A rapid and sensitive rabies live virus kit, detection method and application thereof

Abstract

The present invention belongs to the field of gene detection technology, and discloses a rapid and sensitive rabies live virus kit, detection method and application thereof. The method designs primers, probes and standard products based on the region where the rabies virus N protein is located, specifically detects the presence of intermediate cDNA produced during the rabies virus replication process, and thus quantitatively detects the rabies live virus with replication activity and infectious activity. The method can realize rapid and sensitive detection of rabies live virus, and its minimum detection limit is 10 3 copies·μL ‑1 Compared with traditional detection methods, it is simpler, faster and more sensitive, while saving time and cost. It is very suitable for the rapid detection of live rabies virus and the detection of residual live virus after the rabies virus inactivation process.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, and particularly relates to a rapid and sensitive rabies live virus kit, a detection method and an application thereof. Background Art

[0002] Rabies virus (RABVs) is a single-stranded negative-sense RNA virus of the genus Lyssavirus of the family Rhabdoviridae and is the pathogen of rabies. Rabies is a zoonotic disease. Once symptoms appear, it is almost 100% fatal. The most effective way to prevent rabies is to inject rabies vaccine in time. At present, the inactivated rabies virus vaccine produced by Vero cells and diploid cells has the largest market share. The most important step in the safe production of inactivated rabies vaccine is the inactivation verification step. The classic inactivation verification method requires a 35-day testing cycle from cell culture to inoculation of mice until the final data is obtained. The costs of manpower, time, sample storage, etc. involved during this period are huge, and the product production operation process time is also extended. Therefore, it is very valuable to invent a rapid and sensitive method for detecting residual live rabies virus.

[0003] RABVs begin their infection cycle after infecting host cells. Viral genomic RNA (vRNA) is used as a template for transcription and translation to produce viral proteins required for RABVs replication. In the late stage of infection, the activity of the polymerase switches to replication to produce full-length positive-strand RNA copies. These complementary RNAs (cRNA) are used as templates to make new negative-strand vRNAs, which are then packaged into ribonucleoproteins together with protein N to form new viruses. The presence of positive-strand cRNA can be used as a marker for RABVs replication in infected cells. Therefore, methods for detecting specific chains of viral RNA in infected cells or tissues are very important for the study of RNA viruses and the detection of residual live viruses.

[0004] Fluorescence quantitative method (Reverse transcription-quantitative PCR, RT-qPCR) has high sensitivity and repeatability and is widely used in virus quantification and pathogen detection. However, the simple RT-qPCR method cannot distinguish between infectious live viruses and inactivated dead viruses, that is, it cannot distinguish between positive-strand and negative-strand RNA during RNA virus replication, and cannot verify the residual live virus in the inactivated rabies virus vaccine. Summary of the invention

[0005] In order to overcome the problems of the prior art, the present invention applies the strand-specific RT-qPCR detection method (ssRT-qPCR) to the detection of live rabies virus for the first time, and proposes a rapid and sensitive detection kit, detection method and application of live rabies virus. This method effectively detects the residual live virus after the rabies virus inactivation process, and compresses the classic inactivation verification method from cell culture to test results from 35 days to 7 days, greatly shortening the detection cycle, saving manpower, material resources and production costs, and improving the production efficiency of rabies virus inactivated vaccines.

