A TTC21B gene mutation site and its application
Knocking out the exon 6 target site of zebrafish ttc21b gene through CRISPR/Cas9 technology, solving the problem of Morpholino's short-term reduction of gene expression and achieving long-term reduction of expression and loss of function of ttc21b gene.
Patent Information
- Application Number
- CN202410962617.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-18
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2044-07-18
AI Technical Summary
In the prior art, Morpholino can only reduce the expression of the ttc21b gene in organisms in the short term, and the long-term impact of the loss of ttc21b gene function cannot be studied.
CRISPR/Cas9 gene editing technology was used to knock out the exon 6 target site of the ttc21b gene, so as to achieve gene mutation and reduce the expression of the ttc21b gene for a long time.
By accurately knocking out the exon 6 target site, an abnormal truncated protein was formed, and the long-term reduction of the expression of the ttc21b gene was achieved, providing an effective animal model for studying the loss of function of the ttc21b gene.
Smart Images

Figure CN118773200B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biotechnology, and particularly to a ttc21b gene mutation site and its application. Background Art
[0002] Nephronophthisis (NPHP) is an autosomal recessive tubulointerstitial disease and one of the most common genetic diseases causing end-stage kidney disease in children. The clinical symptoms of nephronophthisis include polyuria, polydipsia, secondary enuresis, anemia, and growth retardation. In addition to kidney phenotypes, this disease may also involve multiple extra-renal organs, including the liver, pancreas, eyes, and bones, etc.
[0003] The pathogenic gene of NPHP12 is TTC21B. This gene belongs to the TTC21 family, is located on chromosome 2q24.3, has 5415 base pairs, and contains 29 exons in total, encoding intraflagellar transport protein 139 (IFT139) with 1316 amino acids; and IFT139 is one of the constituent proteins of the IFT-A complex, mainly participating in the retrograde material transport from the ciliary tip to the base. The IFT139 protein contains 19 TPR domains, which are composed of 34 amino acids and are generally formed by the tandem arrangement of multiple TPR sequences. This domain will generate a right-handed superhelical structure, and this superhelical structure is related to the multi-protein complex.
[0004] Mice with Ttc21b gene knockout are embryonically lethal and not suitable for kidney-related research. And zebrafish is a commonly used model organism for studying ciliopathies. Therefore, currently in zebrafish, there is a Morpholino-mediated ttc21b gene knockdown animal model to study the modifying genes of different point mutations of ttc21b. Although it provides a useful model for studying the pathogenicity of different point mutations of ttc21b, Morpholino can only short-term reduce the expression of genes in organisms and cannot study the long-term effects of the loss of function of the target gene. Therefore, how to provide a ttc21b gene deletion target site to achieve accurate knockout of the target site and long-term reduction of the expression of genes in organisms is a technical problem that needs to be solved urgently at present. Summary of the Invention
[0005] This application provides a ttc21b gene deletion site and its application to solve the technical problem that Morpholino in the prior art can only short-term reduce the expression of genes in organisms.
[0006] In the first aspect, this application provides a ttc21b gene mutation site, and the site is located at the target site of exon 6 of the ttc21b gene. The nucleotide sequence of the target site of exon 6 is shown as SEQ ID NO.1;
[0007] The gene mutation site is knocked out by the CRISPR / Cas9 gene editing technology.
[0008] Optionally, the targeting sgRNA primer sequence for the exon 6 target site includes: the nucleotide complementary sequence of the exon 6 target site, the sgRNA backbone sequence, and the T7 promoter sequence. The sgRNA backbone sequence is located at the 3' end of the nucleotide complementary sequence of the exon 6 target site, and the T7 promoter sequence is located at the 5' end of the nucleotide complementary sequence of the exon 6 target site;
[0009] The targeting sgRNA primer sequence is as shown in SEQ ID NO.5.
[0010] In a second aspect, the present application provides a primer set for detecting the ttc21b gene mutation site. The primer set is used to detect the gene mutation site described in the first aspect, and the primer set includes a detection primer pair for detecting the exon 6 target site.
