The application of tobacco nicotine metabolism and plant height control related gene NtSULTR3.4 in nicotine metabolism and plant height control

Abstract

The application discloses a tobacco nicotine metabolism and plant height regulation related gene NtSULTR3.4 in nicotine metabolism and plant height regulation, and the CDS sequence of the NtSULTR3.4 is shown as SEQ ID No. 1. After the sequence of the NtSULTR3.4 gene is translated, the amino acid sequence of the encoded protein is shown as SEQ ID No. 2. By using a CRISPR / Cas9 mediated gene editing technology to knock the NtSULTR3.4 gene, edited materials with increased nicotine content and changed plant height are obtained, indicating that the gene is a negative regulatory factor of nicotine metabolism, and is positively correlated with the tobacco plant height, which provides genetic materials and theoretical basis for directional improvement of a new tobacco variety of tobacco nicotine metabolism gene function research, nicotine content regulation and plant height regulation.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of tobacco, in particular to an application of a tobacco nicotine metabolism and plant height regulation related gene NtSULTR3.4 in nicotine metabolism and plant height regulation. BACKGROUND

[0002] Plant SULTR3.4 (sulfate transporter) is related to plant sulfur transport, assimilation and accumulation. Higher plants have evolved a SO4 2- transporter family SULTRs, which mediates the absorption of SO4 2- from the soil and distributes it throughout the organism. SULTRs are composed of four subfamilies with about 60% amino acid sequence similarity. SULTR1, 2 is mainly responsible for the absorption of SO4 2- in the root and the transport from the root to the ground, SULTR3 promotes the absorption of SO4 2- by chloroplasts. SULTR4 is located in the vacuole membrane and releases stored SO4 2- into the cytoplasm. SULTRs have high amino acid sequence similarity with the transporters of the mammalian solute carrier 26 family (SLC26), which consists of 11 members (SLC26A1-11) and mediates the transport of inorganic anions (Cl - , I - , HCO3 - and SO4 2- ) and organic anions (such as oxalate and formate) as anion exchangers or channels.

[0003] At present, there is no related report on the function research of tobacco NtSULTR3.4 gene. SUMMARY

[0004] The technical problem to be solved by the present application is to provide an application of a tobacco nicotine metabolism and plant height regulation related gene NtSULTR3.4 in nicotine metabolism and plant height regulation, which provides germplasm resources for the research of tobacco gene function and the directional improvement of cultivated tobacco varieties.

[0005] The technical problem to be solved by the present application is solved by the following technical scheme:

[0006] The application of a tobacco nicotine metabolism and plant height regulation related gene NtSULTR3.4 in nicotine metabolism and plant height regulation, wherein the CDS sequence of NtSULTR3.4 is shown in SEQ ID No. 1.

[0007] Preferably, after the sequence of NtSULTR3.4 gene is translated, the amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0008] Preferably, in the above technical solution, the high-nicotine and plant height changed tobacco new variety is obtained by knocking out tobacco NtSULTR3.4 gene through CRISPR / Cas9.

[0009] Preferably, in the above technical solution, the method for obtaining the high-nicotine and plant height changed tobacco by knocking out tobacco NtSULTR3.4 gene through CRISPR / Cas9 comprises the following steps:

[0010] (1) designing sgRNA guide sequence, constructing sgRNA expression vector;

[0011] (2) obtaining T0 generation edited material through genetic transformation;

[0012] (3) obtaining T-DNA-free homozygous edited material by selfing T0 generation plants;

[0013] (4) planting the T-DNA-free homozygous material for two generations, observing its traits and evaluating its genetic stability;

[0014] (5) detecting the nicotine content of the 7-day leaf after topping of the two-generation homozygous knockout material of NtSULTR3.4 gene by GC-MS.

[0015] Preferably, in the above technical solution, in step (1), the sgRNA guide sequence is ATCTATAGCATCACTAGTGATGG (SEQ ID No. 3).