[0006] The classical rabies virus vaccine inactivation verification method needs to go through three weeks of three blind cell culture stages and two weeks of animal inoculation stages before the final statistical results can be obtained. The exogenous contamination involved in the three blind cell culture processes and the judgment results of nonspecific death or specific death in animal experiments affect the final results to a certain extent. Therefore, the present invention has developed a rapid and sensitive rabies live virus detection method, which can obtain the judgment result of the accurate residual live virus copy number at the end of the first blind cell culture, and the use of molecular biological gene detection methods improves the sensitivity of the detection results and reduces the influence of human operation factors. However, the inventors found that the use of ssRT-qPCR for rabies virus inactivation verification of residual live virus detection has certain challenges. First, the content of residual live virus after conventional inactivation process is extremely low, and the number of intermediate cRNA copies produced by rabies virus during virus replication is naturally less than the number of copies of viral genome vRNA. In addition, both dead and live viruses contain viral genome vRNA. Conventional qPCR detection cannot distinguish between vRNA and cRNA, and the large amount of vRNA will mask the detection signal of cRNA and cause false negatives, thereby making the specific detection of cRNA complicated. Secondly, vRNA and cRNA are reverse complementary single-stranded RNAs. After reverse transcription into cDNA, the product obtained by qPCR amplification is a double-stranded sequence, that is, the double-stranded sequences of the products of vRNA and cRNA are almost the same. The detection result of conventional qPCR is only a mixture of the two products, and it is impossible to achieve specific quantification for the specified chain. Third, in order to avoid false positives, the present invention designs probes for the positive and negative chains separately to avoid the probes combining with the cDNA itself and the residual transcription primers in the cDNA to produce signals that affect the final result judgment. At the same time, the fluorescent signals marked by the positive and negative chain probes are respectively set in signal channels that do not interfere with each other, which can realize the simultaneous detection of positive and negative chains on the qPCR quantitative instrument. Fourth, the target of detection belongs to viral RNA, and the in vitro viral RNA with a small content is very easy to degrade. The present invention uses a chain-specific reverse transcription reaction to reverse transcribe RNA into cDNA, and fixes the content of cRNA and vRNA on the source template, so that the detection results are more accurate, and the storage period of the test samples is extended, so that the process production arrangement can be flexibly and effectively planned. Fifth, the design range of the primers, probes and standards of the present invention is selected from the region where the rabies virus N protein is located. RABVs virus replication depends on the intracellular concentration of the newly synthesized protein N, so the method of the present invention can more accurately detect the actual replication of the virus. In addition, the sequence design of the chain-specific reverse transcription primer, the chain-specific label qPCR primer, the detection probe, and the setting of the reaction conditions will affect the specificity, sensitivity and repeatability of the detection. In view of this, the inventors provide the following scheme of the present invention.

[0007] The first aspect of the present invention provides a rapid and sensitive method for detecting live rabies virus. The method designs primers, probes and standards based on the region where the rabies virus N protein is located, specifically detects the presence of intermediate cRNA produced during the replication of the rabies virus, and quantitatively detects live rabies virus with replication activity and infectious activity, and specifically comprises the following steps:

[0008] 1) Using the gradient diluted positive and negative strand nucleic acid detection standards as templates, using strand-specific label qPCR primers and corresponding detection probes to perform ssRT-qPCR amplification, and using the logarithmic value of the nucleic acid detection standard copy number and the obtained Cp value to draw a standard curve;

[0009] 2) Collect the cell or tissue sample to be tested, extract RNA, and reverse transcribe the viral RNA into cDNA using strand-specific reverse transcription primers;

[0010] 3) Using the sample cDNA obtained in step 2) as a template, ssRT-qPCR is performed under the same conditions as step 1), and the obtained Cp value is compared with the standard curve, and the cDNA reverse transcribed from the positive and negative strand RNA of rabies virus in the test sample is subjected to absolute quantitative detection, respectively, to further complete the absolute quantification of the copy number of the specific strand of rabies virus.

[0011] Furthermore, the strand-specific reverse transcription primers include a positive strand cRNA reverse transcription primer and a negative strand vRNA reverse transcription primer;

[0012] The positive-strand cRNA reverse transcription primer has a nucleotide sequence as shown in SEQ ID No. 1 in the sequence list: GGCTCTGGGCGCTGGAAATGAAGAGATCGCACATACGGAGAT; wherein it contains a non-viral sequence tag GGCTCTGGGCGCTGGAAA;

[0013] The negative-strand vRNA reverse transcription primer has a nucleotide sequence as shown in SEQ ID No. 2 in the sequence table: GCTGAACGCCGTTAGCTATCAGAAACTCGGCGAATGAGTTTGG; wherein it contains a non-viral sequence tag GCTGAACGCCGTTAGCTATC.

