A rice salt tolerance related gene OsBLH4 and its encoded protein and application

Abstract

The purpose of the present invention is to disclose a rice salt tolerance-related gene OsBLH4 and its encoded protein and application. The gene OsBLH4 is a DNA molecule as described in 1) or 2) or 3) below: 1) a DNA molecule with a genome sequence as shown in SEQ ID NO.1; 2) a DNA molecule with a CDS sequence as shown in SEQ ID NO.2; 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under strict conditions and encodes the protein. The genetic engineering application of the gene OsBLH4 provided by the present invention in regulating rice salt tolerance is specifically to knock out the aforementioned gene OsBLH4 to improve rice salt sensitivity; overexpress the aforementioned gene OsBLH4 to improve rice salt tolerance.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a rice salt tolerance related gene OsBLH4 and its encoded protein and application. Background Art

[0002] With the growth of the world's population and economic development, the demand for food continues to increase. As the main food source for more than half of the world's population, the increase in rice production is crucial to ensuring global food security. There are a large number of saline-alkali land resources around the world, especially in China, which are not suitable for conventional crop cultivation due to excessive salt content. China has about 1.5 billion mu of saline-alkali land, of which about 500 million mu have the potential for transformation and utilization. If these lands can be effectively used to grow crops, it will greatly expand the arable land area and increase food supply. Although rice itself has a certain salt tolerance, it will still be inhibited in the face of high-salt environments, affecting yield and quality. Enhancing rice's salt tolerance through gene mining and biotechnology can enable it to achieve higher yields on saline-alkali land, thereby developing new arable land resources. The cultivation of salt-tolerant rice can not only increase food production and reduce pressure on high-quality arable land, but also contribute to ecological restoration, improve the saline-alkali land environment through the salt absorption and excretion of plants, promote biodiversity, and bring significant economic and social benefits.

[0003] The damage caused by salt stress to plants mainly includes osmotic stress and ion toxicity, as well as a series of secondary stresses such as nutritional imbalance and oxidative stress caused by them. The accumulation of multiple stresses will inhibit the growth and development of plants and energy metabolism, leading to premature aging and even death of plants. At the plant level, the main mechanism of plant salt tolerance is to reduce the salt ion (Na2+) in functional tissues (such as leaves) and the salt ion (Na2+) in the leaves. + and Cl - ) content, and tolerance to the harm of salt ions that have entered the cells. In a high-salt environment, after plants sense salt stress, they will produce signal molecules and quickly regulate the activity of related transport proteins or ion channels. At the same time, signal molecules will also regulate the expression of related genes and the activity of related enzymes through different cascade reactions, protein modification and localization regulation, further maintaining the ion and osmotic balance in the cells for a long time, and repairing the damage caused to the cells by salt stress.

[0004] Rice salt tolerance is a comprehensive manifestation of multiple salt-tolerant physiological and biochemical reactions. It is a quantitative trait controlled by multiple genes and has a complex genetic basis. Improving rice salt tolerance using traditional breeding methods is difficult and progress is slow. The use of molecular marker-assisted selection and genetic engineering technology can accelerate the breeding process of new salt-tolerant rice varieties, but the introduction / editing of a single or a few salt-tolerant genes has limited effect on improving salt tolerance. In order to obtain salt-tolerant rice varieties that can be widely promoted and applied, it may be necessary to introduce / edit multiple key genes at the same time and genetically improve multiple pathways in the salt-tolerant regulatory network. Therefore, it is crucial to explore key salt-tolerant genes and analyze their molecular regulatory networks and mechanisms of action for improving rice salt tolerance. Summary of the invention

[0005] In order to solve the above technical problems in the prior art, the purpose of the present invention is to disclose a rice salt tolerance related gene OsBLH4 and its encoded protein and application.

[0006] The invention relates to the genetic engineering application of the salt tolerance related gene OsBLH4, or the protein encoded by the gene OsBLH4, or the knockout vector of the gene OsBLH4, or the overexpression vector of the gene OsBLH4, or the recombinant bacteria containing the gene OsBLH4, or the primers for amplifying the gene OsBLH4 in regulating the salt tolerance of rice.