[0016] Preferably, in the above technical solution, in step (1), the primer sequence used by the sgRNA sequence is:

[0017] upstream primer NtSULTR3.4gRNA-F: GATTGATCTATAGCATCACTAGTGA (SEQ ID No. 4);

[0018] downstream primer NtSULTR3.4gRNA-R: AAACCTCACTAGTGATGCTATAGAT (SEQ ID No. 5).

[0019] Preferably, in the above technical solution, step (1) is specifically:

[0020] The sgRNA guide sequence is designed, the upstream primer sgRNA-F and the downstream primer sgRNA-R are annealed to form a double strand, and the restriction endonuclease BsaI-HF is used to cut the CRISPR / Cas9 carrier pOREU3TR; the double-stranded product formed by annealing is connected with the cut carrier skeleton by using T4 ligase; the connection product is transformed into the competent cells of E.coli, positive clones are detected and obtained, and the recombinant plasmid is extracted, so as to obtain the CRISPR / Cas9-sgRNA expression carrier.

[0021] Preferably, in the technical scheme, the step (2) is specifically:

[0022] The agrobacterium LBA4404 liquid carrying the CRISPR / Cas9-sgRNA expression carrier is soaked to infect tobacco leaf discs, co-cultured, differentiated and cultured, and induced to root, and T0 generation tissue culture seedlings are obtained, the tissue culture seedlings are transplanted to a greenhouse flowerpot, and after 2 months, the target point editing condition is detected by sampling, NtSULTR3.4 gene editing plants are obtained, and T0 generation seeds are obtained by seed collection.

[0023] Preferably, in the technical scheme, the step (3) is specifically:

[0024] The T0 generation seeds are self-crossed and expanded for planting at 100 times, sgRNA and target point editing detection are performed, NtSULTR3.4 gene homozygous editing plants without T-DNA are obtained, T1 generation seeds are obtained by seed collection, and the primer sequence used in the NtSULTR3.4 target point editing detection is the same as that in step (2).

[0025] Preferably, in the technical scheme, the step (4) is specifically:

[0026] The T1 generation seeds are expanded for planting by using potting, 60 plants are planted, main botanical properties are investigated 7 days after topping, the property indexes of T2 generation plants are determined and analyzed, and T2 generation seeds are collected by bagging;

[0027] The T2 generation seeds are expanded for planting by using potting, 60 plants are planted, main botanical properties are investigated 7 days after topping, and the property indexes of T3 generation plants are determined and analyzed.

[0028] The above technical scheme of the present application has the following beneficial effects:

[0029] The present application constructs a CRISPR / Cas9 editing carrier for knocking out the NtSULTR3.4 gene by using the CRISPR / Cas9 mediated gene editing technology, and obtains the NtSULTR3.4 gene knockout Honghuadajinyuan editing plant after editing material creation and molecular detection and identification.

[0030] The tobacco nicotine metabolism and plant height regulation gene NtSULTR3.4 provided by the application, the T2 generation and T3 generation plants of the NtSULTR3.4 gene knockout are extremely significantly lower than the control in the plant height after topping and the number of effective leaves, and the waist leaf length and waist leaf width have little difference with the control.

[0031] The tobacco nicotine metabolism and plant height regulation gene NtSULTR3.4 provided by the application, through the gas chromatography-mass spectrometry detection, it is found that the nicotine content of the T2 generation and T3 generation plants of the NtSULTR3.4 gene knockout is increased by about 30% than the control in the mature period of leaves.

[0032] In summary, the NtSULTR3.4 gene is knocked out by using the CRISPR / Cas9 mediated gene editing technology to obtain the edited material with increased nicotine content and changed plant height, which shows that the gene is a negative regulation factor of nicotine metabolism, and is positively correlated with the plant height of tobacco, which provides genetic material and theoretical basis for the directional improvement of the new tobacco variety of the nicotine metabolism gene function research, nicotine content regulation and plant height regulation. BRIEF DESCRIPTION OF DRAWINGS

[0033] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the application and, together with the description, serve to explain the principles of the application.