[0014] The chain-specific label qPCR primers include positive-chain cRNA chain-specific label qPCR upstream primer / downstream primer and negative-chain vRNA chain-specific label qPCR upstream primer / downstream primer;

[0015] The positive-strand cRNA chain-specific tag qPCR upstream primer has a nucleotide sequence as shown in SEQ ID No. 3 in the sequence list, which is a non-viral sequence tag GGCTCTGGGCGCTGGAAA;

[0016] The positive-strand cRNA chain-specific tag qPCR downstream primer has a nucleotide sequence as shown in SEQ ID No. 4 in the sequence list: AGAAACTCGGCGAATGAGTTTGG;

[0017] The negative-strand vRNA chain-specific tag qPCR upstream primer has a nucleotide sequence as shown in SEQ ID No. 5 in the sequence list, which is a non-viral sequence tag GCTGAACGCCGTTAGCTATC;

[0018] The negative-strand vRNA chain-specific tag qPCR downstream primer has a nucleotide sequence as shown in SEQ ID No. 6 in the sequence table: TGAAGAGATCGCACATACGGAG.

[0019] The detection probe is a fluorescently labeled Taqman probe, including a Taqman detection probe for positive-strand cRNA and a Taqman detection probe for negative-strand vRNA; the Taqman detection probe for positive-strand cRNA has a nucleotide sequence as shown in SEQ ID No. 7 in the sequence list: ATGTCTCAGTCAGTTCC, and both ends of the sequence are modified with 5'6-FAM and 3'MGB, respectively;

[0020] The Taqman detection probe of the negative-strand vRNA has a nucleotide sequence as shown in SEQ ID No. 8 in the sequence list: CGAGCTTGATGATTGGAA, and both ends of the sequence are modified with 5'CY5 and 3'MGB, respectively.

[0021] Further preferably, the absolute quantification of viral RNA copy number requires the use of positive and negative strand nucleic acid detection standards, the positive and negative strand nucleic acid detection standards include positive strand cRNA detection standards and negative strand vRNA detection standards, and the positive strand cRNA detection standards and negative strand vRNA detection standards are used to perform parallel test reactions;

[0022] The positive-strand cRNA detection standard has a nucleotide sequence as shown in SEQ ID No. 9 in the sequence list: GGCTCTGGGCGCTGGAAATGAAGAGATCGCACATACGGAGATATGTCTCA GTCAGTTCCAATCATCAAGCTCGTCCAAACTCATTCGCCGAGTTTCT;

[0023] The negative-strand vRNA detection standard has a nucleotide sequence as shown in SEQ ID No. 10 in the sequence list: GCTGAACGCCGTTAGCTATCAGAAACTCGGCGAATGAGTTTGGACGAGCT TGATGATTGGAACTGACTGAGACATATCTCCGTATGTGCGATCTCTTCA.

[0024] Furthermore, the ssRT-qPCR reaction system includes:

[0025]

[0026] Total 10 μl;

[0027] The nucleotide sequences of the primers are shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, and SEQ ID No.6; the nucleotide sequences of the detection probes are shown in SEQ ID No.7 and SEQ ID No.8.

[0028] Furthermore, the reaction procedure of the ssRT-qPCR includes enzyme activation and amplification cycles, specifically:

[0029] Enzyme activation: 30s-10min, the number of amplification cycles is 1 cycle; the preferred enzyme activation reaction conditions: 95°C for 10min;

[0030] Amplification cycles: 95°C for 10s, 60°C for 30s, with the number of amplification cycles ranging from 40 to 50 cycles. Preferably, a cycle number of 40 can be used for absolute quantification of viral RNA copy number. Preferably, a cycle number of 50 can be used for cRNA detection of extremely low viral load samples to distinguish between positive and negative cRNA.

[0031] The second aspect of the present invention provides a strand-specific real-time RT-qPCR detection kit for live rabies virus, the kit comprising a synthetic strand-specific reverse transcription primer, a strand-specific label qPCR primer, and a detection probe;

[0032] The chain-specific reverse transcription primers include a positive-chain cRNA reverse transcription primer and a negative-chain vRNA reverse transcription primer, and their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively;

[0033] The chain-specific label qPCR primers include a positive-chain cRNA chain-specific label qPCR upstream primer / downstream primer and a negative-chain vRNA chain-specific label qPCR upstream primer / downstream primer, and their nucleotide sequences are shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, respectively;

[0034] The detection probes include a Taqman detection probe for positive-strand cRNA and a Taqman detection probe for negative-strand vRNA, and their nucleotide sequences are shown in SEQ ID No.7 and SEQ ID No.8, respectively.

