A composition, kit and use for detecting cervical cancer and high-grade cervical lesions

Abstract

The present invention relates to the field of molecular biology detection, and specifically, to the field of cervical cancer detection. The present invention provides a composition for detecting cervical cancer and high-grade cervical lesions, comprising detection reagents for detecting the methylation levels of the following regions: the region shown in SEQ ID NO:1 in the JAM3 gene; the region shown in SEQ ID NO:2 in the PCDHGB7 gene. The composition of the present invention can stably achieve high sensitivity and high specificity in detecting high-grade cervical lesions and cervical cancer with fewer detections, avoid overdiagnosis, and is expected to alleviate the current practical problem of overconsumption of cervical cancer screening resources but low efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology detection, specifically, to the field of cervical cancer detection, and more specifically, relates to the detection of the methylation level of cervical cancer gene markers. Background Art

[0002] HPV virus nucleic acid detection is the mainstream technology for the primary screening of cervical cancer. However, more than 90% of HPV infections are transient and will clear spontaneously within 1-2 years. Screening for cervical cancer only by HPV virus nucleic acid detection will increase the risk of over-referral and treatment, and cannot efficiently utilize medical and health resources. Finding key molecules that can be used for the early screening and auxiliary diagnosis of cervical intraepithelial neoplasia and cervical cancer, and optimizing the molecular detection path, is a feasible and efficient way to improve the efficiency of cervical cancer screening.

[0003] Human gene methylation detection is a research hotspot in the field of cervical cancer screening technology. So far, more than 100 human gene methylations have been found to be closely related to the occurrence and development of cervical cancer. To balance the detection sensitivity and specificity, these genes are usually combined to develop cervical cancer screening technologies. Affected by differences such as the target genes contained in the composition, the number of target genes, and the molecular detection technology used, the existing human gene methylation combination screening technologies still fail to achieve stable and good detection effects. So far, no methylation detection technology based on human genes has been recommended by the screening guidelines of various authoritative institutions worldwide for large-scale cervical cancer screening practice.

[0004] There is an urgent need in this field for a non-invasive, rapid and more accurate cervical cancer screening product to provide technical support for improving the efficiency of cervical cancer screening. Summary of the Invention

[0005] In view of this, the present invention provides a composition for detecting cervical cancer and high-grade cervical lesions, and the composition includes detection reagents for detecting the methylation level in the following regions:

[0006] The region in the JAM3 gene as shown in SEQ ID NO:1; and

[0007] The region in the PCDHGB7 gene as shown in SEQ ID NO:2.

[0008] Further, the composition further includes detection reagents for detecting the methylation level in the following regions:

[0009] The region in the SORCS1 gene as shown in SEQ ID NO:3.

[0010] The regions shown as SEQ ID NO:1 in the JAM3 gene, the region shown as SEQ ID NO:2 in the PCDHGB7 gene, and the region shown as SEQ ID NO:3 in the SORCS1 gene are sequences of a segment of the CpG island in the promoter region of their respective genes.

[0011] Specifically, the SEQ ID NO:1 region of the JAM3 (Genbank accession number: NC_000019.10) gene is as follows:

[0012] CAGCTTCCTCTGTCACCATGGTGCCGGCTCGGCTGGGCCCGGCGGTCGCCATGGTAACTGGGGCGGGTCGCAGGGTCCTGGCAGGCTGGGCGCATGCGCGCGGGGACTACAAGCCGCGCCGCGCTGCCGCTGGCCCCTCAGCAACCCTCGACATGGCGCTGAGGCGGCCACCGCGACTCCGGCTCTGCGCTCGGCTGCCTGACTTCTTCCTGCTGCTGCTTTTCAGGGGTGAGTTTGCGCGTTTCCGCTGTTGGGAGACTAGGGTCTGGGGGCGACGGAAGCAGAGCGGGCCGAAGCTGCTGGAGCCGGTCCGGGCGAGGATAGCGGTCCTGGCTCCGAGGGCTCCCGGGGTCCCGGGCCGGAGGGGCGGCGCGCGCCCGCGTCCCCGCAGCCAGGGCTGGGACTCGGGCCTGGCTAGGGCGGGGGCCCTGGGACGCCCGGCAGTTGGACCGGGGC.