[0034] Figure 1 Comparison of main agronomic traits of NtSULTR3.4 T2 generation plants of the application and the control (unedited).

[0035] Figure 2 Comparison of main agronomic traits of NtSULTR3.4 T3 generation plants of the application and the control (unedited). DETAILED DESCRIPTION

[0036] Various exemplary embodiments of the present application will now be described in detail with reference to the accompanying drawings. Note that the relative arrangement, numerical expressions, and numerical values of components and steps set forth in these embodiments are not limiting to the scope of the present application unless otherwise specifically stated.

[0037] Unless otherwise specified, all experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained through commercial channels.

[0038] Example 1 Cloning of tobacco NtSULTR3.4 gene

[0039] Taking the whole plant of the cultivated species tobacco Honghuadajinyuan as the experimental material, total RNA of tobacco roots was extracted by using an RNA extraction kit, and reverse transcription was carried out to obtain cDNA for standby use:

[0040] Total RNA of tobacco was extracted according to the instruction of plant RNA extraction kit.

[0041] 1 μg total RNA extracted from leaves was used for reverse transcription, and the transcription system was as follows:

[0042] Total RNA 1 μg;

[0043] Oligo(dT) (10 μmol / L) 1.5 μL;

[0044] ddH2O up to 15 μL.

[0045] After mixing the above system, it was placed in PCR, and incubated at 70 °C for 5 min, and then immediately placed on ice for 5 min. Then the following reagents were added to the system:

[0046]

[0047] The above system was placed in a PCR instrument, and incubated at 42 °C for 65 min, 65 °C for 10 min, and 4 °C for incubation. Then it was placed in a refrigerator at -20 °C for storage and use.

[0048] By homologous alignment method, referring to the sequence of Arabidopsis genes and known partial gene sequences of tobacco, the primer sequence for amplification was designed as follows:

[0049] NtSULTR3.4CF: 5'-ATGACATTAAATTCAATTAAAG-3', (SEQ ID No. 8);

[0050] No. 8);

[0051] NtSULTR3.4CR: 5'-TCATGGTTCAGTCTTCCAAG-3'; (SEQ ID No. 9).

[0052] Using the above prepared cDNA as a template, the above primer was used for PCR amplification:

[0053] Amplification system (50 μL):

[0054]

[0055] After mixing and centrifugation, PCR amplification was performed, and the PCR reaction conditions were as follows: 95 °C for 10 sec, 52 °C for 30 sec, 72 °C for 2 min, for a total of 30 cycles; 72 °C for 10 min; 25 °C for holding.

[0056] The purified amplification product was sequenced to obtain the CDS sequence of the gene NtSULTR3.4 related to nicotine metabolism and plant height regulation, the base sequence of which is shown in SEQ ID No. 1, and the base sequence comprises 1965 bases. After the gene sequence is translated, the protein sequence encoded by the gene is shown in SEQ ID No. 2, and the protein sequence comprises 654 amino acid residues.

[0057] Construction of expression vector in Example 2

[0058] Using the gene NtSULTR3.4 related to nicotine metabolism and plant height regulation obtained in Example 1, the present application further constructs a CRISPR / Cas9 vector.

[0059] (1) Design and synthesis of sgRNA sequence of NtSULTR3.4 gene:

[0060] The sgRNA guide sequence is designed by using the online software CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ), and the guide sequence with a higher score and located at a suitable position of the NtLNP1 gene sequence is selected.

[0061] The selected sgRNA sequence in the present application is: ATCTATAGCATCACTAGTGATGG (SEQ ID No. 3).