[0011] Optionally, the nucleotide sequence of the upstream primer of the detection primer pair is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer of the detection primer pair is as shown in SEQ ID NO.3.
[0012] In a third aspect, the present application provides an application of the ttc21b gene mutation site, and the application includes using the gene mutation site described in the first aspect as a knockout site for constructing a ttc21b gene knockout animal model.
[0013] Optionally, the method for constructing the animal model includes:
[0014] Designing a targeting sgRNA primer for the gene mutation site described in the first aspect;
[0015] Performing PCR amplification according to the targeting sgRNA primer to obtain gDNA;
[0016] Performing in vitro transcription on the gDNA and the pT3-Cas9 plasmid to obtain a mixture of sgRNA and Cas9 mRNA for the ttc21b gene;
[0017] Injecting the mixture of sgRNA and Cas9 mRNA into a single-cell stage fertilized egg to enable Cas9 protein to cleave the ttc21b gene and cause DNA double-strand breakage of the ttc21b gene, and then obtaining an animal model containing mutant DNA through DNA repair;
[0018] Raising and screening the animal model containing mutant DNA to obtain an animal model with ttc21b gene deletion.
[0019] The above technical solution provided by the embodiments of the present application has the following advantages compared with the prior art:
[0020] A deletion site of the ttc21b gene provided by the embodiments of the present application can be designed by targeting the nucleotide sequence of the target site of exon 6 of the ttc21b gene, and can cooperate with the CRISPR / Cas9 gene editing technology to precisely knockout the target site of exon 6, so that the ttc21b gene can generate gene mutations at the target site of exon 6. After knockout, a stop codon is introduced in advance during translation, so that the translation of the ttc21b gene is terminated in advance and an abnormal truncated protein is formed, thereby reducing the expression of the ttc21b gene in the organism in the long term. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The drawings herein are incorporated into the specification and constitute a part of this specification, showing embodiments consistent with the present application, and are used together with the specification to explain the principles of the present application.
[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0023] Figure 1 It is a schematic flow chart of constructing an animal model using the ttc21b gene mutation site provided by the embodiments of the present application;
[0024] Figure 2 It is a schematic diagram of the sequencing result of the target site of exon 6 provided by the embodiments of the present application;
[0025] Figure 3 It is a schematic diagram of the mutant screened at the target site of exon 6 provided by the embodiments of the present application;
[0026] Figure 4 It is a prediction of the IFT139 protein translated from the mutant provided by the embodiments of the present application;
[0027] Figure 5 It is a schematic diagram of the morphological appearance of the ttc21b gene-deficient zebrafish provided by the embodiments of the present application;
[0028] Figure 6 It is a schematic diagram of the spinal curvature change of the homozygous mutant zebrafish provided by the embodiments of the present application. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0029] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of this application. Obviously, the described embodiments are some, but not all, of the embodiments of this application. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in this application without creative efforts shall fall within the scope of protection of this application.
[0030] Unless otherwise specifically stated, all kinds of raw materials, reagents, instruments, equipment, etc. used in this application can be obtained through market purchases or can be prepared by existing methods.
[0031] The creative concept of this application is as follows:
[0032] CRISPR refers to regularly interspaced short palindromic repeats existing in prokaryotes. The CRISPR / Cas system is the acquired immune system of prokaryotes and exists in most archaea and bacteria. This system integrates exogenous DNA fragments such as phages, viruses, and plasmids into CRISPR as spacer sequences, and then transcribes and processes them into mature guide crRNAs including spacer sequences. When exogenous viruses or plasmids invade again, the Cas protein and the mature crRNA form a complex to recognize the genomes of viruses or plasmids containing homologous sequences and then perform targeted cleavage, thereby resisting the invasion of exogenous genomes. The CRISPR / Cas9 system used in gene editing technology mainly consists of two parts: the modified Cas9 protein and sgRNA. sgRNA is a nucleotide guiding sequence of about 100bp. The Cas9 protein binds to the last 80 nucleotides of sgRNA, and its first 20 nucleotides are designed to locate to the specific target site sequence of the DNA to be edited. When the target site sequence in sgRNA binds to the DNA through base complementary pairing, the endonuclease in the Cas9 protein is activated to cleave the targeted DNA at 3bp - 8bp upstream of PAM, triggering DNA double-strand break. However, generating DNA double-strand break in the genome is extremely harmful, and the in vivo DBS repair system will quickly repair it through non-homologous end joining or homologous recombination. When there is a homologous repair template in vivo, the CRISPR / Cas9 system performs homologous recombination repair with the homologous template, and through this method, the genome can be precisely edited such as point mutation, etc. In the absence of a template, the non-homologous end joining repair mechanism directly connects the broken ends of the DNA sequences, usually resulting in small fragment deletions or insertion mutations that cause gene open reading frame shift, thereby leading to premature termination of translation.
