Vvarr1 gene and application thereof
By cloning and overexpressing the grape fruit shape regulatory gene VvARR1 and using the pBWA(V)HS vector to regulate the shape of plant fruits and leaves, the regulatory difficulties in existing technologies were solved, significant regulation of fruit and leaf shape was achieved, and the commercial value of the fruit was enhanced.
Patent Information
- Application Number
- CN202410764590.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-13
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-06-13
AI Technical Summary
Existing technologies make it difficult to effectively control the shape of grape and tomato fruits and leaves, which affects the commercial value and appearance of the fruits.
By cloning and overexpressing the grape berry shape regulatory gene VvARR1, the pBWA(V)HS vector was used for gene overexpression to regulate the shape of plant fruits and leaves.
It significantly regulates the shape of plant fruits and leaves, provides a tool for breeding a variety of fruits and vegetables, and improves the commercial value of fruits.
Smart Images

Figure CN118755732B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant genetic engineering, and specifically provides a grape fruit shape regulation gene VvARR1 and application thereof. BACKGROUND
[0002] Grape belongs to Vitaceae Vitis L., and is one of the oldest cultivated fruit trees, which is widely planted in the world. It is favored by people because of its unique flavor and high nutritional value.
[0003] Fruit shape is an important appearance trait of fruit tree crops, which affects the commodity value of fruits. Exploring the genes affecting fruit shape in grape and utilizing them to regulate plant fruit shape is a potential improvement direction. SUMMARY
[0004] In one aspect, a grape fruit shape regulation gene VvARR1 is provided, wherein the nucleotide sequence of the grape fruit shape regulation gene VvARR1 is SEQ ID NO. 1 or SEQ ID NO. 2.
[0005] In another aspect, the application provides application of the grape fruit shape regulation gene VvARR1 in regulating fruit shape of plants.
[0006] In another aspect, the application provides application of the grape fruit shape regulation gene VvARR1 in regulating leaf shape of plants.
[0007] Further, the plant fruit is a tomato or grape fruit.
[0008] Further, the plant fruit is a tomato fruit.
[0009] Further, in the application, the grape fruit shape regulation gene VvARR1 is overexpressed in the plant to regulate the plant fruit to be round.
[0010] Further, in the application, the grape fruit shape regulation gene VvARR1 is overexpressed in the plant to regulate the plant leaf to be wide.
[0011] Further, the overexpression is performed using a pBWA(V)HS vector.
[0012] In another aspect, the application provides application of the gene or application in tomato or grape breeding.
[0013] The grape fruit shape regulation gene VvARR1 discovered by the application has a significant regulation effect on plant fruit shape, and provides a good tool for variety cultivation of various fruits and vegetables. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 Figure 2 is the amplification result of VvARRl gene.
[0015] Figure 2 Figure 3 is the expression amount of VvARRl gene in long fruit and round fruit.
[0016] Figure 3 Figure 4 is the phylogenetic analysis of ARR gene family.
[0017] Figure 4 Figure 5 is the schematic diagram of functional domain of VvARRl.
[0018] Figure 5 Figure 6 is the map of pBWA(V)HS-ARRl overexpression vector and enzyme cutting band verification (A part: pBWA(V)HS-ARRl overexpression vector; B part: enzyme cutting band of overexpression vector).
[0019] Figure 6 Figure 7 is the PCR identification of transgenic tomato (wherein M: DNA Marker; P: positive control; N: negative control; H: water control; 1-20: transgenic lines).
[0020] Figure 7 Figure 8 is the phenotype observation of VvARRl transgenic tomato (A part: phenotype of tomato plant at mature stage; B part: phenotype of tomato fruit at mature stage; C part: phenotype of tomato plant at seedling stage; D part: phenotype of tomato leaf at mature stage; '-': 1 centimeter). DETAILED DESCRIPTION
[0021] Materials:
[0022] Long fruit grape varieties: sweet blue sapphire (L1), grape dream (L2), golden finger L3, pink kornia (L4), krim konys (L5)
[0023] Round fruit grape varieties: New York rose (R1), Xiangfei (R2), early gold (R3), Baco (R4), longan (R5).
[0024] Overexpression plant material:'micro tom' tomato.
[0025] Example 1 Screening, cloning and identification of VvARRl gene
[0026] To investigate the genetic regulation mechanism of grape berry shape, we previously constructed a F2 population containing 528 single plants using the round grape line ‘E42-6’ and the oblong grape variety ‘Rizamat’ as parents. Using this population as material, after hybridization and authenticity identification, 208 F2 single plants were randomly selected together with the parents for whole-genome resequencing. Based on the developed SNP molecular markers, a high-density genetic linkage map of grape was constructed, and combined with the phenotypic data of the population for three consecutive years (2019-2021), QTLs of grape berry shape were located. Through transcriptome analysis of fruits at different development stages of extreme fruit shape single plants, a grape berry shape regulation candidate gene ARR1 was screened from the QTL location interval. In this study, according to the screened candidate gene VvARR1, its CDS sequence was amplified in different long and round fruits, gene expression was determined, gene family analysis and transgenic verification were carried out.
