DmGA2ox3 gene from Orchidaceae and its application

Abstract

The present invention discloses a DmGA2ox3 gene of D. chinensis and its application. The nucleotide sequence of the DmGA2ox3 gene of D. chinensis is shown in SEQ ID NO: 1, and the amino acid sequence thereof is shown in SEQ ID NO: 2. The DmGA2ox3 gene of D. chinensis encodes gibberellin 3-β-dioxidase. The function of the DmGA2ox3 gene of D. chinensis was studied, and it was found that the content of volatile terpenoid compounds was significantly increased in the overexpressed tobacco transformed strain thereof. The present invention provides a basis for cultivating high-quality varieties of D. chinensis.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to a DmGA2ox3 gene of Orchidaceae and an application thereof. Background Art

[0002] Dracocephalam moidavical is an annual herbaceous plant of the genus Dracocephalam of the Lamiaceae family. It has a large amount of resources and is distributed in the hilly areas of the Loess Plateau in northern Shaanxi, northern Shanxi and northwestern Shanxi. The average annual temperature in the distribution area is 6-10℃, and the lowest temperature can withstand -30℃. It is commonly found in dry mountains, hills, grasslands, forest edges, hillsides, and roadsides. It is a light-loving, drought-tolerant, and ridge-thinning plant. The whole plant of Dracocephalam moidavical, especially the flowers, can be distilled to obtain volatile oil, which contains a large amount of volatile terpenoid compounds, such as citral, geraniol, and cinnamyl alcohol. Dracocephalam essential oil has floral, green, and fruity aromas, and is a dense wax type. The entire aroma is long-lasting and stable. It can be used to mix various types of flavors such as edible and daily use, such as green fragrance, aldehyde fragrance, fruit fragrance, fantasy fragrance, and floral fragrance. It is a new fragrance product with great development value.

[0003] However, there is no large-scale artificial cultivation base for C. chinensis, and related breeding work is lacking. The genetic background of its terpenoid synthesis pathway is unclear, and breeding research to increase the content of terpenoids has not yet been carried out, which restricts the research on C. chinensis anabolism, functional genes, and the development of high-quality C. chinensis varieties. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a DmGA2ox3 gene of DmGA2ox3 of DmGA2ox3 and its application. The present invention obtains a gene sequence DmGA2ox3 with a length of 1098bp from DmGA2ox3 of DmGA2ox3. Sequencing comparison shows that the protein encoded by the sequence is a type of gibberellin 3-β-dioxygenase with a specific catalytic site for the enzyme. The function of the DmGA2ox3 gene of DmGA2ox3 ...

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The invention provides a DmGA2ox3 gene of Cynanchum odoratum. The nucleotide sequence of the DmGA2ox3 gene is shown as SEQ ID NO:1.

[0007] The present invention also provides a gibberellin 3-β-dioxygenase DmGA2ox3 encoded by the DmGA2ox3 gene. The amino acid sequence of the gibberellin 3-β-dioxygenase DmGA2ox3 is shown in SEQ ID NO:2.

[0008] The present invention also provides a primer pair for obtaining the DmGA2ox3 gene sequence of the fragrant blue orchid, and the primer pair is:

[0009] F:AGAACACGGGGGACGAGCTC;

[0010] R:ACCATGGTGTCGACTCTAGA.

[0011] The present invention also provides an overexpression vector containing the DmGA2ox3 gene, wherein the overexpression vector is pCAMBIA1301-DmGA2ox3.

[0012] The present invention also provides a method for constructing the above-mentioned overexpression vector, comprising the following steps:

[0013] (1) Introducing restriction endonuclease Sca I and Xba I cleavage sites at both ends of the terpenoid synthesis gene DmGA2ox3;

[0014] (2) The DmGA2ox3 gene fragment containing the restriction site was connected to the downstream of the 35S promoter of the pCAMBIA1301 vector to obtain the pCAMBIA1301-DmGA2ox3 vector.

[0015] The present invention also provides an engineering strain containing the above-mentioned overexpression vector, wherein the engineering strain is Escherichia coli.

[0016] The present invention also provides a host bacterium containing the overexpression vector, wherein the host bacterium is Agrobacterium GV3101.

[0017] The present invention also provides an application of the DmGA2ox3 gene of the hyacinthus annuus in improving the content of terpene compounds in the hyacinthus annuus.

[0018] Furthermore, the terpene compounds are hexanal, hexenal, 3-nonen-2-one, pentadecanal-2-hexadecene-1-ol, 3,7,11,15-tetramethyl acetate, and 1-naphthylpropanol.

[0019] The present invention also provides an application of the above-mentioned DmGA2ox3 gene of the fragrant blue orchid in cultivating a high-quality new variety of fragrant blue orchid.