[0013] The SEQ ID NO:2 region of the PCDHGB7 (Genbank accession number: NC_000007.14) gene is as follows:

[0014] CTCGTAGTTTAAAAAAAATTCCTTGAAAGAGGTAGAGAAAAGTCAAGTTGCAGTCCCACACAGAGCCTCTGGGCGCCGCCGTCGGCCAGTGCAGAGCAAGCGCTGACGCCGGGGATCCCTCAGCCTCTAGCCTGGGATTCCCTGCGCAGCCAACAACAGAAAAGAAAACCAGCTCCCACACAGAGGCTCCCGGCTGCGCAGACCTTGCCCAGCACACCAGATTGCCAGCTCCGAGACCCGGGACTCCTCCTGTCCTGGGCCGAATGCTCTTTTAGCGCGGTAGAGTGCACTT TCTCCAACTGGAAAAGCGGGGACCCAGCGAGAACCCGAGCGAACGATGGGAGG。

[0015] The region shown in SEQ ID NO:3 in the SORCS1 (Genbank accession number: NC_000010.11) gene is as follows:

[0016] GCGGCACGAGCTCTGCGCTGGCGGCTGTGGGGGGCCGGCGCTCAGGACCCCAACTCCATCCAAGTTGCGCCGCGGTGGGGGCGGGCGGAGGCGGCGCCGGGCAGGTGGCGGCCGCTTGCCCGGGCTGGGCTTGTGCCGAGCGCGGGTCCGGACGGAGCGAGCCGCCGCCGCGCGGGGGTGGAGCTGAGCTGAAGTCACTGGCGGAG。

[0017] Using the composition "JAM3+PCDHGB7+SORCS1" of the present invention for triage testing in HPV-positive populations, the detection sensitivity, specificity, and AUC for cervical intraepithelial neoplasia grade 2 and above (CIN2+) are 69.9%, 88.8%, and 0.794 respectively; the detection sensitivity, specificity, and AUC for cervical intraepithelial neoplasia grade 3 and above (CIN3+) are 85.0%, 81.8%, and 0.834 respectively.

[0018] In the same population, compared with the cytological examination triage recommended by the cervical cancer screening guidelines issued by domestic and foreign authoritative institutions, using the methylation detection kit of the present invention as a direct triage plan for HPV-positive populations, the colposcopy referral rate is less than 30%, which is about 40% lower than that of cytological examination (the cytological examination is 70%); moreover, the maximum number of colposcopies required to detect one true high-grade cervical lesion or cervical cancer patient is at most 3 times, which is about 60% less than that of cytological examination (cytological examination requires at least 6 times).

[0019] The reagent combination of the present invention can detect cervical exfoliated cells clinically with fewer markers, saving both cost and time, and can detect patients truly at risk of cervical cancer at an early stage of the carcinogenesis process with relatively high sensitivity and high specificity.

[0020] In the present invention, "CpG island" is the abbreviation of cytosine (C)-phosphate (p)-guanine (G), referring to some regions on the genome rich in CpG dinucleotides, with a length of 300 - 3000bp.

[0021] In the present invention, the term "CIN2+" includes cervical cancer, CIN3 and CIN2; the term "CIN3+" includes cervical cancer and CIN3.

[0022] In some embodiments, using the detection reagent of the present invention, the methylation level of the CpG island or a sequence segment on the CpG island in the corresponding gene region present in the sample can be detected.

[0023] In the present invention, the "sample" is a biological sample selected from an individual. Specifically, for example, selected from histological sections, tissue biopsies / paraffin-embedded tissues, etc., preferably a cervical exfoliated cell sample.