[0035] Furthermore, the kit also includes positive and negative strand nucleic acid detection standards, and the nucleotide sequences of the positive strand cRNA detection standard and the negative strand vRNA detection standard are shown in SEQ ID No.9 and SEQ ID No.10, respectively.

[0036] Furthermore, the detection probe is a fluorescently labeled Taqman probe. Preferably, the Taqman detection probe sequence of the positive-strand cRNA is modified with 5'6-FAM and 3'MGB at both ends, and the Taqman detection probe sequence of the negative-strand vRNA is modified with 5'CY5 and 3'MGB at both ends.

[0037] The third aspect of the present invention provides the use of the above-mentioned chain-specific real-time RT-qPCR detection kit for live rabies virus in verifying the effectiveness of a rabies virus inactivation process, to detect the residual live virus of the rabies virus inactivation process to be verified and to evaluate the effectiveness of the process.

[0038] The advantages and beneficial effects of the present invention are:

[0039] 1. Compared with the existing rabies virus detection technology, the detection method of the present invention designs specific reverse transcription primers, upstream and downstream primers and probes according to the sequence of the intermediate cRNA produced during the replication of the live rabies virus, so it can specifically detect the presence of the intermediate cRNA produced during the replication of the live rabies virus, that is, the method of the present invention detects live rabies virus with replication activity. The method can accurately distinguish the intermediate cRNA of virus replication and the viral genome vRNA, and the method design avoids the occurrence of false negatives, false positives, etc.;

[0040] 2. The traditional inactivation verification method takes at least 35 days from cell culture to test results, while the method of the present invention only takes 7 days, and its minimum detection limit is 10 3 copies·μL -1, which realizes the rapid, sensitive and specific detection of live rabies virus. Compared with traditional detection methods, it is simpler, faster and more sensitive, while saving time and cost. It is very suitable for the rapid detection of live rabies virus and the detection of residual live virus after the rabies virus inactivation process. It can shorten the detection cycle of residual live virus after the inactivation process, greatly saving manpower, material resources and production costs.

[0041] 3. The detection method of the present invention has strong specificity, high sensitivity, good repeatability, simple operation, fast detection speed, and accurate experimental results, and is very suitable for process application in the industrialization of rabies virus inactivated vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0043] Figure 1 This is a schematic diagram of the principle of ssRT-qPCR detection of live rabies virus provided in the present invention;

[0044] Figure 2 The target design position of the whole genome gene map of rabies virus and the nucleotide sequence of the primer used in the present invention in the viral genome;

[0045] Figure 3 is the positive-strand cRNA ssRT-qPCR standard curve established in Example 1;

[0046] Figure 4 is the negative-strand vRNA ssRT-qPCR standard curve established in Example 1;

[0047] Figure 5 The specificity test 1 in Example 2 was established in the presence or absence of a fixed amount of antisense strand (10 6 ) in the case of qPCR quantification of cRNA at different dilutions;

[0048] Figure 6 The specificity test 1 in Example 2 was established in the presence or absence of a fixed amount of antisense strand (10 6 ) in the case of qPCR quantification of vRNA at different dilutions;

[0049] Figure 7 This is the case where the method of the present invention was used to verify the expression dynamics of vRNA and cRNA of RABVs in KMB-17 cells in Example 3. DETAILED DESCRIPTION

[0050] The present invention has no special restrictions on the synthesis method of the primers and probes, and can be commissioned to a gene synthesis company known in the art. The sequences of primers, probes, etc. involved in the following embodiments of this application are all commissioned to Shanghai Sangon Biotechnology Co., Ltd. for synthesis. The method described in the present invention requires the use of a reverse transcription reagent when performing a reverse transcription reaction. The present invention has no special restrictions on the source of the reverse transcription reagent, and conventional commercial products in the art can be used. The reverse transcription reagent described in the embodiments of the present invention is purchased from Yishen Company. In the present invention, the reagent also includes a qPCR reaction solution. The present invention has no special restrictions on the source of the qPCR reaction solution, and conventional commercial products known in the art can be used. The qPCR reaction reagent described in the embodiments of the present invention is purchased from Roche.

