ ID

[0078] No. 4)

[0079] The extension primer sequences and extension products are shown in Table 1:

[0080] Table 1. Extension primer sequences and extension products

[0081]

[0082]

[0083] The primers mentioned above were synthesized by Junuode Company.

[0084] The testing process is as follows:

[0085] 1. Extract genomic DNA from the sheep to be tested; in addition, add two standard positive template DNAs, with the genotype TT at locus 59193510 on chromosome 13 (based on sheep genome sequence information version number ARS-UI_Ramb_v2.0).

[0086] 2. Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using upstream primer F and downstream primer R;

[0087] The PCR amplification reaction system was 5 μL: 1 μL of 20-50 ng / μL genomic DNA, 0.5 μL of 10× PCR reaction buffer, 0.4 μL of 25 mmol / L MgCl2, 0.1 μL of 25 μmol / L dNTPs, 1 μL of PCR Primer mix, 0.2 μL of 5 U / μL Taq DNA polymerase, and deionized water to a final volume of 5 μL.

[0088] The PCR amplification reaction program was as follows: 95℃ for 2 min, 95℃ for 30 s, 56℃ for 30 s, 72℃ for 60 s, for 45 cycles; 72℃ for 5 min.

[0089] 3. Digest the PCR amplification products with SAP enzyme; the PCR amplification products are digested mainly by using SAP enzyme to remove residual primers and dNTPs from the reaction products. The SAP enzyme digestion system is 2 μL: SAP Buffer 0.17 μL, SAP Enzyme 0.3 μL, and deionized water to a final volume of 2 μL; the reaction conditions are: 37℃ for 40 min, 85℃ for 15 min, and storage at 25℃.

[0090] 4. Using the digested PCR amplification product as a template, perform an extension reaction using the extension primer S1. The extension reaction system is 2 μL: iplex Buffer 0.2 μL, Terminator mix 0.2 μL, extension primer 0.94 μL, iplex Enzyme 0.041 μL, and deionized water to a final volume of 2 μL.

[0091] The extended reaction conditions are: [94℃ 5s, (52℃ 5s, 80℃ 5s)]; wherein (52℃ 5s, 80℃ 5s) is performed for 5 cycles, and [94℃ 5s, (52℃ 5s, 80℃ 5s)] is performed for 40 cycles.

[0092] 5. Analyze the extended products to identify the sheep genotype.

[0093] The resin-purified extension products were transferred to a 384-well SpectroCHIP (Sequenom) chip for MALDI-TOF-MS (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry) reaction. The mass spectral peaks were detected using Typer 4.0 software, and the genotypes of different target sites in the samples were determined based on the mass spectral peak diagrams.

[0094] Mass spectrometry results of the extended product are as follows: Figure 1 As shown, the blue slanted triangle represents the AA genotype, the yellow inverted triangle represents the TT genotype, and the green square represents the AT genotype.

[0095] Statistical results: Table 2 shows the statistical results of the association analysis between different genotypes at the 59193510bp locus on chromosome 13 of the sheep and the adult (2-year-old) weight of Huameng meat sheep.

[0096] Table 2. Association analysis between different genotypes at the 59193510bp locus on chromosome 13 of the tested sheep and adult weight of Huameng meat sheep.

[0097]

[0098] Different lowercase superscript letters in the last column represent significant differences (P < 0.05).

[0099] Depend on Figure 1 The results in Table 2 show that the body weight of adult sheep with the TT genotype is significantly higher than that of the other two genotypes.

[0100] As can be seen from the above embodiments, the SNP molecular markers related to sheep weight traits provided by this invention have a significant correlation with adult sheep weight traits. By genotyping these SNP loci, it is possible to predict early on whether sheep will have a weight advantage in adulthood. The method described in this invention enables automated detection of these SNP loci. In sheep breeding, homozygous TT individuals with weight advantage can be selected, thereby improving sheep growth performance and demonstrating potential application value for large-scale molecular breeding of sheep.