[0024] In the present invention, the "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample. Among them, the methylation level is measured by means of amplification-sequencing, chip detection, methylation fluorescence quantitative PCR.

[0025] In some specific embodiments, the detection reagent for the methylation level can also be a detection reagent for detecting the average methylation level of a gene fragment.

[0026] In some specific embodiments, the detection reagent for the methylation level can also be a detection reagent for detecting one or more methylation sites within a gene segment.

[0027] In some specific embodiments, the detection reagent includes but is not limited to nucleic acid primers, sequencing Tag sequences, for measuring the methylation level by amplification-sequencing.

[0028] In some specific embodiments, the detection reagent includes, but is not limited to, a chip, which is a methylation chip having probes that specifically bind to methylated regions. The chip is used to measure the methylation level.

[0029] In some specific embodiments, the detection reagent includes, but is not limited to, nucleic acid primers and nucleic acid probes for measuring the methylation level by methylation fluorescence quantitative PCR.

[0030] Furthermore, the detection reagent further includes internal standard primers and internal standard probes.

[0031] In a specific embodiment, the target of the internal standard primers and probes is the ACTB gene.

[0032] In a preferred embodiment, the target of the internal standard primers and probes is the region of the ACTB gene shown as SEQ ID NO: 4.

[0033] The region of SEQ ID NO: 4 of the ACTB gene (Gene bank accession number: NC_000007.14) is as follows:

[0034] TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAG CATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCTTCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGA.

[0035] When the detection reagent includes nucleic acid primers and nucleic acid probes, the detection reagent detects the methylation level of nucleic acids in a sample by methylation fluorescence quantitative PCR.

[0036] In the present invention, "methylation fluorescence quantitative PCR" refers to subjecting the region to be detected to bisulfite conversion or digestion with methylation-sensitive restriction endonucleases, and then performing fluorescence quantitative PCR detection using primers and probes specifically designed for the detection target, so as to obtain the methylation level of the region to be detected.

[0037] The above reagent combination may further include other reagents. Specifically, for example, various reagents required for pre-processing or pre-treatment of the sample. For example, a sample releasing agent for extracting sample nucleic acid, a purifying agent for purifying sample nucleic acid, bisulfite or hydrogen sulfite used for conversion, etc.

[0038] In some specific embodiments, the detection reagents are as shown in Table 1. Among the following detection reagents, the upstream primer / downstream primer / probe pair for detecting one target corresponds to one group. Use the upstream primer / downstream primer / probe for detecting the target(s) to be detected, that is, this group. Therefore, the detection reagents of the present invention may include any one or more groups of the following primer probes.

[0039] Table 1

[0040] Primer Name Number Sequence (5’-3’) ME-JAM3-F SEQ ID NO:5 CATGCGCGCGGGGACTAC ME-JAM3-R SEQ ID NO:6 GGCAGCCGAGCGCAGAGC ME-JAM3-P SEQ ID NO:7 CCGCCTCAGCGCCATGTCGAG ME-PCDHGB7-F SEQ ID NO:8 AGTGCAGAGCAAGCGCTGACG ME-PCDHGB7-R SEQ ID NO:9 GCGCAGCCGGGAGCCTC ME-PCDHGB7-P SEQ ID NO:10 CAGCCTCTAGCCTGGGATTCCCTGC ME-SORCS1-F SEQ ID NO:11 CTGGCGGCTGTGGGGGG ME-SORCS1-R SEQ ID NO:12 CGGCTCGCTCCGTCCGG ME-SORCS1-P SEQ ID NO:13 AGGACCCCAACTCCATCCAAG ME-ACTB-F SEQ ID NO:14 GTTGTTACAGGAAGTCCCTTGCC ME-ACTB-R SEQ ID NO:15 GCAATGCTATCACCTCCCCTGTG ME-ACTB-P SEQ ID NO:16 CTTGGGAGAGGACTGGGCCATTCTCC

[0041] In some specific embodiments, the four fluorescence channels adopted in the present invention are respectively FAM, ROX, HEX, and CY5 channels, but in actual application, it is not limited thereto and may be any combination of other fluorescence channels; at the same time, different targets may also correspond to different fluorescence channels. For example, any one fluorescence channel can be used as the internal standard detection channel.