[0051] like Figure 1 As shown in the schematic diagram of the detection principle, the present invention uses reverse transcription primers with specific non-viral sequence tags added to the 5' end to synthesize the cDNA of the positive and negative chains of the virus respectively, distinguishes the positive and negative chains of the virus by the introduced non-viral sequence tags, and then specifically and quantitatively detects the positive and negative chains of the virus respectively by the non-viral sequence tags and the primers on the viral genome sequence paired therewith.

[0052] Because the replication of RABVs depends on the intracellular concentration of newly synthesized protein N, preferably, the design range of the primers, probes and standards described in the embodiments of the present application is selected from the region where the rabies virus N protein is located ( Figure 2 ). The primer and probe sequences involved in the following examples are shown in Table 1.

[0053] Table 1

[0054]

[0055]

[0056] The present invention relates to a rapid and sensitive method for detecting live rabies virus, which specifically comprises the following steps:

[0057] 1) Using the gradient diluted positive and negative strand nucleic acid detection standards as templates, using strand-specific label qPCR primers and corresponding detection probes to perform ssRT-qPCR amplification, and using the logarithmic value of the nucleic acid detection standard copy number and the obtained Cp value to draw a standard curve;

[0058] 2) Collect the cell or tissue sample to be tested, extract RNA, and reverse transcribe the viral RNA into cDNA using strand-specific reverse transcription primers;

[0059] 3) Using the sample cDNA obtained in step 2) as a template, ssRT-qPCR is performed under the same conditions as step 1), and the obtained Cp value is compared with the standard curve, and the cDNA reverse transcribed from the positive and negative strand RNA of rabies virus in the test sample is subjected to absolute quantitative detection, respectively, to further complete the absolute quantification of the copy number of the specific strand of rabies virus.

[0060] Example 1: Determination of standard curve

[0061] This example draws a standard curve to determine its linear range and quantitative limit. The specific method is:

[0062] The synthesized positive and negative strand nucleic acid detection standards (the nucleotide sequences of the positive strand cRNA detection standard and the negative strand vRNA detection standard are shown in SEQ ID No.9 and SEQ ID No.10, respectively) were diluted 10-fold to 1.0×10 1 , 1.0×10 2 , 1.0×10 3 , 1.0×10 4 , 1.0×10 5 , 1.0×10 6 , 1.0×10 7 , 1.0×10 8 , 1.0×10 9 , 1.0×10 10 copies·μL -1 Different concentrations were used as test samples to determine the lowest detection line of the sample, obtain the best linear range and draw the standard curve of the best linear range. The reaction system was prepared according to Table 2, the final concentration of the primer was 0.5 μM, and the final concentration of the probe was 0.1 μM. Roche 480Probes Master Kit reaction solution was used for amplification. The reaction procedure is shown in Table 3. The real-time fluorescence quantitative PCR instrument used for amplification was Roche 480, response ended using software version Data analysis was performed using 480Software Version 1.5.1.

[0063] Table 2 qPCR amplification system

[0064]

[0065] Table 3 qPCR reaction procedure

[0066]

[0067] The nucleotide sequences of the primers are shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, and SEQ ID No.6; the nucleotide sequences of the detection probes are shown in SEQ ID No.7 and SEQ ID No.8.

[0068] The results showed that the standard curve was drawn with the logarithmic value of the copy number of the nucleic acid standard and the obtained Cp value, and the optimal linear range and quantitative limit were determined. Figure 3 and Figure 4 As shown in the figure, the positive and negative strand (cRNA / vRNA) amplification curves have uniform spacing at each dilution; the optimal linear range of positive strand cRNA is 1.0×10 3 ~1.0×10 8 copies·μL -1 The minimum detection limit is 1.0×10 3 copies·μL -1 , the standard curve is Y = -3.506 × X + 45.97, R 2 =0.9973 (e.g. Figure 3 As shown), R 2 >0.99 indicates high correlation and effective quantification. The slope is -3.506 and the amplification efficiency Eff is 92.85%. The amplification efficiency is between 90% and 110%, which meets the requirements. The optimal linear range of negative-strand vRNA is 1.0×10 3 ~1.0×10 8 copies·μL -1 The minimum detection limit is 1.0×10 3 copies·μL -1 , the standard curve is Y = -3.562 × X + 42.72, R 2 =0.9951(e.g. Figure 4 As shown), R 2 >0.99 indicates a high correlation and can be effectively quantified. The slope is -3.562, the amplification efficiency Eff is 90.87%, and the amplification efficiency is between 90% and 110%, which meets the requirements.