[0033] Therefore, the present application uses the CRISPR / Cas9 gene editing technology to precisely knockout the target site of exon 6 of the zebrafish ttc21b gene, and can construct a homozygous mutant nephronophthisis animal model for the ttc21b gene, which can provide a new animal model for the study of the pathogenesis of nephronophthisis and its related ciliopathies and the screening of therapeutic drugs.
[0034] An embodiment of the present application provides a ttc21b gene deletion site, the gene deletion site includes the target site of exon 6 of the ttc21b gene, and the nucleotide sequence of the target site of exon 6 is as shown in SEQ ID NO.1;
[0035] The gene mutation site is knocked out by the CRISPR / Cas9 gene editing technology.
[0036] In some alternative embodiments, the targeting sgRNA primer sequence of the target site of exon 6 includes: the nucleotide complementary sequence of the target site of exon 6 without the PAM sequence, the sgRNA backbone sequence, and the T7 promoter sequence.
[0037] In the embodiment of the present application, by using the nucleotide complementary sequence of the target site of exon 6, the sgRNA backbone sequence, and the T7 promoter sequence to form the targeting sgRNA primer sequence, gDNA containing the T7 promoter, the ttc21b targeting site, and the sgRNA backbone can be obtained by PCR amplification, and then in vitro transcription is carried out to obtain sgRNA targeting ttc21b. After mixing and injecting the fertilized eggs at the single-cell stage of zebrafish with Cas9 mRNA, the construction of an animal model with a deletion of the target site of exon 6 can be achieved through the CRISPR / Cas9 gene editing technology.
[0038] Based on a general inventive concept, an embodiment of the present application provides a primer set for detecting the ttc21b gene mutation site. The primer set is used to detect the gene mutation site, and the primer set includes a detection primer pair for detecting the target site of exon 6.
[0039] This primer set is based on the above gene mutation site. The specific composition information of this gene mutation site can be referred to the above embodiment. Since this primer set adopts some or all of the technical solutions of the above embodiment, it has at least all the beneficial effects brought by the technical solutions of the above embodiment, which will not be elaborated here one by one.
[0040] In some alternative embodiments, the nucleotide sequence of the upstream primer of the detection primer pair is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer of the detection primer pair is as shown in SEQ ID NO.3.
[0041] In the embodiments of the present application, by refining the specific primer set for detecting the mutation site of the ttc21b gene, specific amplification of the ttc21b gene can be performed using the designed detection primer pair, so as to obtain a sufficient amount of amplification products, thereby facilitating the subsequent detection process.
[0042] Based on a general inventive concept, the present application provides an application of the mutation site of the ttc21b gene, and the application includes using the gene deletion site as the knockout site for constructing an animal model with a knockout of the ttc21b gene.
[0043] This application is implemented based on the above gene deletion site. The specific composition information of this gene deletion site can refer to the above embodiments. Since this application adopts some or all of the technical solutions of the above embodiments, it at least has all the beneficial effects brought by the technical solutions of the above embodiments, and will not be elaborated one by one here.
