Method for detecting methicillin-resistant staphylococcus aureus based on crisper and rolling circle amplification

By combining CRISPR and rolling circle amplification technology, and utilizing Cas12a-crRNA and FRET fluorescent probes, specific and highly sensitive detection of methicillin-resistant Staphylococcus aureus was achieved under isothermal conditions. This solves the problems of long detection time, expensive equipment, and professional skills required by existing detection methods, and achieves rapid and accurate detection results.

CN118773350BActive Publication Date: 2025-11-21RES & DEV INST OF NORTHWESTERN POLYTECHNICAL UNIV IN SHENZHEN +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410930776.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-12
Publication Date
2025-11-21
Estimated Expiration
2044-07-12

AI Technical Summary

Technical Problem

Existing methods for detecting methicillin-resistant Staphylococcus aureus are time-consuming, require expensive equipment and specialized skills, and are easily affected by environmental interference, resulting in unstable detection results.

Method used

Combining CRISPR and rolling circle amplification technologies, detection is performed under isothermal conditions. Cas12a-crRNA and FRET fluorescent probes are used to achieve specific and highly sensitive detection of the MecA gene. The combination of rolling circle amplification and CRISPR/Cas12a technology enables dual amplification of the fluorescence ratio signal.

Benefits of technology

It enables rapid and accurate detection of methicillin-resistant Staphylococcus aureus in complex food matrices, reducing detection time, improving detection sensitivity and anti-interference ability, and has the capability to complete the detection within 4 hours.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118773350B_ABST
    Figure CN118773350B_ABST
Patent Text Reader

Abstract

The application discloses a methicillin-resistant Staphylococcus aureus detection method based on CRISPR and rolling circle amplification, and belongs to the technical field of gene detection. The detection method comprises the following steps: synthesizing a circular DNA template in a loop reaction system; incubating the circular DNA template with DNA polymerase, dNTPs, recombinant albumin, a primer and a polymerase reaction buffer, then terminating the reaction by heat treatment to obtain an RCA amplification product; incubating pre-assembled Cas12a-crRNA, the RCA amplification product and a FRET fluorescent probe in a buffer to generate a detectable ratio fluorescence signal change, thereby obtaining a sample solution to be detected; and measuring the fluorescence signal. The application has the advantages of short time consumption and sensitive detection in a complex food matrix.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of gene detection, and particularly relates to a methicillin-resistant Staphylococcus aureus detection method based on CRISPR and rolling circle amplification. BACKGROUND

[0002] As an important foodborne bacterial pathogen, methicillin-resistant Staphylococcus aureus widely exists in many foods, hospitals and community environments, can contaminate foods in the food preparation and processing process, and is considered as one of the main causes of food poisoning. Because of its high pathogenicity and high prevalence, it can cause extensive and severe infections. Methicillin, penicillin and kanamycin and other β-lactam antibiotics can achieve the purpose of killing bacteria to treat infections by inhibiting the synthesis of bacterial cell walls, but MRSA can resist all β-lactam antibiotics including methicillin, penicillin and kanamycin. Because MRSA contains the MecA gene encoding penicillin-binding protein 2a (PBP2a), PBP2a does not bind to antibiotics, and the cell wall remains intact, so that the bacteria survive. The MecA gene is identified as a marker for detecting MRSA and MSSA. Therefore, it is urgent to develop a rapid and accurate detection method to distinguish MRSA from other pathogenic bacteria to evaluate the impact of MRSA on the food chain and foodborne diseases. Currently, the main methods for diagnosing methicillin-resistant Staphylococcus aureus in clinics are paper diffusion method (K-B method) and polymerase chain reaction-based method. The traditional K-B diffusion method and VITEK2 method need to be identified after 24h bacterial culture, and the detection time often needs one to two days, which is time-consuming. The PCR method needs three steps of annealing, denaturation and extension, so it needs professional experimental equipment, and the heating module of the equipment is expensive, which requires a professional laboratory. In addition, the PCR method is difficult to operate, and false positive results may be caused by aerosol, so professional experimental personnel are needed. The experimental operation of the present method is less difficult and there is no aerosol. Therefore, the existing detection methods are time-consuming, and require expensive instruments, professional laboratories and technical personnel.