[0069] Example 2: Specificity Verification

[0070] In order to verify the specificity of the detection method described in this application for live rabies virus, this example conducted the following specificity verification test:

[0071] Specificity Verification 1

[0072] The specificity of the positive and negative strand label qPCR primers of RABVs genome and the qPCR detection of standard samples was tested. 6) for the opposite strand, for the positive or negative strand template (standard dilution 10 3 ~10 9 ) Quantification was performed by qPCR using strand-specific tag qPCR primers, and the average linear correlation coefficient of the standard curve generated in the presence and absence of the opposite strand was evaluated. The experiment was performed in triplicate, the qPCR amplification system was as shown in Table 2 of Example 1, and the qPCR reaction procedure was as shown in Table 3 of Example 1.

[0073] like Figure 5 , Figure 6 As shown, the results showed that in the presence or absence of a fixed amount of antisense strand (10 6 ), using the label qPCR primers to quantify the gradient dilution of the standard sample, a good linear regression curve can be formed. 6 ~10 3 ), the use of labelled qPCR primers also produces robust and reproducible correlation coefficient values. Moreover, the RABVs positive strand primer probe combination only amplifies the positive strand, and the addition of antisense standards has no significant effect on the amplification curve ( Figure 5 ), indicating that the positive-strand specific label qPCR primer has good specificity; the negative-strand detection results of RABVs are the same, that is, the negative-strand primer probe combination only amplifies the negative strand, and the addition of antisense standards has no significant effect on the amplification curve ( Figure 6 ), indicating that the negative strand specific tag qPCR primer has good specificity.

[0074] Specificity Verification 2

[0075] The specificity test of qPCR detection of RABVs genome positive and negative strand label qPCR primers and viral RNA reverse transcription cDNA samples was performed. Evaluate whether the label qPCR primers can specifically detect specific strands of RNA viruses. The cDNA synthesized by viral RNA using positive and negative strand specific reverse transcription primers was first removed from the genomic DNA (gDNA). The reaction system is shown in Table 4. After the system is prepared, mix and centrifuge. Incubate at 42℃ for 2min.

[0076] Table 4gDNA enzyme digestion system

[0077] Components Volume (μL) <![CDATA[RNase-freeH2O]]> 10 5×gDNADigesterMix 3 Total RNA (0.5 μg / μL) 2 Total volume 15

[0078] Table 5 cDNA synthesis system

[0079]

[0080] Table 6 cDNA synthesis reaction conditions

[0081] Temperature(℃) time 55 15min 85 5min 4 5min

[0082] After gDNA was removed, reverse transcription cDNA synthesis was performed, and the reaction system was shown in Table 5, and the reaction conditions were shown in Table 6. After the cDNA synthesis reaction was completed, the cDNA was diluted 10 times and used as a template for qPCR reaction. The experiment was performed in triplicate, and the qPCR amplification system was as shown in Table 2 of Example 1, and the qPCR reaction procedure was as shown in Table 3 of Example 1.

[0083] As shown in Table 7, when the cDNA samples of RABVs infected cells at different time points (24 h, 36 h and 48 h) were detected, no effective signals were detected for the positive and negative strand templates and negative controls that did not contain the corresponding tag qPCR primers, that is, the RABVs positive strand primer probe combination only amplified the positive strand, and the RABVs negative strand primer probe combination only amplified the negative strand, indicating that the positive and negative strand specific tag qPCR primers had good specificity.

[0084] Table 7 qPCR primer specificity test results of cDNA samples at different virus infection time points

[0085]

[0086] cRNAtag-F / cRNA-R is used to specifically detect the positive strand of the RABV genome;

[0087] vRNAtag-F / vRNA-R is used to specifically detect the negative strand of the RABV genome;

[0088] Data are Cp values, shown as mean ± SD;

[0089] NTC is NO template control, and pure water was used as a negative control in this test;

[0090] Undetectable means no signal is detected.