[0044] As Figure 1 shown, in some optional embodiments, the method for constructing the animal model includes:
[0045] S1. Design a targeting sgRNA primer for the gene mutation site;
[0046] S2. Perform PCR amplification according to the targeting sgRNA primer to obtain gDNA;
[0047] S3. Perform in vitro transcription on the gDNA and pT3-Cas9 plasmid to obtain a mixture of sgRNA and Cas9mRNA for the ttc21b gene;
[0048] S4. Inject the mixture of sgRNA and Cas9mRNA into the single-cell stage fertilized eggs of the animal model to enable the Cas9 protein to cleave the ttc21b gene and break the DNA double strand of the ttc21b gene, and then through DNA repair, obtain an animal model containing mutant DNA;
[0049] S5. Raise and screen the animal model containing mutant DNA to obtain an animal model with a deletion of the ttc21b gene.
[0050] In the embodiment of the present application, by refining the method for constructing an animal model, a targeting sgRNA primer is first designed for the gene mutation site, and then the transcription template gDNA is obtained by PCR, and then the transcription template gDNA and the pT3-Cas9 plasmid are transcribed in vitro to obtain a mixture of sgRNA and Cas9mRNA, and then the mixture of sgRNA and Cas9mRNA is injected into the single-cell fertilized egg of the animal model to achieve the shearing of the ttc21b gene by the Cas9 protein, and then the DNA repair method is used to generate a gene mutation at the target site of exon 6 of the ttc21b gene to produce a frameshift mutation, thereby achieving ttc21b gene knockout and long-term reduction of the expression of the ttc21b gene in the organism.
[0051] The present application will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are intended only to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are usually measured according to national standards. If there is no corresponding national standard, then the conditions recommended by the manufacturer are followed.
[0052] Example 1
[0053] 1. Screening of active sgRNA:
[0054] 1. Design of sgRNA: The sgRNA target site is generally 20bp. The target site can be designed for the sense strand or antisense strand of the target gene. The target site is generally designed in the first 2 / 3 of the gene coding sequence or before the key domain and after the start codon ATG to ensure maximum destruction of the gene domain or transcript. The target site can also be selected at the junction of exons and introns to disrupt mRNA splicing.
[0055] The specific sgRNA primers were searched for potential CRISPR / Cas9 targeting sequences of zebrafish ttc21b gene through the online CRISPR target site design website CHOPCHOP (http: / / chopchop.cbu.ui b.no / ), and the sequences with the front exons and high scores were preferentially selected. The target site sequences that met the requirements were aligned in the Ensembl database to confirm the specificity of the target site and check whether there were SNP sites on the target site. Then, the T7 promoter sequence was added to the 5' end of the target site sequence that did not contain the PAM sequence, and the sgRNA backbone sequence was added to the 3' end, which was the specific targeting sgRNA primer (the specific sequence is shown in SEQ ID NO.5), and the universal reverse primer ZF-cp-R on the sgRNA backbone was synthesized at the same time (the specific sequence is shown in SEQ ID NO.4).
[0056] Select a target site that meets the above requirements, which is located on exon 6 and after the translation start codon ATG.
[0057] Among them, the forward primer and reverse primer ZF-cp-R for amplifying sgRNA targeting exon 6 are shown in Table 1.
[0058] Table 1 Table of amplification primers and reverse primers for exon 6
[0059]
[0060] (1) Synthesis of gDNA for in vitro transcription template of sgRNA: Obtained by ordinary PCR amplification, and the PCR reaction system is shown in Table 2.
[0061] Table 2 PCR reaction system
[0062] Reagent Name Dosage pT7-gRNA plasmid 1 ng 10x Taq buffer 5 μL dNTP (10 mM) 1.0 μL sgRNA primer (25 μM) 1.0 μL ZF_cp_R (25 μM) 1.0 μL Taq DNA polymerase 0.5 μL Double-distilled water Volume made up to 50 μL
[0063] Amplify 2 50 μL systems for each target site. The PCR reaction program and gel electrophoresis are the same as before. After amplification, purify by AxyPrep Cleanup Kit and then measure the concentration and purity.
[0064] (2) In vitro transcription of sgRNA: The system preparation for in vitro transcription is shown in Table 2.