[0042] In some specific embodiments, the present invention further includes a storage medium storing computer instructions, and the computer instructions are executed to implement a model for detecting cervical cancer and high-grade cervical lesions.

[0043] Furthermore, the cervical cancer and high-grade cervical lesions include cervical intraepithelial neoplasia grade 2 (CIN2), cervical intraepithelial neoplasia grade 3 (CIN3), and cervical cancer.

[0044] Further, the CIN2+ diagnosis model is:

[0045]

[0046] Wherein, X1 is the methylation level of the JAM3 gene; X2 is the methylation level of the PCDHGB7 gene; X3 is the methylation level of the SORCS1 gene.

[0047] When the P value calculated by the prediction model is greater than or equal to 0.295, it is judged as positive; when it is less than 0.295, it is judged as negative.

[0048] Furthermore, the CIN3+ diagnostic model is as follows:

[0049]

[0050] Among them, X1 is the methylation level of the JAM3 gene; X2 is the methylation level of the PCDHGB7 gene; X3 is the methylation level of the SORCS1 gene.

[0051] When the P value calculated by the prediction model is greater than or equal to 0.103, it is judged as positive; when it is less than 0.103, it is judged as negative.

[0052] Using the storage medium of the present invention can further enhance the effect of detecting cervical cancer and high-grade cervical lesions, and its sensitivity, specificity, positive predictive value and negative predictive value can all be improved.

[0053] In a second aspect, the present invention provides a kit for detecting cervical cancer and high-grade cervical lesions (CIN2 and CIN3), and the kit includes the reagent combination as described above.

[0054] Furthermore, the kit further includes at least one of reagents for nucleic acid extraction, reagents for nucleic acid purification, and bisulfite.

[0055] Furthermore, the kit further includes negative samples.

[0056] Specifically, the negative sample is human genomic DNA that has been verified by sequencing to have no methylation of the target gene.

[0057] Furthermore, the kit further includes at least one of dNTPs, Mg 2+ , methylation-sensitive restriction endonuclease, PCR buffer, and hot start enzyme.

[0058] Furthermore, the methylation-sensitive restriction endonuclease includes at least one of HpaII, HinP1I, and HhaI.

[0059] Furthermore, the range of the final concentration of each component is as follows: Mg 2+ 1 - 6 mM, dNTPs 1 - 80 mM, methylation-sensitive restriction endonuclease 0.01 - 30 U, primers 0.1 - 40 μM, probes 0.1 - 20 μM.

[0060] The methylation-sensitive restriction endonuclease adopted by the present invention can specifically recognize the restriction site and perform cleavage. If a specific base in the recognition sequence is methylated, it remains intact and is detected by PCR. Compared with the traditional bisulfite conversion method, the cleavage method does not require conversion and purification recovery, takes less time, has no nucleic acid loss, and has high detection sensitivity. Brief Description of the Drawings

[0061] Figure 1 Detection of methylation of the composition of the present invention at 0.05 ng / reaction;

[0062] Figure 2 Detection of no non-specific amplification of the composition of the present invention in non-methylated DNA at 20 ng / reaction;

[0063] Figure 3 ROC curve analysis results of the composition of the present invention. Detailed Description of the Invention

[0064] The present invention will be specifically described below in combination with specific implementation schemes and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these specific implementation schemes and examples are used to illustrate the present invention, rather than limiting the present invention.

[0065] Example 1. Screening of Methylated Genes

[0066] Based on public data source platforms such as TCGA, NCBI, GEO, and EBI ArrayExpress, the present invention collects and mines cervical cancer methylation data, and uses a variety of bioinformatics to perform differential analysis on the methylation levels of normal cervix or cervical inflammation, cervical intraepithelial neoplasia grade 1 (CIN1), cervical intraepithelial neoplasia grade 2 (CIN2), cervical intraepithelial neoplasia grade 3 (CIN3), and cervical cancer samples, and preliminarily screens out relatively specific methylation markers. Further, the methylation level of real clinical samples is detected and analyzed and verified by fluorescence quantitative PCR.