[0091] Example 3: Expression dynamics of vRNA and cRNA of RABVs in KMB-17 cells

[0092] KMB-17 cells were cultured at 1.0×10 6 / mL inoculated in 25cm 2In a cell culture flask, cells were grown to a monolayer using a cell growth medium containing 10% fetal bovine serum (FBS), inoculated with RABVs virus, placed at 37°C for adsorption for 1 hour, and then the liquid was removed and gently rinsed twice with PBS to wash away the unadsorbed virus. Then, a virus maintenance medium containing 2% FBS was added and cultured for 48 hours. The sampling time points set during the period were 0h, 2h, 4h, 8h, 12h, 16h, 24h, 36h, and 48h. The maintenance liquid was discarded at different sampling points after inoculation, and the cells were rinsed 3 times with PBS to fully wash and remove the extracellular virus. The infected cell samples after washing were collected and placed at -70°C for use.

[0093] The total RNA of cells and viruses was extracted from the collected cell samples according to the TRIzol operating instructions, and the concentration of RNA was detected using a micro-ultraviolet spectrophotometer. Viral RNA was synthesized into cDNA using positive and negative strand-specific reverse transcription primers, and the synthesis steps were the same as in Example 2.

[0094] According to the fluorescent quantitative PCR method established in the present invention, the cDNA of samples collected at different sampling times after cell infection was detected, pure water was used as a blank control group, and the standard product was used as a positive control group. The test was performed in triplicate, the qPCR amplification system was as shown in Table 2 of Example 1, and the qPCR reaction procedure was as shown in Table 3 of Example 1.

[0095] After KMB-17 was inoculated with rabies virus, the quantitative detection results of positive and negative strand RNA copies of RABVs were as follows Figure 7 As shown in the figure, the dynamic change trend of the positive and negative strand RNA copy numbers of RABVs is slightly different. The copy numbers of both vRNA and cRNA increase rapidly 2 hours after infection. There is a slight decrease in vRNA at 2 to 8 hours, which may be caused by virus budding. Then, the copy number of vRNA shows a continuous upward trend at 8 to 24 hours, and reaches the first peak after infection and proliferation at 24 hours. It is basically in a stable period at 24 to 48 hours. cRNA shows a continuous upward trend at 2 to 8 hours after cell infection, and reaches the first peak at 8 hours. After that, cRNA shows a downward trend at 8 to 16 hours, which may be related to the consumption of cRNA for vRNA replication. It is in a stable period at 16 to 24 hours. This stage corresponds to the continuous increase of vRNA. At 24 to 48 hours, cRNA shows a continuous upward trend again, starting a new round of replication cycle.

[0096] The RABVs genome is a single-stranded negative-strand vRNA. When it replicates in cells, it needs to transcribe positive-strand cRNA and form replicative double-stranded RNA with the RABVs genome vRNA. Then, under the action of the replication complex, the replication of the progeny viral genome is initiated. In cells, the appearance of RABVs positive-strand cRNA indicates the beginning of the replication of the RABVs progeny viral genome vRNA. The content of positive-strand cRNA is related to the replication rate of the progeny viral RNA. The increase in positive-strand cRNA indicates that the replication rate of the RABVs progeny RNA in the cell is gradually increasing. The content reaching a stable level may indicate that a dynamic equilibrium state has been reached between RABVs virus replication and virus release in the cell, which continues until the death of the host cell.

[0097] In summary, the rapid and sensitive ssRT-qPCR method for live rabies virus established in the present invention can effectively distinguish live rabies virus from dead virus. Its detection limit is 10 3 copies·μL -1 , high sensitivity, good specificity, can directly determine whether the sample is infectious, can avoid the influence of human subjective factors on the result judgment, and save time and cost. This method is more suitable for the process application in the industrialization of rabies virus inactivated vaccine or the detection of the infectiousness of live rabies virus.