[0062] (2) The forward and reverse primers of the sgRNA sequence are designed and synthesized by a design company: the upstream primer sgRNA-F: GATTGATCTATAGCATCACTAGTGA (SEQ ID No. 4) and the downstream primer sgRNA-R: AAACCTCACTAGTGATGCTATAGAT (SEQ ID No. 5);

[0063] (3) Primer annealing: the synthesized target sequence primers (upstream primer and downstream primer) are diluted with sterilized ddH2O to a concentration of 100 ng / μL, and then 5 μL of the upstream primer and 5 μL of the downstream primer are mixed uniformly in a PCR tube and placed on a PCR instrument for annealing, so that the single-stranded upstream and downstream oligos are annealed to form double-stranded.

[0064] The annealing program of the PCR instrument is: 95℃ for 2 min, -0.1℃ / 8 s, annealing to 25℃, and the annealing product is diluted to 10 ng / μL with 90 μL of sterile water.

[0065] (4) Enzymatic digestion and ligation

[0066] a. The CRISPR / Cas9 vector pOREU3TR is digested with restriction endonuclease BsaI-HF.

[0067] Enzyme digestion system (50 μL):

[0068]

[0069] 37℃ overnight enzyme digestion, 1.5% agarose gel electrophoresis, cutting the target fragment band, and recovering the skeleton fragment with the gel recovery kit.

[0070] b. Ligation

[0071] The double-stranded product formed by annealing was ligated with the enzyme-digested vector skeleton.

[0072] Ligation system (10 μL):

[0073]

[0074]

[0075] The ligation conditions were: 16℃ for 2 hours.

[0076] (5) Transformation of E. coli:

[0077] a. Take Trans-T1 competent cells from -80℃ and freeze-thaw on ice, divide into 50 μL / portion;

[0078] b. After the competent cells are thawed, add 10 μL of the ligation product to the competent cells, mix gently, and ice bath for 10 min;

[0079] c. After ice bath, heat shock in a 42℃ water bath for 90 s, and quickly put the competent cells back on ice for 2 min.

[0080] d. Spread 60 μL of the transformation product evenly on LB solid medium containing 50 mg / L kanamycin, and incubate in a 37℃ bacterial incubator for 12 hours.

[0081] (6) Positive clone screening:

[0082] a. After the plate grows single colonies, pick E. coli single colonies into LB liquid medium containing 50 mg / L kanamycin, and shake overnight at 37℃;

[0083] b. Take part of the bacterial solution for bacterial solution PCR, and detect whether it is a positive clone by nucleic acid electrophoresis;

[0084] c. Extract E. coli plasmid from the remaining part of the bacterial solution preliminarily detected as a positive clone. Send the plasmid to Novogene for sequencing to confirm the correctness of the positive clone.

[0085] Example 3 Creation and identification of T0 generation plants

[0086] The Agrobacterium LBA4404 liquid carrying CRISPR / Cas9-NtSULTR3.4 sgRNA expression vector is soaked to infect tobacco leaf discs, and co-cultured, differentiated and cultured, and induced to root, and T0 generation tissue culture seedlings are obtained, which are transplanted to a greenhouse pot, and sampled after 2 months to detect the target editing, and NtSULTR3.4 gene edited plants are obtained, and the related experimental process is briefly introduced as follows:

[0087] (1) Transformation of Agrobacterium

[0088] The correct sequence of the plasmid is transformed into Agrobacterium, and the specific steps are as follows:

[0089] 1) Take the LBA4404 electrotransformation competent Agrobacterium cells stored at -80°C, and freeze-thaw on ice.

[0090] 2) When the competent cells are just thawed, add 2 μL of CRISPR / Cas9-NtLNP1 editing vector plasmid, mix well, and place on ice.

[0091] 3) Transfer the mixed competent cells to a pre-cooled electrotransformation cup, and place the electrotransformation cup in an electrotransformation instrument for transformation. After transformation, add 1 mL of YEB liquid medium to mix with the transformation liquid, and then place it in a shaker at 28°C, 200 rpm for 1.5-2 h.