[0067] Finally, based on the modeling analysis of cervical exfoliated cell sample data, it is determined that the CpG island regions of three genes, JAM3, PCDHGB7, and SORCS1, are selected as optional detection targets, and a combined model of these three genes is further constructed for detecting cervical cancer and high-grade cervical lesions, and its detection performance is evaluated in different populations.

[0068] Example 2. Detection of Gene Methylation Level of Standard Products

[0069] Positive samples: Prepared by mixing standard methylated human genomic DNA and target gene non-methylated human genomic DNA, with a concentration of 1 ng / μL containing 10% standard methylated human genomic DNA; a concentration of 1 ng / μL containing 1% standard methylated human genomic DNA; a concentration of 1 ng / μL containing 0.5% standard methylated human genomic DNA;

[0070] Negative samples: Human genomic DNA verified by sequencing to have no methylation of the target gene, 2 ng / μL;

[0071] Methylation-sensitive restriction endonucleases: including HpaII, HinP1I and HhaI;

[0072] Testing process:

[0073] PCR system configuration: Prepare PCR reaction solution according to the reagent formula in Table 3 below according to different detection targets

[0074] Table 3

[0075]

[0076]

[0077] The sample was added to the PCR reaction tube at 10 μL / reaction, and then 40 μL of PCR reaction solution was added in sequence. The PCR tube was capped, shaken to mix, and then centrifuged for 5 seconds.

[0078] Fluorescence PCR reaction and result analysis

[0079] 1) Place the PCR reaction tube into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order.

[0080] 2) Fluorescence detection channel selection: Select the FAM channel (Reportere: FAM, Quencher: None) to detect JAM3; select the ROX channel (Reportere: ROX, Quencher: None) to detect SORCS1; select the HEX channel (Reportere: ROX, Quencher: None) to detect PCDHGB7; select the CY5 channel (Reportere: CY5, Quencher: None) as an internal standard to detect the housekeeping gene ACTB;

[0081] 3) Fluorescence quantitative PCR reaction conditions are as shown in Table 4:

[0082] Table 4

[0083]

[0084] 4) Result analysis

[0085] After the reaction is completed, the instrument automatically saves the results and can be automatically analyzed using the instrument's own software (you can also manually adjust the baseline start value, end value, and threshold line value for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the cycle value experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold). Figures 1-2 As shown, the detection reagent provided by the present invention is 0.05ng / reaction ( Figure 1), there was no non-specific amplification in non-methylated DNA at 20 ng / reaction Figure 2 )

[0086] Example 3. Detection effect of the composition of the present invention on high-grade cervical lesions and cervical cancer

[0087] From the collected cervical exfoliated cell samples of 2372 high-risk HPV-positive individuals, 1223 clinical samples were selected according to the distribution ratio of different cervical lesions in Chinese HPV-positive individuals reported in the literature and previous studies (including 8 cases of cervical cancer [CC], 172 cases of CIN3, 192 cases of CIN2, 175 cases of CIN1, and 676 cases of Normal) for detecting the composition of the present invention, and a logistic regression algorithm model was fitted according to the obtained results

[0088] The nucleic acid was extracted using Shengxiang Biotech nucleic acid extraction reagent S10016 with the extractor natch48. According to the procedure of Example 2, the nucleic acid sample was subjected to enzymatic digestion and PCR amplification detection in the same reaction tube. For the amplification results, the ΔCt value (Ct(target gene) - Ct(housekeeping gene)) was calculated, and logistic regression fitting and ROC curve analysis were performed to obtain the prediction model

[0089] ① Taking CIN2+ as the outcome variable

[0090]