[0007] Furthermore, the gene OsBLH4 is a DNA molecule as described in 1) or 2) or 3) below:

[0008] 1) A DNA molecule having a genome sequence as shown in SEQ ID NO.1;

[0009] 2) a DNA molecule having a CDS sequence as shown in SEQ ID NO.2;

[0010] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein.

[0011] Furthermore, knocking out the aforementioned gene OsBLH4 improved the salt sensitivity of rice.

[0012] Furthermore, overexpression of the aforementioned gene OsBLH4 improves the salt tolerance of rice.

[0013] Specifically, the CRISPR-Cas9 technology can be used to edit the gene in rice, knocking out the aforementioned gene OsBLH4 in the rice plant, rendering the gene inoperable;

[0014] Alternatively, the aforementioned gene OsBLH4 is introduced into rice using an overexpression vector or recombinant bacteria to overexpress the aforementioned gene OsBLH4 in rice plants.

[0015] By using any vector that can be used for gene editing in plants, the gene encoding the protein is knocked out to obtain transgenic cell lines and transgenic plants. The expression vector carrying the gene can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants.

[0016] Furthermore, the protein encoded by the gene OsBLH4 has an amino acid sequence as shown in SEQ ID NO.3, or the protein encoded by the gene OsBLH4 is a protein derived from SEQ ID NO.3 by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of SEQ ID NO.3 and is related to salt tolerance.

[0017] Furthermore, the overexpression vector of the gene OsBLH4 is obtained by inserting the gene OsBLH4 into a plant expression vector.

[0018] The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. The plant expression vector may also contain the 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the carmine synthase Nos gene) and the 3' non-translated region of the plant gene (such as the soybean storage protein gene) transcription, which have similar functions.

[0019] When the gene is used to construct a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added before the transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, maize ubiquitin promoter (Ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene.

[0020] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0021] Furthermore, the overexpression vector of the gene OsBLH4 is a vector that uses restriction endonucleases SmaI and Eco91I to double-cut the recombination site of the vector pCAMBIA1301 to insert the gene OsBLH4, and uses the corn Ubiquitin 1 promoter to promote the overexpression of the OsBLH4 gene.

[0022] pCAMBIA1301 containing OsBLH4 was named pCAMBIA1301-OsBLH4.

[0023] Furthermore, the recombinant bacteria containing the gene OsBLH4 are obtained by transferring the overexpression vector of the gene OsBLH4 into an engineered bacterium.

[0024] Furthermore, the primers for amplifying the gene OsBLH4 are selected from Primer1 shown in SEQ ID NO.4 and Primer2 shown in SEQ ID NO.5, or Primer3 shown in SEQ ID NO.6 and Primer4 shown in SEQ ID NO.7.

[0025] Beneficial effects:

[0026] The present invention provides the application of rice gene OsBLH4 in regulating rice salt tolerance traits. The plant salt tolerance-related protein of the present invention affects the salt tolerance of plants. Inhibiting the expression of the protein encoding gene can increase the salt sensitivity of plants, thereby cultivating salt-sensitive transgenic plants. Introducing the encoding gene of the protein into plants for overexpression can lead to improved plant salt tolerance, thereby cultivating salt-tolerant transgenic plants. The protein and its encoding gene can be used for plant genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the construction of OsBLH4 gene overexpression vector.

[0028] Figure 2 The expression levels of OsBLH4 gene in wild-type Nipponbare and OsBLH4 overexpression strains (OE1 and OE2).

[0029] Figure 3The mutation site and the sequences on both sides of the OsBLH4 gene in the wild-type Nipponbare and the OsBLH4 gene mutants (osblh4-1, osblh4-2 and osblh4-3).

[0030] Figure 4 The phenotypes of wild-type Nipponbare, OsBLH4 overexpression lines (OE1 and OE2), and OsBLH4 gene mutants (osblh4-1, osblh4-2, and osblh4-3) seedlings under salt stress.