[0092] 4) Centrifuge the medium at 8,000 rpm, discard the supernatant, and resuspend the bacterial cells with 200 μL of YEB liquid medium, and then spread on YEB solid medium containing 50 mg / L rifampicin, 50 mg / L streptomycin and 50 mg / L kanamycin, and incubate at 28°C in the dark for 2-3 d.

[0093] (2) Leaf disc preparation and infection

[0094] 1) Prepare tobacco leaf discs in a clean bench to form square leaf discs with a side length of 1 cm, and prepare Agrobacterium colonies containing CRISPR / Cas9-NtSULTR3.4 sgRNA expression vector into a suspended bacterial liquid (OD 600 = 0.6-0.8) with MS liquid.

[0095] 2) Use the suspended Agrobacterium liquid to soak and infect the tobacco leaf discs for 10 min.

[0096] 3) Place the leaf discs on MS solid medium containing 2.0 mg / L NAA + 0.5 mg / L 6-BA, and incubate at 28°C in the dark for 3 d.

[0097] (3) Differentiation culture and induction of rooting

[0098] 1) Differentiation culture, placed on MS solid medium containing 2.0 mg / L NAA + 0.5 mg / L 6-BA + 250 mg / L Cb + 50 mg / L Kan. The culture conditions are: 28°C light culture 16h / d, light intensity 30-50 μmol / (m2·s), 25°C dark culture 8h / d, culture for 45-60d until differentiation bud formation, change the differentiation culture medium every 7-10d for 3-4 times; culture until differentiation bud formation.

[0099] 2) Rooting culture, cut the purple callus with differentiation bud formation, placed on MS medium containing 500 mg / L carbenicillin and 50 mg / L kanamycin for culture, when the differentiation bud on the callus grows to 2-4 cm high, the culture conditions are consistent with the differentiation culture conditions, culture for 8-14d; rooting culture of regenerated plants, cut the differentiation bud and insert into MS medium containing 500 mg / L carbenicillin and 50 mg / L kanamycin for rooting culture, the culture conditions are consistent with the differentiation culture conditions, culture for 20-30d.

[0100] (4) T0 generation plant culture and target detection

[0101] The tissue culture rooting purple seedlings were transplanted to a greenhouse pot, and after 2 months, the tender leaves of the purple plants were taken and sent to Huada Gene for molecular detection. The detection primers were upstream primer NtSULTR3.4-F: CGTGCGTGGAACCCTTACTT (SEQ ID No. 6) and downstream primer NtSULTR3.4-R: AGAATTGGCTCTTGGCTGTATGA (SEQ ID No. 7). After detection and identification, one edited material with 2 base deletions was obtained. The deletion of 2 bases caused a frameshift mutation in NtSULTR3.4, which resulted in premature termination of translation. T0 generation seeds were collected.

[0102] Example 4: Obtaining of homozygous edited material

[0103] The T0 generation seeds were self-crossed for 100 times for homozygous propagation. Green T1 generation plants were selected for thinning and fixing. When the green seedlings grew to 5-6 leaves, the leaves of a single plant were sampled and sent to Huada Gene for molecular detection. The sgRNA and target mutation were detected. The target detection primers were the same as above. Plants with homozygous editing of NtSULTR3.4 gene without T-DNA were determined, and T1 generation seeds were collected in a bag.

[0104] Example 5: Observation of traits and genetic stability of T-DNA-free homozygous edited material

[0105] The T1 generation seeds are expanded and planted by potting, 60 plants are planted, and the main botanical characteristics are investigated 7 days after topping. Referring to the YCT 142-2010 tobacco agronomic trait investigation and measurement method, the topping plant height, waist leaf length, waist leaf width and other trait indexes of the T2 generation plants are determined and analyzed, and the T2 generation seeds are collected by bagging.

[0106] The T2 generation seeds are expanded and planted by potting, 60 plants are planted, and the main botanical characteristics are investigated 7 days after topping. Referring to the YCT 142-2010 tobacco agronomic trait investigation and measurement method, the topping plant height, effective leaf number, waist leaf length, waist leaf width and other trait indexes of the T3 generation plants are determined and analyzed.