[0091] When the P value calculated by the prediction model is greater than or equal to 0.295, it is judged as positive; when it is less than 0.295, it is judged as negative

[0092] ② Taking CIN3+ as the outcome variable

[0093]

[0094] When the P value calculated by the prediction model is greater than or equal to 0.103, it is judged as positive; when it is less than 0.103, it is judged as negative

[0095] The ROC curve analysis results of prediction model ① and prediction model ② are as Figure 3 shown, showing the AUC value of the overall model and marking the optimal cut-off value in this population

[0096] The methylation test results were judged positive using the optimal cut-off value. The detection results of high-grade cervical lesions and cervical cancer by prediction model ① and prediction model ② are shown in Tables 5 - 7. Among them, CIN3+ includes CIN3 and cervical cancer, and CIN2+ includes cervical cancer, CIN3, and CIN2. The results show that the sensitivity and specificity of the composition of the present invention for detecting high-grade cervical lesions CIN2 and CIN3 and cervical cancer (CIN2+) are 69.9% and 88.8% respectively, and the sensitivity and specificity for detecting CIN3 and cervical cancer (CIN3+) are 85.0% and 81.8% respectively.

[0097] Table 5

[0098]

[0099] After being classified by prediction model ①, the detection results of the composition of the present invention in different stages of cervical cancer, cervical precancerous lesions, and cervical inflammation or normal cervix in HPV-positive populations are shown in Table 6 below.

[0100] Table 6

[0101]

[0102]

[0103] Among them, the methylation gene test results refer to the results after the methylation test Ct values of the composition of the present invention are classified by prediction model ①. CC refers to cervical cancer, CIN3 refers to cervical intraepithelial neoplasia grade 3, CIN2 refers to cervical intraepithelial neoplasia grade 2, CIN1 refers to cervical intraepithelial neoplasia grade 1, and Normal refers to normal cervix or cervical inflammation. The positive rate of methylation detection refers to the consistency between the methylation positive results of the composition of the present invention and the pathological results. P trend refers to the Cochran - Armitage trend test result. P trend <0.05 indicates that in HPV-positive populations, the methylation positive rate of the composition of the present invention gradually increases with the deepening of the severity of cervical lesions, indicating that the composition of the present invention may be able to indicate the occurrence and development of cervical lesions.

[0104] Similarly, after being classified by prediction model ②, the detection results of the composition of the present invention in different stages of cervical cancer, cervical precancerous lesions, and cervical inflammation or normal cervix in HPV-positive populations are shown in Table 7 below.

[0105] Table 7

[0106]

[0107] Among them, the methylation gene detection result refers to the result after the methylation detection Ct value of the composition of the present invention is classified by the prediction model ②. CC refers to cervical cancer, CIN3 refers to cervical intraepithelial neoplasia grade 3, CIN2 refers to cervical intraepithelial neoplasia grade 2, CIN1 refers to cervical intraepithelial neoplasia grade 1, and Normal refers to normal cervix or cervical inflammation. The methylation detection positive rate refers to the consistency between the methylation positive result of the composition of the present invention and the pathological result. P trend refers to the Cochran-Armitage trend test result, P trend <0.05 indicates that in the HPV-positive population, the methylation positive rate of the composition of the present invention gradually increases with the deepening of the severity of cervical lesions, indicating that the composition of the present invention may be able to indicate the occurrence and development of cervical lesions.

[0108] To further prove the superiority of the composition of the present invention, in the HPV-positive population of this example, the effects of cytological examination triage recommended by domestic and foreign cervical cancer screening guidelines and using the composition of the present invention to triage HPV-positive population were directly compared. The specific detection performance results of the composition of the present invention for high-grade cervical lesions and cervical cancer in this population are shown in Table 8 (with CIN2+ as the outcome) and Table 9 (with CIN3+ as the outcome).