[0031] Figure 5 The survival rates of seedlings of wild-type Nipponbare, OsBLH4 overexpressing lines (OE1 and OE2), and OsBLH4 gene mutants (osblh4-1, osblh4-2, and osblh4-3) under salt stress. DETAILED DESCRIPTION

[0032] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0033] Example 1. Construction of recombinant plasmid

[0034] 1. Construction of OsBLH4 gene overexpression vector

[0035] Design the following primers:

[0036] Primer1:5'-ATGGGAATAGCGGCGCCACCGT-3' (SEQ ID NO.4);

[0037] Primer2: 5'-TCAGCAACCACTGTAGTTCTCGCAAGGA-3' (SEQ ID NO. 5).

[0038] Using Primer1 and Primer2 as primers and cDNA from leaves of Nipponbare seedlings as template, PCR amplification was performed to obtain the CDS fragment of the target gene OsBLH4.

[0039] PCR amplification reaction was carried out in a Bio-Rad T100 PCR instrument. The reaction system (50 μL) included 10×PCR Buffer for KOD-Plus-Neo 5 μL, 2 mM dNTP 5 μL, 25 mM MgSO4 3 μL, Primer1 (10 μM) 1.5 μL, Primer2 (10 μM) 1.5 μL, template cDNA (200 ng / μL) 1 μL, KOD-Plus-Neo (1 U / μL) 1 μL, and ddH2O 32 μL. The program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 68°C for 2 min, for 35 cycles; extension at 68°C for 5 min; and storage at 25°C.

[0040] The PCR product was recovered and purified and then connected to -Blunt Zero Cloning Vector (Beijing Quanshijin Biotechnology Co., Ltd.), the ligation product was transformed into Escherichia coli DH5α competent cells (Baoriyi Biotechnology (Beijing) Co., Ltd., Code No. 9057), and colony PCR was performed using Primer1 and Primer2 as primers to identify the colony, and the positive single clones were selected for sequencing.

[0041] The sequencing results showed that the OsBLH4 gene fragment obtained by PCR reaction had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 790 amino acid residues (SEQ ID NO.3). The obtained recombinant vector was named pEASY-OsBLH4.

[0042] Using pEASY-OsBLH4 plasmid as template, Primer3 and Primer4 were used for PCR amplification to obtain the full-length CDS sequence fragment of OsBLH4 gene (SEQ ID NO.2). Using B73 corn DNA as template, Primer5 and Primer6 were used for PCR amplification to obtain corn Ubiquitin 1 promoter (SEQ ID NO.10).

[0043] Primer3:5'-TCCCCCGGGATGGGAATAGCGGCGCCACCGT-3' (SEQ ID NO.6);

[0044] Primer4: 5'-GGGTAACCTCAGCAACCACTGTAGTTCTCGCAAGGA-3' (SEQ ID NO. 7).

[0045] Primer5:5'-CGAGCTCCTGCAGTGCAGCGTGACCCG-3' (SEQ ID NO.8);

[0046] Primer6: 5'-CGGGGTACCCTGCAGAAGTAACACCAAAC-3' (SEQ ID NO. 9).

[0047] The maize Ubiquitin 1 promoter (SEQ ID NO. 10) was connected to the pCAMBIA1301 vector via the SacI and KpnI double restriction sites, and the full-length CDS sequence of the OsBLH4 gene was connected to the pCAMBIA1301 vector via the SmaI and Eco91I double restriction sites, and the maize Ubiquitin 1 promoter was used to drive the overexpression of the OsBLH4 gene. The construction method of the vector is as follows Figure 1 The ligation product was transformed into E. coli DH5α, positive clones were identified by colony PCR, and plasmids were extracted for sequencing. The sequencing results showed that a recombinant overexpression vector containing the sequences shown in SEQ ID NO.2 and SEQ ID NO.10 was obtained, which was named pCAMBIA1301-OsBLH4.

