A microsatellite primer set for species identification of yellow sand softshell turtle and its application

Abstract

The present invention belongs to the field of molecular biology technology, and specifically relates to a microsatellite primer set for identifying yellow sand softshell turtle varieties, comprising a first primer set and a second primer set, wherein the sequence of the first primer set comprises: an upper primer: CTGAAGTCTGGCACTAAGCTTTCC, a lower primer: GTCTAAATTCCGAAGCGGGTAAAA; the sequence of the second primer set comprises: an upper primer: TAGCCCCGAGATTATCAGAGACAG, a lower primer: TGTGGCTGGTTGGTGTAGTAAGAA, and application of the microsatellite primer set in identifying yellow sand softshell turtle varieties. The microsatellite primer set proposed by the present invention has high conservatism and high versatility, and can accurately and quickly identify yellow sand softshell turtle varieties, thereby effectively improving the accuracy of identifying yellow sand softshell turtle varieties.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a microsatellite primer set for identifying yellow sand softshell turtle varieties and an application thereof. Background Art

[0002] Chinese soft-shell turtle, also known as soft-shelled turtle, belongs to the class Reptilia, order Testudinata, family Testudinidae, genus Chinese soft-shelled turtle. It is widely distributed in my country, Japan, South Korea, Vietnam and other places. Due to the vast territory of my country, different geographical species have been formed in different regions after long-term geographical isolation and artificial selection. Among them, the yellow sand soft-shell turtle, also known as the southwest strain, is mainly distributed in the Zuojiang, Youjiang, Yongjiang, Yujiang and Xijiang River basins in Guangxi. It has a golden body color, a flat round body, a wide skirt, a beige abdomen, and clearly visible carapace ribs. The meat of the yellow sand soft-shell turtle is delicious and has high nutritional value. It is the pillar industry of turtle breeding in Guangxi. Since the 1990s, with the continuous improvement of people's living standards, the artificial breeding industry of Chinese soft-shelled turtle has developed rapidly. Various imported turtles, hybrid turtles, and artificially bred new strains of Chinese soft-shelled turtles have gradually occupied the local turtle species market, causing serious damage to the germplasm resources of local Chinese soft-shelled turtles. The yellow sand soft-shelled turtle is not only a geographical species unique to Guangxi, but also has higher genetic diversity than geographical species such as the Yellow River soft-shelled turtle and the Dongting soft-shelled turtle, and is genetically farther away from other geographical species. Therefore, it can be used as a preferred parent for hybrid breeding. Germplasm protection of the yellow sand soft-shelled turtle can not only avoid germplasm degeneration, but also lay the foundation for subsequent hybrid breeding work.

[0003] To protect germplasm, we first need to establish a fast and convenient germplasm identification technology. Molecular marker technology is not affected by the growth environment, physiological conditions and age, and can directly detect the variation of DNA molecular base sequences to distinguish species. It has been widely used in species identification. There are many types of molecular markers, among which microsatellite markers (SSR, i.e. simple sequence repeats) are one of the most promising molecular markers. SSR is a simple repetitive sequence composed of qualified nucleotides present in the genome of eukaryotic organisms. It has the characteristics of co-dominance, high polymorphism, and random distribution in the genome. Compared with other markers, SSR can better reveal the overall characteristics of the entire genome. However, in the species identification of yellow sand softshell turtle, relevant molecular markers have not yet been developed.

[0004] At present, the germplasm identification methods for yellow sand softshell turtle mainly focus on phenotype and genotype. The method of measuring morphological indicators of each geographical species based on phenotype and establishing a discriminant formula is simple and intuitive, but the error rate is high and it cannot be distinguished well. Based on the genotype, 4 SNP markers that can be used to identify the yellow sand softshell turtle have been found, but SNP is more suitable for large-scale and highly automated analysis, while the high conservatism and versatility of SSR make its identification more accurate. Summary of the invention

[0005] 1. Technical issues to be solved

[0006] The purpose of the present invention is to solve the problem that the prior art method for identifying the germplasm of yellow sand softshell turtle has a high error rate and cannot distinguish well, and to propose a microsatellite primer set for yellow sand softshell turtle variety identification and its application.