[0109] Table 8

[0110]

[0111] Table 9

[0112]

[0113] Among them, CIN2+ includes patients with CIN2, CIN3, and CC (cervical cancer) patients, and CIN3+ includes CIN3 patients and CC patients. AUC refers to the area under the receiver operating characteristic curve, SE refers to sensitivity, SP refers to specificity, PPV refers to positive predictive value, NPV refers to negative predictive value, Referral refers to the colposcopy referral rate, and NNR refers to the number of tests required to refer 1 patient. When the cytological examination result is atypical squamous cells of undetermined significance or more severe lesions (ASC-US+), the cytological examination result is determined to be positive. Direct triage means that for the population with positive HPV test results, if the combined test result of the present invention is positive or the cytological examination result is positive, they are directly referred to colposcopy. Combined triage with HPV16 / 18 means that if the HPV test result is positive for HPV16 or HPV18, they are directly referred to colposcopy. If it is not positive for HPV16 / 18, cytology or the combination of the present invention is continued for testing, and if the test result is positive, they are referred to colposcopy.

[0114] The results showed that, compared with cytological examination, whether it was direct triage or triage in combination with HPV16 / 18, the specificity, positive predictive value and negative predictive value of the composition of the present invention were significantly better, and the colposcopy referrals were reduced by 40% - 45%. The number of colposcopies required to detect one true case of cervical cancer or high-grade cervical lesions was also reduced by approximately 40% - 65%. In particular, for CIN3+, compared with direct cytological triage or HPV16 / 18 combined cytological triage, the sensitivity of the composition of the present invention for detecting CIN3+ was equivalent or better. These results indicate that after detection with the composition of the present invention, fewer colposcopies are needed to identify true high-grade cervical lesions or cervical cancer patients from HPV-positive populations. While avoiding unnecessary psychological burdens on patients caused by positive HPV tests, it reduces the medical and health resources required for referral to colposcopy, greatly alleviating the pressure on the colposcopy process.

[0115] Example 4. Comparison of the detection effects of the composition of the present invention and other gene compositions on high-grade cervical lesions and cervical cancer

[0116] In addition to the composition of the present invention "JAM3+PCDHGB7+SORCS1", multi-target combined detection systems were constructed for multiple potential cervical cancer-related methylation genes such as JAM3, PCDHGB7, SORCS1, ZNF536, POU4F3, CADM1, EPB41L3, POU4F3, OTX1, etc. The sensitivity and specificity of each combination and the single-target / double-target of the composition of the present invention were tested using the clinical cervical exfoliated cell samples in Example 3. The results showed that the clinical performance effect of the composition of the present invention was the best, and the results are shown in Table 10 (arranged in descending order of AUC for detecting CIN3+).

[0117] Table 10

[0118]

Claims

1. Use of a composition in the preparation of a kit for detecting high-grade cervical lesions, characterized in that, The composition is a detection reagent for detecting the methylation level of the following gene regions, wherein the detection reagent is primers and probes: The region shown as SEQ ID NO:1 in the JAM3 gene; The region shown as SEQ ID NO:2 in the PCDHGB7 gene; and The region shown as SEQ ID NO:3 in the SORCS1 gene.

2. The use according to claim 1, wherein The detection reagent further includes the detection reagent used in amplification-sequencing, chip detection, or methylation fluorescence quantitative PCR for detecting the methylation level.

3. The use according to claim 2, characterized in that, The detection reagent further includes any one or more of nucleic acid primers, sequencing Tag sequences, methylation chips, or nucleic acid probes.

4. The use according to claim 3, characterized in that, The nucleic acid primers and nucleic acid probes are: The nucleic acid primers and probes shown as SEQ ID NO:5 to 13.

5. The use according to any one of claims 1 to 4, characterized in that, The composition further includes an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for detection.

6. The use according to any one of claims 1 to 4, characterized in that, The kit further includes at least one of dNTPs, Mg 2+ , methylation-sensitive restriction enzyme, PCR buffer, or hot start enzyme.

7. The use according to claim 6, characterized in that, The methylation-sensitive restriction enzyme includes at least one of HpaII, HinP1I, or HhaI.

Images