[0048] 2. Construction of OsBLH4 gene knockout vector

[0049] The OsBLH4 genome sequence (SEQ ID NO.1) was input into the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the CRISPR-Cas9 sgRNA target was designed from the website. The target sequence was “CACCTGTTGGCGAGGCAGAC (SEQ ID NO.11)”, and Primer7 and Primer8 were synthesized.

[0050] Primer7:5'-ggcaCACCTGTTGGCGAGGCAGAC-3' (SEQ ID NO. 12);

[0051] Primer8:5'-aaacGTCTGCCTCGCCAACAGGTG-3'(SEQ ID NO.13)

[0052] Primer7 and Primer8 were annealed to obtain a double-stranded DNA molecule with sticky ends; the double-stranded DNA molecule was connected to the pOs-sgRNA linearized vector cut by Bsa I (the vector construction method is recorded in the document "Targeted mutagenesis in rice using CRISPR-Cas system") using T4 DNA ligase, and the ligation product was transformed into Escherichia coli DH5α, positive clones were identified by colony PCR, and plasmids were extracted for sequencing. The sequencing results showed that a recombinant vector containing the sequence shown in SEQ ID NO.11 was obtained, named pOs-sgRNA-OsBLH4t.

[0053] The pH-Ubi-cas9-7 vector vector (the vector construction method is recorded in the document "Targeted mutagenesis in rice using CRISPR-Cas system") plasmid was mixed with the pOs-sgRNA-OsBLH4t plasmid, and the LR reaction was performed using the Gateway kit of Invirogen according to the instructions, and the Escherichia coli DH5α was transformed. The positive clones were identified by colony PCR, and the plasmid was extracted for sequencing to obtain the plasmid pH-Ubi-cas9-7-OsBLH4t containing the sequence shown in SEQ ID NO.11.

[0054] Example 2. Obtaining and identifying rice gene OsBLH4 overexpression and knockout transgenic plants

[0055] 1. Obtaining recombinant Agrobacterium

[0056] The pCAMBIA1301-OsBLH4 plasmid and pH-Ubi-cas9-7-OsBLH4t plasmid were mixed with Agrobacterium EHA105 competent cells, incubated on ice for 5 min, and pCAMBIA1301-OsBLH4 was transformed into Agrobacterium EHA105 competent cells by electric shock (1500V, 5ms) to obtain recombinant strains. The recombinant strains identified correctly by colony PCR were named EH-pCAMBIA1301-OsBLH4 and EH-pH-Ubi-cas9-7-OsBLH4t.

[0057] 2. Obtaining Transgenic Plants

[0058] The above recombinant Agrobacterium strain was transformed into the rice variety Nipponbare, and the specific method was as follows:

[0059] (1) Cultivate the EH-pCAMBIA1301-OsBLH4 strain at 28°C and 200 rpm overnight until the OD 600Saturation; inoculate the bacterial solution into new YEP liquid medium at a ratio of 1:100, and culture at 28°C and 200rpm until OD 600 =0.6-0.8, collect the bacteria; pour 30mL AAM bacterial solution (containing 30μL 1000×AS (acetosyringone)) into the centrifuge tube containing the bacteria, mix gently, and make OD 600 =0.05-0.1.

[0060] (2) The mature embryonic callus of the Nipponbare wild type cultured for one month was mixed with the bacterial solution of step (1) and infected for 90 seconds, and after the bacterial solution was dried with filter paper, it was transferred to 2N6-AS solid medium and cultured in the dark at 28° C. for 48-60 hours;

[0061] (3) The callus obtained in step (2) was taken out and placed in a 50 mL centrifuge tube. The callus was washed 8-10 times with sterile water, and the tube was shaken continuously until the water was clear. The callus was then washed twice with sterile water containing 500 mg / L Car (disodium carbenicillin), each time for 10-20 min. The sterile water was removed, and the callus in the centrifuge tube was poured onto sterile filter paper and drained for 1-2 h.