[0027] Map information: Whole-genome resequencing was performed on ‘E42-6’ and ‘Rizamat’ and their 208 hybrid F2 single plants, and 358,709 SNP markers were developed, which were converted into 4401 bin markers and used to construct a high-density genetic map of grape. Based on the 19 chromosomes of the grape reference genome, the bin markers were divided into 19 linkage groups (LGs), with a total map distance of 1,635.65 cM and an average map distance of 0.37 cM between adjacent markers. The genetic map distance of each linkage group ranged from 58.13 cM (LG10) to 127.51 cM (LG4). LG10 had the fewest number of markers (77) with an average map distance of 0.76 cM, while LG4 contained the most markers (370) with an average map distance of 0.35 cM. The largest Gap on each linkage group ranged from 2.21 cM (LG15) to 16.09 cM (LG1), and the percentage of “Gap <5 cM” (genetic distance between adjacent markers ≤5 cM) in the 19 linkage groups ranged from 94.74% (LG10) to 100% (LG5, LG9 and LG14).
[0028] QTL site information: At the top of LG5, a major QTL site was located for three consecutive years (2019-2021), with a linkage interval of 0-1.731 cM, and the corresponding physical location was 4.75-19.45 Mp on grape chromosome 5.
[0029] Gene information: By comparing the grape reference genome, combined with the located QTL site related to fruit shape, gene function annotation information and expression pattern results, a grape fruit shape related candidate gene VvARR1 was screened on chromosome 5.
[0030] Total RNA was extracted from grape inflorescences at peak flowering. Based on the previously identified gene VvARR1 (VIT_05s0077g01480), specific primers VvARR1-F (ATGAATCTGGGTAGCGGACAG, SEQ ID NO. 3) and VvARR1-R (CATGGATAACATTCCCGTGTAA, SEQ ID NO. 4) were designed for amplification. CDS amplification was performed using the reverse-transcribed first-strand cDNA as a template. A 25 μL reaction system consisted of 13 μL of 2× Phanta Max Master Mix, 1 μL of each upstream and downstream primer, and 3 μL of diluted cDNA, brought to 25 μL with ddH20. The reaction procedure was: 95°C for 3 min, 35 cycles of (95°C for 15 s, 55°C for 15 s, 72°C for 1 min), 72°C for 5 min, and storage at 4°C. The PCR products were separated by 1% agarose gel electrophoresis, and the target bands were recovered from the gel and ligated to the pCE2TA / Blunt-Zero vector, transformed into DH5a Escherichia coli, and the positive clones were sent to the company for sequencing.
[0031] Reaction procedure:
[0032]
[0033]
[0034] The VvARR1 gene was amplified using grape inflorescence as the material. The amplification results are shown in Figure 2. Figure 1 As shown, the length is approximately 2000 bp. Sequencing and comparison with the grape reference genome revealed that the VvARR1 gene is 2043 bp long, with an ATG start codon and a TAA stop codon, encoding a total of 680 amino acids. The CDS sequences are identical in long and round fruits, with both having two genotypes (SEQ ID NO. 1 and SEQ ID NO. 2).
[0035] The annotated sequences of the whole genome of Arabidopsis thaliana were downloaded from TAIR (https: / / www.arabidopsis.org / ), the annotated sequences of the whole genome of Vitis vinifera were downloaded from Ensembl Plants (https: / / plants.ensembl.org / index.html), and the sequences of ARR family proteins were downloaded from TAIR. The sequences of Response regulator receiver domain (PF00072) were downloaded from Pfam database (http: / / pfam-legacy.xfam.org / ). The homologous proteins of these sequences were searched in the proteome of Vitis vinifera using TBtools software. The repetitive sequences were deleted, and the sequences were searched in Pfam to remove the sequences without Response regulator receiver domain. Finally, 50 members of ARR family in Vitis vinifera were obtained. Figure 3 )。
[0036] The functional domain of VvARR1 includes two domains, the red one is the signal transduction response regulator receiver domain (Pfam: PF00072), located at 35-143 aa, and the grey one is the SANT / Myb domain (Pfam: PF00249), located at 215-265 aa. Figure 4 )。
[0037] Example 2 Verification of gene expression
[0038] The specific primers of real-time fluorescent quantitative PCR were designed according to the base sequence of VvARR1 gene (F: AAGCCTCGCCACACTCCAAG, SEQ ID NO. 5, R: GTTGCTGTTGCTGCTGACCTTC, SEQ ID NO. 6), and the sequence of internal reference gene primers (F: CAAGAGAAACCATCCCTAGCTG, SEQ ID NO. 7, R: TCAATCTGTCTAGGAAAGGAAG, SEQ ID NO. 8). The reaction system was constructed. The qRT-qPCR was performed on 480 real-time fluorescent quantitative PCR instrument using SYBR Green I Master Mix (Roche, Basel, Switzerland). The relative expression amount of the gene was determined based on 2 -ΔΔCt Method. Each experiment was repeated three times independently.