[0020] Beneficial effects of the present invention:

[0021] The present invention cloned the DmGA2ox3 gene of the fragrant blue orchid for the first time and studied its gene function. Gene DmGA2ox3 overexpression vectors and transgenic tobacco plants were constructed, and the types and contents of volatile components in the overexpression strains and wild types were compared and analyzed. The results showed that the contents of terpenoid compounds such as hexanal, hexenal, 3-nonen-2-one, pentadecanal-2-hexadecene-1-ol, 3,7,11,15-tetramethyl acetate, and 1-naphthylpropanol in the overexpression plants were significantly increased. The present invention provides a method for increasing the content of volatile terpenoid compounds in the fragrant blue orchid, providing a basis for the biosynthesis of specific terpenoid compounds in the fragrant blue orchid. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the analysis diagram of differentially expressed genes in different stages of Xiangqinglan;

[0023] Figure 2 It is the sequence alignment and expression pattern analysis diagram of gene DmGA2ox3;

[0024] In the figure, A is the evolutionary tree analysis diagram;

[0025] B is the expression pattern of DmGA2ox3 gene in different tissues;

[0026] C is a multiple sequence alignment of DmGA2ox3 encoded proteins (the conserved domain is marked in the red box);

[0027] Figure 3 Schematic diagram of the construction of gene DmGA2ox3 overexpression vector and plant transformation;

[0028] In the figure, A is the PCR amplification diagram of DmGA2ox3 gene;

[0029] B is the PCR verification diagram of the recombinant pCAMBIA1302 vector;

[0030] C is the PCR detection diagram of transformed tobacco strains;

[0031] D is a diagram of the process of Agrobacterium-mediated transformation of tobacco;

[0032] E is the expression detection diagram of transformed tobacco strains;

[0033] Figure 4 PCA analysis of component detection in transgenic plants and wild-type controls. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0035] Example 1 Amplification of DmGA2ox3 gene in Cibotium chinense and analysis of its expression pattern

[0036] 1. Amplification of DmGA2ox3 gene of D.

[0037] A differentially expressed gene Dm_transcript_42553 ( Figure 1 ). Upstream and downstream primers F and R were designed according to the sequence information, and the cDNA of Scutellaria baicalensis was used as the PCR amplification template for amplification. The PCR amplification system was 25 μL, including Premix Taq: 12.5 μL, cDNA diluent: 1 μL, F and R primers (20 μM) each: 1 μL, ddH2O: 9.5 μL; the PCR amplification program was 98℃: 3min, (98℃: 10s, 55℃: 30s, 72℃: 75s) for 32 cycles, 72℃: 10min. The PCR amplification product was detected by gel electrophoresis, and a fragment of 1098bp in length was obtained ( Figure 3 A), after sequencing and comparison, it was named DmGA2ox3 gene, and the nucleotide sequence is shown in SEQ ID NO: 1. The primers are:

[0038] F:AGAACACGGGGGAC;

[0039] R:ACCATGGTGTCGACTCTAGA.

[0040] 2. Analysis of the expression pattern of DmGA2ox3 gene in D.

[0041] Sequencing comparison showed that the protein encoded by the above nucleotide sequence is a type of gibberellin 3-β-dioxygenase, and its amino acid sequence is shown in SEQ ID NO: 2; it has a specific catalytic site for the enzyme and is named DmGA2ox3 ( Figure 2 C).

[0042] Phylogenetic analysis showed that the protein had the closest homology and relationship with the GA2ox enzyme of Salvia miltiorrhiza ( Figure 2 A); Expression pattern analysis showed that the enzyme was expressed in roots, stems, leaves, and flowers, but was most highly expressed in flowers, and its expression increased significantly during the flower development period ( Figure 2 B).

[0043] Example 2 Construction of DmGA2ox3 overexpression vector and transgenic tobacco plants

[0044] 1. Introduce restriction sites at both ends of the DmGA2ox3 sequence

[0045] Sca I and Xba I restriction sites were introduced at both ends of the DmGA2ox3 sequence by PCR amplification technology. The upstream primer F / sac containing the Sca I restriction site and the downstream primer R / xab containing the Xba I restriction site were used to perform PCR amplification using the cDNA of the fragrant blue orchid as a template.

[0046] The PCR amplification system contained 25 μL of Premix Taq, 2 μL of cDNA diluent, 1 μL of upstream and downstream primers (20 μM), and 50 μL was filled with ddH2O.