[0107] The results show that the topping plant height and effective leaf number of the T2 generation and T3 generation plants of the NtSULTR3.4 gene knockout are extremely significantly lower than those of the control, the waist leaf length is significantly longer than that of the control, and the waist leaf width is significantly wider than that of the control.

[0108] The main agronomic characteristics of the NtSULTR3.4 T2 generation and T3 generation plants of the application are compared with those of the control (unedited) as shown in Table 2. Figure 1

[0109] Example 6 GC-MS detection

[0110] The T2 generation and T3 edited plants planted in Example 5 are used, and then the nicotine content of the 7-day post-topping leaves of the NtSULTR3.4 gene homozygous knockout material is detected by GC-MS.

[0111] Select 5 control (unedited) tobacco plant samples 7 days after topping, and collect leaves at the same leaf position; select 5 NtLNP1 gene homozygous edited tobacco plant samples 7 days after topping; remove the main ribs of the leaves, wrap them in tin foil, and store and transport them in liquid nitrogen, store them in the laboratory at ultra-low temperature (-70℃), freeze-dry, and sieve.

[0112] 0.2g of sample is weighed in a 15mL centrifuge tube, accurately to 0.1mg, 2.0mL of 5% sodium hydroxide solution is added, and then 0.05mL of internal standard solution A (dimethylquinoline solution, prepared with methanol, diluted with dichloromethane to 1.0mg / mL) and internal standard solution B (2,2'-dipyridyl-d2 solution, prepared with methanol, diluted with dichloromethane to 0.5mg / mL) are added, respectively, after oscillation and mixing, 20min of standing, then 10.0mL of extraction solution (dichloromethane and methanol are mixed in a volume ratio of 4:1) is added, and after sealing, it is placed in a vortex oscillator, oscillated at a speed of 2000r / min for 40min, and after standing for 1h, centrifuged for 8min, the lower organic phase is taken out and transferred to a chromatographic bottle, and analyzed by GC-MS.

[0113] ​The gas chromatography reference conditions are as follows: chromatographic column: DB-35MS or equivalent column efficiency capillary chromatographic column with a specification of 30 mm (length) x 0.25 mm (inner diameter) x 0.25 m (film thickness); injection port temperature: 250 DEG C; column flow rate: 1.0 mL / min; nicotine injection volume: 1.0 L, split injection, split ratio of 40:1; other alkaloid injection volume: 2.0 L, split injection, split ratio of 10:1; temperature rising program: initial temperature 100 DEG C, holding for 3 min; rising to 260 DEG C at a rate of 8 DEG C / min, holding for 10 min.

[0114] The mass spectrometry reference conditions are as follows: transfer line temperature: 280 DEG C; ionization mode: electron impact source (EI); ionization energy: 70 eV; ion source temperature: 230 DEG C; solvent delay: 8 min; determination mode: selected ion monitoring mode (SIM) scanning.

[0115] The comparison of the alkaloid content of the 7-day leaf after topping of the control (non-edited) and the NtSULTR3.4 gene homozygous edited tobacco plants (the results are shown in Table 1) shows that the nicotine content of the 7-day leaf after topping of the T2 and T3 plants with the NtSULTR3.4 gene knocked out is significantly higher than that of the control plants, and the nicotine content is increased by about 30%.

[0116] Table 1 is the alkaloid content (μg / g) of the fresh tobacco leaf of the NtSULTR3.4 gene knockout T2 and T3 edited plants of the application and the control after topping for 7 days.

[0117]

[0118] In summary, the NtSULTR3.4 gene is knocked out by using the CRISPR / Cas9 mediated gene editing technology to obtain edited materials with increased nicotine content and changed plant height, and the analysis of the main agronomic traits and nicotine content of the edited material plants of two consecutive generations shows that the gene is a negative regulatory factor of nicotine metabolism, and is positively correlated with the plant height of tobacco, which provides genetic materials and theoretical basis for the directional improvement of new tobacco varieties with nicotine metabolism gene function research, nicotine content regulation and plant height regulation.