[0007] 2. Technical solution

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] A microsatellite primer set for identifying yellow sand softshell turtle varieties comprises a first primer set and a second primer set, wherein the sequence of the first primer set comprises: an upper primer: CTGAAGTCTGGCACTAAGCTTTCC, and a lower primer: GTCTAAATTCCGAAGCGGGTAAAA; and the sequence of the second primer set comprises: an upper primer: TAGCCCCGAGATTATCAGAGACAG, and a lower primer: TGTGGCTGGTTGGTGTAGTAAGAA.

[0010] The present invention also proposes the application of the microsatellite primer set in the identification of yellow sand softshell turtle varieties.

[0011] The present invention also proposes a method for preparing a microsatellite primer set for identifying yellow sand softshell turtle species, comprising the following steps:

[0012] S1: The skirts of 10 turtles from each of the six groups of yellow sand turtle, Japanese turtle, Dongting turtle, Yellow River turtle, Changyong turtle and Black turtle were collected for Super-GBS sequencing, and the SSR loci were found using MISA software, and the intersection of the found SSR and InDel was taken;

[0013] S2: 113 SSR markers were randomly selected and upstream and downstream primers were designed using Primer software;

[0014] S3: Synthesize primers, randomly select 10 sample DNAs from each population and mix them to make a mixed DNA sample as a PCR reaction template for the preliminary screening of SSR markers, perform PCR reaction, and detect the PCR products by agarose gel electrophoresis to screen out marker primers with correct products, clear bands, and single bands;

[0015] S4: The labeled primers obtained in S3 are also used in the DNA mixed sample to perform gradient PCR amplification according to the average Tm value of each pair of upstream and downstream primers, using the average Tm value ± 5°C temperature. The amplified products are detected by agarose gel electrophoresis, and the optimal amplification temperature is selected according to the band clarity;

[0016] S5: DNA samples from two populations were randomly selected from the six populations, and the marker primers screened in S3 were used for PCR amplification at the optimal annealing temperature. The amplified products were detected by 8% agarose gel electrophoresis, and microsatellite markers were screened again. After the electrophoresis, silver nitrate staining was performed, and film photography was used to record the results, and primers with good polymorphism and clear bands were screened out;

[0017] S6: Use the primers screened in S5, and the mixed DNA samples of the six populations prepared in S3 as templates. Randomly add four fluorescent linkers, FAM, ROX, HEX, and TAMRA, to the front end of the primers. Perform fluorescent PCR amplification at the optimal annealing temperature, and detect the amplified products by capillary electrophoresis. Based on the similarities and differences in the waveforms of each population, screen out SSR marker primers that can identify the yellow sand softshell turtle from other populations.

[0018] Preferably, the PCR reaction system in S3 is: Mix 12.5 μL, Primer 1 μL, DNA 1 μL, H2O 9.5 μL, and the amplification reaction program is: 95°C 5 min, 94°C 30 s, 56-61°C 30 s, 72°C 1 min 35×, 72°C 5 min.

[0019] Preferably, the loading amount of PCR product and DNA marker in S5 is 1.5 μL, the electrophoresis buffer is 1×TBE, the pre-electrophoresis is performed at 180 V for 1 h, and the main electrophoresis is performed at 300 V for 2.5 h.

[0020] Preferably, the amplification reaction system and reaction procedure in S6 are the same as those in S3.

[0021] The present invention also proposes a method for identifying yellow sand softshell turtle species, comprising the following steps:

[0022] Step 1: Extract genomic DNA from 30 individuals from each of the six groups: yellow sand turtle, Japanese soft-shell turtle, Dongting soft-shell turtle, Changyong soft-shell turtle, Yellow River soft-shell turtle, and black soft-shell turtle;

[0023] Step 2: Use the two sets of microsatellite primers provided to perform PCR amplification and capillary electrophoresis detection on the genomic DNA obtained in step 1.