[0047] The PCR amplification program was 98°C: 5 min, (98°C: 10 s, 57°C: 30 s, 72°C: 75 s) for 30 cycles, and 72°C: 10 min to obtain the DmGA2ox3 gene fragment containing the restriction site. The primer sequences are as follows:

[0048] F / sac:AGAACACGGGGGACGAGCTC GAGCTC ;

[0049] R / xab:ACCATGGTGTCGAC TCTAGA .

[0050] 2. Construction of DmGA2ox3 overexpression vector and transgenic tobacco plants

[0051] The DmGA2ox3 gene fragment containing the restriction site was connected to the downstream of the 35S promoter of the pCAMBIA1301 vector by enzyme-linked method to obtain the pCAMBIA1301-DmGA2ox3 recombinant vector, which was transformed into Escherichia coli and positive transformants were screened ( Figure 3 B), extract the plasmid contained in the positive transformant, transform it into Agrobacterium GV3101, and further screen the positive strain by PCR. The Agrobacterium containing the pCAMBIA1301-DmGA2ox3 recombinant vector is expanded and transformed into tobacco leaves by leaf disc method.

[0052] After hygromycin screening and PCR verification, positive plants were obtained ( Figure 3 C), further selected the above positive plants for expression detection by qRT-PCR, and selected the overexpression lines OE-4 and OE-6 with high expression levels for subsequent experiments ( Figure 3 E).

[0053] Example 3 Detection of terpenoids in transgenic tobacco plants

[0054] Fresh leaves of the overexpression strain OE-4 and wild-type tobacco were removed, 1.0 g of freshly ground tobacco leaf sample and 1.0 g of high-grade pure sodium chloride were weighed into a 15 mL headspace bottle, and 5 mL of ultrapure water was added; 2 μl of 3-nonanone (0.4 μg / μl) internal standard solution was added, and the volume was fixed with methanol to 0.8 μg; the mixture was equilibrated in a 50°C constant temperature water bath for 30 min, and adsorbed for 30 min using a 50 / 30 μm three-in-one solid phase microextraction needle (DVB / CAR / PDMS) aged for 30 min, and then manually injected.

[0055] 1.GC conditions:

[0056] ①Chromatographic column: HP-5MS UI;

[0057] ② Inlet temperature: 250℃;

[0058] ③Aux: 280℃;

[0059] ④ Column temperature program: initial temperature 35°C, hold for 0 min;

[0060] Raise the temperature to 95°C at a rate of 3°C / min and hold for 0 min;

[0061] Raise the temperature to 200°C at a rate of 4°C / min and hold for 0 min;

[0062] The temperature was raised to 280°C at a rate of 15°C / min and maintained for 15 min.

[0063] 2.MS conditions:

[0064] ①EI source temperature: 230℃;

[0065] ②Quadrupole temperature: 150℃;

[0066] ③SCAN mode: 40-550amu.

[0067] Comparative analysis of the types and contents of volatile components in the overexpression strain OE-4 and the wild type ( Figure 4 , Table 1). The results showed that the contents of hexanal, hexenal, 3-nonen-2-one, pentadecanal-2-hexadecene-1-ol, 3,7,11,15-tetramethyl acetate, and 1-naphthylpropanol in the overexpression plant OE-4 were higher than those in the wild type.

[0068] Table 1 GC-MS identification of volatile oil substances in transgenic tobacco

[0069]

[0070]

[0071] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A DmGA2ox3 gene of Scutellaria baicalensis, characterized in that: The nucleotide sequence of the DmGA2ox3 gene is shown in SEQ ID NO:

1.

2. A gibberellin 3-β-dioxygenase DmGA2ox3 encoded by the DmGA2ox3 gene according to claim 1, characterized in that: The amino acid sequence of the gibberellin 3-β-dioxygenase DmGA2ox3 is shown in SEQ ID NO:

2.

3. An overexpression vector containing the DmGA2ox3 gene according to claim 1, characterized in that: The overexpression vector is pCAMBIA1301-DmGA2ox3.

4. A method for constructing the overexpression vector according to claim 3, characterized in that: The following steps are involved: (1) Introducing restriction endonuclease Sca I and Xba I cleavage sites at both ends of the terpenoid synthesis gene DmGA2ox3; (2) The DmGA2ox3 gene fragment containing the restriction site was connected to the downstream of the 35S promoter of the pCAMBIA1301 vector to obtain the pCAMBIA1301-DmGA2ox3 vector.

5. An engineered strain containing the overexpression vector according to claim 3, characterized in that: The engineered strain is Escherichia coli.

6. A host bacteria containing the overexpression vector according to claim 3, characterized in that: The host bacteria is Agrobacterium GV3101.

7. An application of the DmGA2ox3 gene of the fragrant blue orchid according to claim 1 in cultivating new tobacco varieties, characterized in that: The application is to increase the content of hexanal and hexenal in new tobacco varieties.

Images