[0065] Table 2 System for in vitro transcription
[0066]
[0067]
[0068] Incubate this system in a 37 °C water bath for 2 h, add 1 μL of RNAse free DNAse I, incubate in a 37 °C water bath for 15 min, and purify sgRNA by the ethanol precipitation method.
[0069] 2. Preparation of Cas9 mRNA:
[0070] Cas9 mRNA is obtained by in vitro transcription of pT3-Cas9 plasmid. Linearize the Cas9 plasmid and use mMESSAGEmMACHINE TM T3 in vitro transcription kit for in vitro transcription, and use MEGAclearTM Kit transcription purification kit for purification after transcription.
[0071] 3. Microinjection of zebrafish fertilized eggs:
[0072] Collect the fertilized eggs of TU strain zebrafish, arrange them neatly on the egg plate made of agarose gel, mix the prepared sgRNA and Cas9mRNA above, so that the final concentrations of sgRNA and Cas9mRNA are 80 ng / L and 350 ng / L respectively.
[0073] Turn on the injection system, adjust various parameters. Immediately after collecting the embryos, aspirate 2 μL of the CRISPR / Cas9 mixed system and pour it into the injection needle. Fix the injection needle on the injection device, and start injection after breaking the needle to an appropriate thickness with forceps under a stereomicroscope.
[0074] It is best to inject at the single-cell stage of the fertilized eggs. After injection, transfer the zebrafish embryos to a culture dish, add E3 culture medium containing methylene blue, and place them in a constant temperature incubator at 28.5 °C.
[0075] 4. Detect the effectiveness of the target site:
[0076] When the embryos after targeting are cultured to the 2nd day, collect 30 zebrafish embryos of WT and each target site injection respectively to extract genomic DNA, perform PCR amplification, and send the PCR products for sequencing detection.
[0077] The F0 generation is a chimera and may have multiple frameshift mutations. Therefore, in addition to the normal peaks, the target sequence also contains multiple base peaks. The sequencing results show that heterozygous peaks appear at the target site of exon 6 (as Figure 2 shown), which proves that the target site of exon 6 can effectively perform gene targeting.
[0078] 5. Screening of F0 and F1 generation mutants:
[0079] Cultivate the injected embryos to about 2 months old, extract genomic DNA by cutting the caudal fin, and further screen the successfully targeted F0 generation individuals through PCR amplification. Mate the screened mutant F0 generation with TU wild-type zebrafish to obtain the F1 generation.
[0080] When the F1 grows to about 2 months old, also cut the caudal fin to extract genomic DNA, send the sample for sequencing after PCR amplification. Since the F1 generation is heterozygous, the sequencing results of the obtained mutants show double peaks near the targeted sequence. Different mutant genotypes can be screened out among the F1 generation fish by sequence reading.
[0081] Screen out an effective mutant among the F1 generation fish at the target site of exon 6 (as Figure 3as shown in the figure. Among them, the mutant obtained by screening the exon 6 target site is c.644-664delCCTTTCTACCGGCTCTGGTGAinsGTGAGTT, and the amino acid change it causes is p.Ser215Cysfs*30. This mutant is a frameshift mutation and prematurely introduces a stop codon, resulting in premature termination of IFT139 protein translation and the formation of an abnormal truncated protein (as Figure 4 shown in the figure).
[0082] 6. Screening of mutants in the F2 generation and subsequent generations:
[0083] The F1 generation mutants were mated with wild-type zebrafish to obtain F2 generation zebrafish. After the F2 generation embryos grew to 2 months old, they were identified and typed. After typing the F2 generation zebrafish, more female and male fish with the same mutation type could be obtained. After sexual maturity, the F2 generation zebrafish with the same genotype were self-crossed to obtain F3 generation embryos containing homozygous mutants for experimental research.