[0098] Finally, it should be noted that the above is only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred arrangement scheme, a person skilled in the art should understand that the technical solution of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A rapid and sensitive method for detecting live rabies virus for non-diagnostic purposes, characterized in that: The method designs primers, probes and standards based on the region where the rabies virus N protein is located, specifically detects the presence of intermediate cRNA produced during the rabies virus replication process, and thus quantitatively detects live rabies viruses with replication activity and infectious activity, and specifically comprises the following steps: 1) Using the gradient diluted positive and negative strand nucleic acid detection standards as templates, using strand-specific label qPCR primers and corresponding detection probes to perform ssRT-qPCR amplification, and using the logarithmic value of the nucleic acid detection standard copy number and the obtained Cp value to draw a standard curve; 2) Collect the cell or tissue sample to be tested, extract RNA, and reverse transcribe the viral RNA into cDNA using strand-specific reverse transcription primers; 3) using the sample cDNA obtained in step 2) as a template, performing ssRT-qPCR under the same conditions as step 1), comparing the obtained Cp value with the standard curve, and performing absolute quantitative detection on the cDNA reverse transcribed from the positive and negative strand RNA of rabies virus in the test sample, respectively, to further complete the absolute quantification of the copy number of the specific strand of rabies virus; The chain-specific reverse transcription primers include a positive-chain cRNA reverse transcription primer and a negative-chain vRNA reverse transcription primer, and their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively; The chain-specific label qPCR primers include a positive-chain cRNA chain-specific label qPCR upstream primer / downstream primer and a negative-chain vRNA chain-specific label qPCR upstream primer / downstream primer, and their nucleotide sequences are shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, respectively; The detection probes include a Taqman detection probe for positive-strand cRNA and a Taqman detection probe for negative-strand vRNA, and their nucleotide sequences are shown in SEQ ID No.7 and SEQ ID No.8, respectively.

2. The detection method according to claim 1, characterized in that The detection probe is a fluorescently labeled Taqman probe. The two ends of the Taqman detection probe sequence of the positive-strand cRNA are modified with 5'6-FAM and 3'MGB respectively, and the two ends of the Taqman detection probe sequence of the negative-strand vRNA are modified with 5'CY5 and 3'MGB respectively.

3. The detection method according to claim 1, characterized in that The positive and negative strand nucleic acid detection standards include positive strand cRNA detection standards and negative strand vRNA detection standards, and their nucleotide sequences are shown in SEQ ID No.9 and SEQ ID No.10, respectively.

4. The detection method according to any one of claims 1 to 3, characterized in that: The ssRT-qPCR reaction system includes: The nucleotide sequences of the primers are shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, and SEQ ID No.6; the nucleotide sequences of the detection probes are shown in SEQ ID No.7 and SEQ ID No.

8.

5. The detection method according to any one of claims 1 to 3, characterized in that: The reaction procedure of the ssRT-qPCR includes enzyme activation and amplification cycles, specifically: Enzyme activation: 30s-10min, 1 cycle; Amplification cycles: 95°C for 10 s, 60°C for 30 s, 40 to 50 cycles.

6. A strand-specific real-time RT-qPCR detection kit for live rabies virus, characterized in that: The kit includes a synthetic strand-specific reverse transcription primer, a strand-specific label qPCR primer, and a detection probe; The chain-specific reverse transcription primers include a positive-chain cRNA reverse transcription primer and a negative-chain vRNA reverse transcription primer, and their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively; The chain-specific label qPCR primers include a positive-chain cRNA chain-specific label qPCR upstream primer / downstream primer and a negative-chain vRNA chain-specific label qPCR upstream primer / downstream primer, and their nucleotide sequences are shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, respectively; The detection probes include a Taqman detection probe for positive-strand cRNA and a Taqman detection probe for negative-strand vRNA, and their nucleotide sequences are shown in SEQ ID No.7 and SEQ ID No.8, respectively.

7. The kit according to claim 6, characterized in that The kit also includes positive and negative strand nucleic acid detection standards, and the nucleotide sequences of the positive strand cRNA detection standard and the negative strand vRNA detection standard are shown in SEQ ID No.9 and SEQ ID No.10, respectively.

8. The kit according to claim 6, characterized in that The detection probe is a fluorescently labeled Taqman probe. The two ends of the Taqman detection probe sequence of the positive-strand cRNA are modified with 5'6-FAM and 3'MGB respectively, and the two ends of the Taqman detection probe sequence of the negative-strand vRNA are modified with 5'CY5 and 3'MGB respectively.

9. Use of the kit according to any one of claims 6 to 8 in validating the effectiveness of a rabies virus inactivation process, to detect the residual live virus of the rabies virus inactivation process to be validated and to evaluate the effectiveness of the process.

Images