[0024] 3. Beneficial effects

[0025] Compared with the prior art, the advantages of the present invention are:

[0026] The microsatellite primer set proposed in the present invention is highly conservative and highly universal, and can accurately and quickly identify the varieties of yellow sand softshell turtle, thereby effectively improving the accuracy of identification of the yellow sand softshell turtle varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1The result of capillary electrophoresis detection of genomic DNA of yellow sand soft-shell turtle, Japanese soft-shell turtle, Dongting soft-shell turtle, Changyong soft-shell turtle, Yellow River soft-shell turtle and Black soft-shell turtle by using the first primer set proposed in Example 2 of the present invention;

[0028] Figure 2 This is a graph showing the results of capillary electrophoresis detection of genomic DNA of yellow sand soft-shell turtle, Japanese soft-shell turtle, Dongting soft-shell turtle, Changyong soft-shell turtle, Yellow River soft-shell turtle and Black soft-shell turtle using the second primer set proposed in Example 2 of the present invention. DETAILED DESCRIPTION

[0029] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0030] Embodiment 1:

[0031] A microsatellite primer set for identifying yellow sand softshell turtle varieties comprises a first primer set and a second primer set, wherein the sequence of the first primer set comprises: an upper primer: CTGAAGTCTGGCACTAAGCTTTCC, and a lower primer: GTCTAAATTCCGAAGCGGGTAAAA; and the sequence of the second primer set comprises: an upper primer: TAGCCCCGAGATTATCAGAGACAG, and a lower primer: TGTGGCTGGTTGGTGTAGTAAGAA.

[0032] In this embodiment, a method for preparing a microsatellite primer set for identifying species of yellow sand softshell turtle comprises the following steps:

[0033] S1: The skirts of 10 turtles from each of the six groups of yellow sand turtle, Japanese turtle, Dongting turtle, Yellow River turtle, Changyong turtle and Black turtle were collected for Super-GBS sequencing, and the SSR loci were found using MISA software, and the intersection of the found SSR and InDel was taken;

[0034] S2: 113 SSR markers were randomly selected and upstream and downstream primers were designed using Primer software;

[0035] S3: Synthesize primers, randomly select 10 sample DNAs from each population and mix them to make a mixed DNA sample as a PCR reaction template for the preliminary screening of SSR markers. The PCR reaction system is: Mix 12.5μL, Primer 1μL, DNA 1μL, H2O9.5μL, and the amplification reaction program is: 95℃5min, 94℃30s, 56-61℃30s, 72℃1min 35×, 72℃5min. The PCR product is detected by agarose gel electrophoresis to screen out the marker primers with correct products, clear bands, and single bands;

[0036] S4: The labeled primers obtained in S3 are also used in the DNA mixed sample to perform gradient PCR amplification according to the average Tm value of each pair of upstream and downstream primers, using the average Tm value ± 5°C temperature. The amplified products are detected by agarose gel electrophoresis, and the optimal amplification temperature is selected according to the band clarity;

[0037] S5: DNA samples from two groups were randomly selected from the six groups. The marker primers screened in S3 were used for PCR amplification at the optimal annealing temperature. The amplified products were detected by 8% agarose gel electrophoresis for rescreening of microsatellite markers. The loading amount of PCR product and DNA marker was 1.5 μL. The electrophoresis buffer was 1×TBE. The pre-electrophoresis was performed at 180 V for 1 h and the formal electrophoresis was performed at 300 V for 2.5 h. After the electrophoresis was completed, silver nitrate staining was performed and film was taken for recording. Primers with good polymorphism and clear bands were screened out.

[0038] S6: Use the primers screened in S5, and use the mixed DNA samples of the six populations prepared in S3 as templates. Randomly add four fluorescent linkers, FAM, ROX, HEX, and TAMRA, to the front end of the upper primers. Perform fluorescent PCR amplification at the optimal annealing temperature. The amplification reaction system and reaction procedure are the same as those in S3. The amplified products are detected by capillary electrophoresis. According to the similarities and differences in the waveforms of each population, SSR marker primers that can identify the yellow sand softshell turtle from other populations are screened.

[0039] In this embodiment, the proposed microsatellite primer set is highly conservative and highly universal, and can accurately and quickly identify the yellow sand soft-shelled turtle species, thereby effectively improving the accuracy of identification of the yellow sand soft-shelled turtle species.

[0040] Embodiment 2:

[0041] In this embodiment, a method for identifying yellow sand softshell turtle species includes the following steps:

[0042] Step 1: Extract genomic DNA from 30 individuals from each of the six groups: yellow sand turtle, Japanese soft-shell turtle, Dongting soft-shell turtle, Changyong soft-shell turtle, Yellow River soft-shell turtle, and black soft-shell turtle;

[0043] Step 2: Use the two sets of microsatellite primers provided to perform PCR amplification and capillary electrophoresis detection on the genomic DNA obtained in step 1.