[0101] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer set for detecting SNP molecular markers related to sheep weight traits, characterized in that, The primer set includes an upstream primer, a downstream primer, and an extension primer; the nucleotide sequences of the upstream primer, the downstream primer, and the extension primer are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively. The SNP molecular marker is located at position 59193510 bp on chromosome 13 of the sheep genome, and the SNP molecular marker has a T / A base mutation; the sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

2. A kit characterized in that, The kit includes the primer set and PCR amplification reagents as described in claim 1.

3. The kit of claim 2, wherein The PCR amplification reagents include dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, shrimp alkaline phosphatase, and iplex reaction reagent. The kit also includes standard positive template DNA.

4. Application of SNP molecular markers related to sheep body weight traits, or the primer set described in claim 1, or the kit described in claim 2 or 3, in molecular marker-assisted breeding of adult body weight of Huameng meat sheep; The SNP molecular marker is located at position 59193510 bp on chromosome 13 of the sheep genome, and the SNP molecular marker has a T / A base mutation; the sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

5. The use according to claim 4, wherein the compound is ###0002### The marker-assisted breeding of adult weight of Huameng meat sheep includes the prediction of the trait advantage of adult weight of Huameng meat sheep.

6. A method of predicting whether a Huamón sheep adult body weight is advantageous, characterized by, Includes the following steps: Using the genomic DNA of the sheep to be tested as a template, PCR amplification reaction was performed using the upstream and downstream primers in the primer set described in claim 1 to obtain PCR amplification products; The PCR amplification product is digested to obtain the digested PCR amplification product; Using the digested PCR amplification product as a template, an extension reaction is performed using the extension primers in the primer set described in claim 1 to obtain the extension product. The extended product was genotyped to obtain genotype results; Based on the genotype results, the adult weight of the sheep to be tested is predicted: when the genotype at the 59193510bp site on chromosome 13 of the sheep genome is the TT genotype, the sheep to be tested will be a large-weight type in adulthood and have a weight advantage. When the genotype at the 59193510bp site on chromosome 13 of the sheep genome is TA or AA, the sheep to be tested will be small in weight and will not have a weight advantage after adulthood. The sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

7. The method of claim 6, wherein, The PCR amplification reaction system, in 5 µL increments, comprises the following components: 1 µL of 20–50 ng / µL genomic DNA, 0.5 µL of PCR reaction buffer, 0.4 µL of 25 mmol / L MgCl2, 0.1 µL of 25 μmol / L dNTPs, 1 µL of 0.5 μmol / L PCR primer mixture, 0.2 µL of 5 U / µL Taq DNA polymerase, and 1.8 µL of deionized water; The PCR amplification reaction program was as follows: pre-denaturation at 95℃ for 2 min; denaturation at 95℃ for 30 s; annealing at 56℃ for 30 s. Extend at 72℃ for 60 seconds, repeat for 45 cycles; hold at 72℃ for 5 minutes.

8. The method of claim 6, wherein, The digestion system for the digestion reaction comprises, in 2 µL, 0.17 µL of shrimp alkaline phosphatase buffer, 0.3 µL of 1.7 U / µL shrimp alkaline phosphatase, and 1.53 µL of deionized water; The digestion reaction procedure is as follows: 37℃ for 40 min, 85℃ for 5 min.

9. The method of claim 6, wherein, The extension system for the extension reaction, in 2 µL increments, comprises: 0.2 µL of iplex Buffer Plus, 0.2 µL of iplex Terminator, 0.94 µL of extension primer, 0.041 µL of iplex enzyme, and 0.619 µL of deionized water. The procedure for the extended reaction is: 94℃ for 30s; [94℃ 5s, (52℃ 5s, 80℃ 5s)], wherein (52℃ 5s, 80℃ 5s) is performed for 5 cycles, and [94℃ 5s, (52℃ 5s, 80℃ 5s)] is performed for 40 cycles; 72℃ 3min.

Images