[0062] (4) inoculating the callus obtained in step (3) on N6D-S solid medium containing 50 mg / L Hyg (hygromycin B) and 250 mg / L Car, culturing at 28° C., and screening for 3-4 weeks;

[0063] (5) The selected resistant calli were transferred to MS-NK solid medium and cultured at 28°C for 3-4 weeks to allow the calli to differentiate into adventitious buds;

[0064] (6) When the adventitious buds grow to 3-4 cm, they are transferred to MS-HF rooting medium and grown at 28°C for 1 week;

[0065] (7) After hardening the differentiated transgenic seedlings, they are transferred to the field for growth, and the resulting plants are the T0 generation.

[0066] 3. Identification of transgenic plants

[0067] 1. Identification of OsBLH4 overexpressing plants

[0068] (1) PCR molecular identification

[0069] The genomic DNA extracted from the T0 generation plants obtained in step 3 was used as a template for PCR amplification. The PCR primer sequences are as follows:

[0070] Primer9:5'-GTTTGTCGGGTCATCTTTTCAT-3' (SEQ ID NO. 14);

[0071] Primer10: 5'-CCTGGGAGTGGGACATAGAAG-3' (SEQ ID NO. 15).

[0072] The primer Primer9 is located in the pCAMBIA1301 vector sequence, and Primer10 is located in the CDS sequence of the OsBLH4 gene shown in SEQ ID NO.2.

[0073] The PCR products were detected by 1% agarose electrophoresis. The target bands could be detected in positive plants but not in negative plants.

[0074] (2) Detection of OsBLH4 gene expression

[0075] The positive OsBLH4 overexpression transgenic plants screened by PCR molecular identification in (1) were self-pollinated for two generations to obtain homozygous transgenic lines and identify the expression level of the OsBLH4 gene. The aboveground parts of the two-leaf and one-heart seedlings were taken, frozen in liquid nitrogen and fully ground, and RNA was extracted using the Trizol method. An appropriate amount of RNA was taken and cDNA was obtained using a reverse transcription kit as a template for qRT-PCR detection. An appropriate amount of template cDNA was taken, and rice OsUBQ5 was used as an internal reference gene. The expression level of the OsBLH4 gene was detected in a Bio-Rad fluorescent quantitative PCR instrument CFX96 using the Genious 2×SYBR Green Fast qPCR Mix (No ROX Premixed) (RK21205; AB Clonal) kit. The sequences of the OsUBQ5 gene quantitative detection primers (Primer11 and Primer12) and OsBLH4 gene quantitative detection primers (Primer13 and Primer14) used were as follows:

[0076] Primer11:5'-GACGGACGCACCCTGGCTGACTAC-3' (SEQ ID NO.16);

[0077] Primer12: 5'-TGCTGCCAATTACCATATACCACGAC-3' (SEQ ID NO. 17).

[0078] Primer13:5'-TCGTCATAAGCCAACCCACC-3' (SEQ ID NO.18);

[0079] Primer14: 5'-CCCTGGGAGTGGGACATAGA-3' (SEQ ID NO. 19).

[0080] Adoption 2 -ΔΔCtThe relative expression was calculated by the method, and the results were as follows Figure 2 As shown, the relative expression levels of OsBLH4 and OsUBQ5 in the wild-type Nipponbare were taken as 1, and the relative expression levels of OsBLH4 genes in the two overexpression strains (OE1 and OE2) were significantly increased.

[0081] 2. Identification of OsBLH4 gene knockout plants

[0082] The genomic DNA extracted from the OsBLH4 gene knockout T0 generation plants obtained in step 1 was used as a template to perform PCR amplification on the editing target site and the nucleotide fragments on both sides shown in SEQ ID NO. 11. The PCR primer sequences are as follows:

[0083] Primer15:5'-TATAATGCGTCTATGATTGGTGAA-3' (SEQ ID NO. 20);

[0084] Primer16: 5'-AAAGGAACAAACACAAAATGCTAA-3' (SEQ ID NO. 21).

[0085] The primers Primer15 and Primer16 are both located in the OsBLH4 genomic sequence shown in SEQ ID NO.1 or its complementary sequence.