[0044] In this embodiment, the test results are as follows: Figure 1 (First Primer Set), Figure 2 (The second primer set) shows that the waveform of the yellow sand softshell turtle is significantly different from that of other populations and can be distinguished from the other five populations.

[0045] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A microsatellite primer set for identifying species of yellow sand softshell turtle, comprising a first primer set and a second primer set, characterized in that: The sequence of the first primer set includes: upper primer: CTGAAGTCTGGCACTAAGCTTTCC, lower primer: GTCTAAATTCCGAAGCGGGTAAAA; the sequence of the second primer set includes: upper primer: TAGCCCCGAGATTATCAGAGACAG, lower primer: TGTGGCTGGTTGGTGTAGTAAGAA.

2. The microsatellite primer set for species identification of the yellow sand softshell turtle according to claim 1, characterized in that: The application of the microsatellite primer set in the identification of yellow sand softshell turtle varieties.

3. The method for preparing a microsatellite primer set for identifying species of yellow sand softshell turtle according to claim 1, characterized in that: The following steps are involved: S1: The skirts of 10 turtles from each of the six groups of yellow sand turtle, Japanese turtle, Dongting turtle, Yellow River turtle, Changyong turtle and Black turtle were collected for Super-GBS sequencing, and the SSR loci were found using MISA software, and the intersection of the found SSR and InDel was taken; S2: 113 SSR markers were randomly selected and upstream and downstream primers were designed using Primer software; S3: Synthesize primers, randomly select 10 sample DNAs from each population and mix them to make a mixed DNA sample as a PCR reaction template for the preliminary screening of SSR markers, perform PCR reaction, and detect the PCR products by agarose gel electrophoresis to screen out marker primers with correct products, clear bands, and single bands; S4: The labeled primers obtained in S3 are also used in the DNA mixed sample to perform gradient PCR amplification according to the average Tm value of each pair of upstream and downstream primers, using the average Tm value ± 5°C temperature. The amplified products are detected by agarose gel electrophoresis, and the optimal amplification temperature is selected according to the band clarity; S5: DNA samples from two populations were randomly selected from the six populations, and the marker primers screened in S3 were used for PCR amplification at the optimal annealing temperature. The amplified products were detected by 8% agarose gel electrophoresis, and microsatellite markers were screened again. After the electrophoresis, silver nitrate staining was performed, and film photography was used to record the results, and primers with good polymorphism and clear bands were screened out; S6: Use the primers screened in S5, and the mixed DNA samples of the six populations prepared in S3 as templates. Randomly add four fluorescent linkers, FAM, ROX, HEX, and TAMRA, to the front end of the primers. Perform fluorescent PCR amplification at the optimal annealing temperature, and detect the amplified products by capillary electrophoresis. Based on the similarities and differences in the waveforms of each population, screen out SSR marker primers that can identify the yellow sand softshell turtle from other populations.

4. The method for preparing a microsatellite primer set for identifying species of yellow sand softshell turtle according to claim 3, characterized in that: The PCR reaction system in S3 is: Mix 12.5 μL, Primer 1 μL, DNA 1 μL, H2O 9.5 μL, and the amplification reaction program is: 95°C 5 min, 94°C 30 s, 56-61°C 30 s, 72°C 1 min 35×, 72°C 5 min.

5. The method for preparing a microsatellite primer set for identifying species of yellow sand softshell turtle according to claim 3, characterized in that: The loading amount of PCR product and DNA marker in S5 was 1.5 μL, the electrophoresis buffer was 1×TBE, the pre-electrophoresis was performed at 180 V for 1 h, and the main electrophoresis was performed at 300 V for 2.5 h.

6. The method for preparing a microsatellite primer set for identifying species of yellow sand softshell turtle according to claim 3, characterized in that: The amplification reaction system and reaction procedure in S6 are the same as those in S3.

7. A method for identifying species of yellow sand softshell turtle, characterized in that: The following steps are involved: Step 1: Extract genomic DNA from 30 individuals from each of the six groups: yellow sand turtle, Japanese soft-shell turtle, Dongting soft-shell turtle, Changyong soft-shell turtle, Yellow River soft-shell turtle, and black soft-shell turtle; Step 2: Using the two sets of microsatellite primers provided in claim 1, the genomic DNA obtained in step 1 is subjected to PCR amplification and capillary electrophoresis detection.

Images