[0039] As Figure 2The expression amount of VvARRl gene was determined during the full bloom of grape. The expression amount in round fruit grape (L1-L5) was higher than that in long fruit grape (R1-R5).
[0040] Example 3 Construction of overexpression vector
[0041] Specific primers OEVvARRl-F (AACACGGGGGACTTTGCAACatgaatctgggtagcggacaggg, SEQ ID NO. 9) and OEVvARRl-R (TGAAGACAGAGCTAGTTACAttacacgggaatgttatccatggaataccc, SEQ ID NO. 10) with enzyme cutting sites were designed according to the CDS sequence of the cloned VvARRl gene, and amplification was performed (genotype 1 described above). The pBWA(V)HS vector was linearized by enzyme cutting, and the product was purified and used for the next recombination reaction. The target gene and the linearized vector were connected by homologous recombination, and the competent cells were transformed, cultured at 37°C for 12 hours, and identified by plaque PCR.
[0042] The target gene was connected to the vector by homologous recombination, and the pBWA(V)HS-ARR1 overexpression vector map is as shown in FIG. 1A. Figure 5 After the vector was constructed, the target fragment did not contain enzyme cutting sites at both ends. To ensure the accuracy of the recombinant plasmid, sequencing and EcoRV endonuclease enzyme cutting of the recombinant plasmid were performed to verify whether the actual fragment size of the recombinant plasmid was consistent with the theoretical value. The enzyme cutting gel map is as shown in FIG. 1B. Figure 5 The sequencing result was accurate, indicating that the vector was successfully constructed.
[0043] Example 4 Genetic transformation of tomato
[0044] The overexpression plasmid was transformed into GV3101 Agrobacterium competent cells, which were cultured at 30°C for 48 hours. Plaque PCR identification was performed, and after detection, genetic transformation of tomato was performed. The main process was: seed disinfection, sowing, preparation and pre-culture of explants, Agrobacterium infection and co-culture, screening and differentiation and rooting. Tomato genomic DNA was extracted, and specific primers TG-F (CTGCCCGCTGTTCTACAACCGG, SEQ ID NO. 11) and TG-R (GGAGCATATACGCCCGGAGTC, SEQ ID NO. 12) were designed for PCR detection.
[0045] After the steps of culture, screening, differentiation and rooting, a total of 20 overexpression lines were obtained. PCR detection was performed on the lines, and the results are as shown in FIG. 2. Figure 6), the electrophoresis bands of the positive control and the sample were clear, the size was correct, and the negative control and the water control had no bands, indicating that the gene had been successfully introduced into the tomato strain.
[0046] The phenotype of the transgenic tomato was observed Figure 7 The wild type tomato leaf was relatively thin and long, while the transgenic tomato leaf was relatively wide and large, and the transgenic tomato fruit was more round compared with the wild type fruit.
[0047] Obviously, the above examples are only examples for clearly illustrating, but not limitation of the embodiments. Other different forms of changes or variations can be made on the basis of the above description for those skilled in the art. Here, all the embodiments need not and cannot be exhausted. The obvious changes or variations derived therefrom are still within the protection scope of the present application.
Claims
1. Grape berry shape regulatory genes VvARR1 Application in regulating tomato fruit shape, the grape fruit shape regulating gene VvARR1 The nucleotide sequence is SEQ ID NO.1 or SEQ ID NO.2; in the application, the grape fruit shape regulating gene is overexpressed in tomatoes VvARR1 , in order to regulate the plant's fruits to become round.
2. The use according to claim 1, wherein the overexpression is performed using a pBWA(V)HS vector.
3. Grape Berry Shape Regulatory Genes VvARR1 Application in regulating tomato leaf shape, the grape fruit shape regulating gene VvARR1 The nucleotide sequence is SEQ ID NO.1 or SEQ ID NO.2; in the application, the grape fruit shape regulating gene is overexpressed in tomatoes VvARR1 , to regulate the plant leaves to become wider.
4. The use according to claim 3, wherein the overexpression is performed using a pBWA(V)HS vector.
Citation Information
Patent Citations
Application of SlBIW gene in regulation and control of tomato fruit shape
CN117802153A
Application of SlSTR gene in regulation and control of tomato fruit characters and breeding of new plant varieties
CN117947084A