[0086] The PCR products were tested for band size by 1% agarose electrophoresis and sent to a sequencing company for sequencing. Combined with the sequencing peaks, transgenic plants with edited OsBLH4 genes were screened. The above transgenic plants were propagated for generations, and three homozygous mutant lines were obtained by PCR sequencing of the T2 generation lines, namely, rice lines with specific knockout of OsBLH4 (osblh4-1, osblh4-2 and osblh4-3) ( Figure 3 ).

[0087] Example 3: Identification of salt tolerance of rice gene OsBLH4 overexpression and knockout transgenic plants

[0088] The OsBLH4 gene overexpressing transgenic plants and OsBLH4 gene mutants screened and identified in Example 2 were self-pollinated for two generations to obtain homozygous transgenic lines with OsBLH4 gene overexpression and homozygous mutant lines with OsBLH4 gene specific knockout, which were used for salt tolerance identification at the seedling stage.

[0089] The specific method for identifying salt tolerance in the seedling stage is:

[0090] 1. Place the rice seeds of the overexpression strain and mutant strain in a 45°C oven for one week to break dormancy, soak the seeds at 28°C for 48 hours, and germinate at 30°C until germination.

[0091] 2. Sow the seeds with uniform germination on a 96-well PCR plate with the bottom removed, place in a black rice culture box, and culture in an artificial climate chamber. After one week of culture with pure water, switch to Yoshida nutrient solution, which is changed every 3 days. The culture conditions are: 14h light (28℃) / 10h dark (24℃), light intensity 1000μmol·m -2 ·s -1 , relative humidity 70%.

[0092] 3. When the seedlings grew to two leaves and one heart, salt stress treatment was carried out. 120 mM NaCl was added to the Yoshida nutrient solution of each group, and the solution was replaced every 3 days. The Yoshida nutrient solution without NaCl was used as the control.

[0093] 4. After 7 days of salt treatment, the seedlings were placed back in Yoshida nutrient solution without NaCl added, and the survival rate of the seedlings in each group was calculated after 7 days.

[0094] Figure 4 and Figure 5 The experimental results showed that compared with the wild type Nipponbare (WT), the two OsBLH4 gene overexpression transgenic strains showed milder leaf chlorosis and wilting symptoms under salt stress, the seedling survival rate was significantly improved, and the mortality rate was significantly reduced; the three OsBLH4 gene specific knockout mutant transgenic strains showed heavier leaf chlorosis and wilting symptoms under salt stress, the seedling survival rate was significantly reduced, and the mortality rate was significantly increased.

[0095] Therefore, based on these experimental results, it can be clearly seen that the OsBLH4 gene has an important positive regulatory effect on the salt tolerance of rice seedlings. Knocking out the protein-coding gene can increase the salt sensitivity of plants, and overexpressing the protein-coding gene can improve the salt tolerance of rice.

[0096] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for genetically engineering a salt tolerance-related gene OsBLH4, or a protein encoded by the gene OsBLH4, or an overexpression vector of the gene OsBLH4, or a recombinant bacterium containing the gene OsBLH4 in regulating the salt tolerance of rice, characterized in that: Overexpression of the gene OsBLH4 improves rice salt tolerance; The gene OsBLH4 is a DNA molecule as described in 1) or 2) below: 1) A DNA molecule whose genome sequence is shown in SEQ ID NO. 1; 2) A DNA molecule whose CDS sequence is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The protein encoded by the gene OsBLH4 has an amino acid sequence as shown in SEQ ID NO.

3.

3. The use according to claim 1, characterized in that: The overexpression vector of the gene OsBLH4 is obtained by inserting the gene OsBLH4 into a plant expression vector.

4. The use according to claim 3, characterized in that: The overexpression vector of the gene OsBLH4 is prepared by inserting the gene OsBLH4 into the recombination site of the vector pCAMBIA1301 which is double-digested with restriction endonucleases SmaI and Eco91I, and using the corn Ubiquitin 1 promoter to start the overexpression of the OsBLH4 gene.

5. The use according to claim 1, characterized in that: The recombinant bacteria containing the gene OsBLH4 are obtained by transferring the overexpression vector of the gene OsBLH4 into an engineering bacterium.

Images