[0119] Although the application has been disclosed as above, it is not intended to limit the application, and any person skilled in the art can make various selections and modifications without departing from the spirit and scope of the application, and therefore the protection scope of the application is defined by the claims and their equivalent forms.

Claims

1. A gene related to tobacco nicotine metabolism and plant height regulation NtSULTR3.4 The application in nicotine metabolism and plant height regulation is characterized in that: described NtSULTR3.4 The CDS sequence of tobacco was shown in SEQ ID No. 1, and CRISPR / Cas9 was used to knock out NtSULTR3.4 A new tobacco variety with high nicotine content and reduced plant height.

2. The use according to claim 1, characterized in that CRISPR / Cas9 knockout of tobacco NtSULTR3.4 The method for genetically obtaining tobacco with high nicotine content and reduced plant height comprises the following steps: (1) Design sgRNA guide sequence and construct sgRNA expression vector; (2) Obtain T0 generation editing materials through genetic transformation; (3) The T0 generation plants were self-pollinated to obtain homozygous editing materials without T-DNA; (4) Plant two generations of homozygous T-DNA-free materials to observe their traits and evaluate their genetic stability; (5) GC-MS NtSULTR3.4 Detection of nicotine content in leaves of two-generation homozygous knockout materials 7 days after topping.

3. The use according to claim 2, characterized in that In step (1), the sgRNA guide sequence is ATCTATAGCATCACTAGTGATGG (SEQ ID No. 3).

4. The use according to claim 3, characterized in that In step (1), the primer sequence used for the sgRNA guide sequence is: Upstream primer NtSULTR3.4gRNA-F: GATTGATCTATAGCATCACTAGTGA (SEQ ID No. 4); Downstream primer NtSULTR3.4gRNA-R: AAACCTCACTAGTGATGCTATAGAT (SEQ ID No. 5).

5. The use according to claim 2, characterized in that Step (1) is as follows: The sgRNA guide sequence was designed, and the upstream primer sgRNA-F and the downstream primer sgRNA-R were annealed to form a double strand. The CRISPR / Cas9 vector pOREU3TR was digested with the restriction endonuclease BsaI-HF. The annealed double-stranded product was ligated to the digested vector backbone using T4 ligase. The ligation product was transformed into Escherichia coli competent cells, and positive clones were detected and recombinant plasmids were extracted to obtain the CRISPR / Cas9-sgRNA expression vector.

6. The use according to claim 2, characterized in that Step (2) is as follows: The tobacco leaf discs were inoculated with Agrobacterium LBA4404 carrying the CRISPR / Cas9-sgRNA expression vector. After co-cultivation, differentiation culture and rooting induction, T0 generation tissue culture seedlings were obtained. The tissue culture seedlings were transplanted into greenhouse pots. After 2 months, samples were taken to detect the target editing status. NtSULTR3.4 The plants whose genes have been edited are harvested to obtain T0 generation seeds.

7. The use according to claim 2, characterized in that Step (3) is as follows: The T0 generation seeds were self-pollinated and multiplied 100 times, and the sgRNA and target editing tests were performed to obtain NtSULTR3.4 The plants that are homozygous for gene editing and do not contain T-DNA are harvested to obtain T1 generation seeds. NtSULTR3.4 The primer sequences used for target editing detection are the same as those in step (2).

8. The use according to claim 2, characterized in that Step (4) is as follows: The T1 generation seeds were propagated in pots, and 60 plants were planted. Seven days after topping, the main botanical traits were investigated, the traits of the T2 generation plants were measured and analyzed, and the T2 generation seeds were bagged and harvested. The T2 generation seeds were propagated and planted in pots, with 60 plants planted. The main botanical traits were investigated 7 days after topping, and the trait indicators of the T3 generation plants were measured and analyzed.

Images