[0084] 7. The morphological appearance of the ttc21b gene-deficient zebrafish constructed by the above method was observed and studied. In the F3 generation zebrafish embryos, it was observed that some larvae had kidney cysts and mild pericardial edema on the third day after fertilization, which was more obvious on the fifth day after fertilization. The kidney cysts were significantly prominent when observed from the side view and dorsal view (as Figure 5 shown in the figure). All zebrafish embryos with cysts were determined to be homozygous mutants. The homozygous embryos of the F3 generation were separately picked out and cultured. It was found that the homozygous larvae began to die successively after 15 days, and obvious spinal curvature and growth retardation were observed in the homozygous mutant fish at about the 20th day (as Figure 6 shown in the figure).
[0085] In summary, a ttc21b gene deletion site provided in the embodiment of the present application uses the CRISPR / Cas9 gene editing technology to construct an animal model of human nephronophthisis with ttc21b gene deletion, which can be used for the research on the pathogenesis of nephronophthisis and its related ciliopathies and the screening of therapeutic drugs.
[0086] The various embodiments of the present application may exist in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity and should not be construed as a rigid limitation on the scope of the present application; therefore, it should be considered that the description of the said range has specifically disclosed all possible sub-ranges and single values within that range. For example, it should be considered that the description of the range from 1 to 6 has specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single numbers within the range, such as 1, 2, 3, 4, 5, and 6, and this applies regardless of the range. Additionally, whenever a numerical range is indicated herein, it means including any cited number (fraction or integer) within the indicated range.
[0087] In the present application, unless otherwise stated, the orientation terms such as "upper" and "lower" specifically refer to the drawing directions in the drawings. Additionally, in the description of the present application specification, the terms "include", "comprise", etc. mean "including but not limited to". In this document, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. In this document, "and / or" describes the association relationship of associated objects and indicates that three relationships can exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. Where A and B can be singular or plural. In this document, "at least one" means one or more, and "a plurality" means two or more. "At least one kind", "at least one of the following items (pieces)" or similar expressions refer to any combination of these items, including any combination of single item (piece) or plural items (pieces). For example, "at least one of a, b, or c", or, "at least one of a, b, and c" can both represent: a, b, c, a - b (i.e., a and b), a - c, b - c, or a - b - c, where a, b, and c can be single or multiple respectively.
[0088] The above are only specific embodiments of the present application, enabling those skilled in the art to understand or implement the present application. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but rather to the broadest scope consistent with the principles and novel features claimed herein.
Claims
1. An application of a ttc21b gene mutation site, characterized in that: The gene mutation site is edited by CRISPR / Cas9 gene editing technology, including knocking out the target site of exon 6 of the ttc21b gene to form the mutation site, which is used to construct an animal model of knocking out the target site of the ttc21b gene, and the nucleotide sequence of the target site of exon 6 is shown in SEQ ID NO.1; The targeting sgRNA primer sequence of the exon 6 target site includes: a nucleotide complementary sequence of the exon 6 target site, an sgRNA backbone sequence and a T7 promoter sequence, wherein the sgRNA backbone sequence is located at the 3' end of the nucleotide complementary sequence of the exon 6 target site, and the T7 promoter sequence is located at the 5' end of the nucleotide complementary sequence of the exon 6 target site; The targeting sgRNA primer sequence is shown in SEQ ID NO.5, and the animal model is a zebrafish model.
2. The use according to claim 1, characterized in that: The method for constructing the animal model comprises: Design targeting sgRNA primers for the ttc21b gene mutation site; Performing PCR amplification according to the targeting sgRNA primers to obtain gDNA; The gDNA and pT3-Cas9 plasmid are transcribed in vitro to obtain a mixture of sgRNA and Cas9mRNA targeting the ttc21b gene; A mixture of sgRNA and Cas9 mRNA is injected into the single-cell stage fertilized egg of the animal model to enable the Cas9 protein to cut the ttc21b gene and cause a double-strand break in the ttc21b gene. After that, an animal model containing mutant DNA is obtained through DNA repair. The animal model containing the mutant DNA is raised and screened to obtain an animal model with ttc21b gene deletion.
Citation Information
Patent Citations
Methods and compositions for modulating gene expression
CN109890962A