[0003] Therefore, the present application designs a methicillin-resistant Staphylococcus aureus detection method combining CRISPR and rolling circle amplification. SUMMARY

[0004] The technical problem to be solved is:

[0005] In order to avoid the shortcomings of the prior art, the present application provides a methicillin-resistant Staphylococcus aureus detection method based on CRISPR and rolling circle amplification, which combines CRISPR and rolling circle amplification to complete isothermal rolling circle amplification at 30 DEG C without the need for heating equipment, so as to achieve the purpose of anti-interference and specific detection of methicillin-resistant Staphylococcus aureus; therefore, it has the advantages of short time consumption, sensitive detection in complex food matrix, etc. The present application solves the problems of long time consumption, easy interference and unstable detection effect of the existing detection method.

[0006] The technical scheme of the present application is: a methicillin-resistant Staphylococcus aureus detection method based on CRISPR and rolling circle amplification, the specific steps are as follows:

[0007] Synthesizing a circular DNA template in a loop reaction system; the loop reaction system comprises a padlock probe, a target gene, 1x Splint R Buffer, a Splint R ligase and water, wherein the sequence of the padlock probe is:

[0008] P-TGATCCCAATTATACCACGTTTGGGCGTGTTAACCCACGCCGAATAATGAATGACGCTA;

[0009] Incubating the circular DNA template with a DNA polymerase, dNTPs, recombinant albumin, a primer and a polymerase reaction buffer, and then terminating the reaction by heat treatment to obtain an RCA amplification product; the sequence of the primer is: TTAACACGCCCAAACGTGGTA;

[0010] Incubating the pre-assembled Cas12a-crRNA with the RCA amplification product, a FRET fluorescent probe and a buffer to produce a detectable ratio fluorescent signal change to obtain a sample solution to be detected; the sequence of the crRNA is UAAUUUCUACUAAGUGUAGAUGGCGUGUUAACCCACGCCGAAU;

[0011] Measuring the fluorescent signal.

[0012] The further technical scheme of the present application is: the preparation method of the circular DNA template is mixing the padlock probe with the genomic DNA of methicillin-resistant Staphylococcus aureus, annealing treatment, incubating with a DNA ligase in a ligase reaction buffer system, and then terminating the reaction by heat treatment to obtain the circular DNA template.

[0013] Further technical solutions of the present application are: the process parameters of the preparation method of the circular DNA template are: annealing conditions: 95℃, 5min, 0.1℃ / S slowly reduced to room temperature and kept for 5min, and then stored at 4℃; incubation conditions: 25℃, 10-120min; heat treatment conditions: 65°C, 10min.

[0014] Further technical solutions of the present application are: the process parameters of the RCA amplification product preparation are: incubation conditions: 30℃, 0.5-6h; heat treatment conditions: 65°C, 10min.

[0015] Further technical solutions of the present application are: the volume ratio of the circular DNA template, DNA polymerase, dNTPs, recombinant albumin, DNA primer and polymerase reaction buffer is: 5:3-15:3:1:1:2.

[0016] Further technical solutions of the present application are: the incubation conditions of the pre-assembled Cas12a-crRNA and RCA amplification product, FRET fluorescent probe in the buffer solution are: 37℃, 10-180min.

[0017] Further technical solutions of the present application are: the concentration ratio of Cas12a and crRNA is 20-100nM:100nM.

[0018] Further technical solutions of the present application are: the sequence of the FRET fluorescent probe is: 6-FAM-TTTTTT-CY3.

[0019] Further technical solutions of the present application are: the measurement method of the fluorescent signal is: 80μL of enzyme-free water is added to the sample solution to be measured, 475nm wavelength light is used for excitation, and the ratio of the fluorescent signal changes at 528nm and 571nm is measured.

[0020] A kit for detecting methicillin-resistant Staphylococcus aureus, comprising a padlock probe, methicillin-resistant Staphylococcus aureus genomic DNA, Splint R ligase, dNTPs, recombinant albumin, primer, phi29 DNA polymerase, Cas12a-crRNA and FRET fluorescent probe.

[0021] Advantages

[0022] The present application has the beneficial effects that: the present application uses rolling circle amplification technology combined with CRISPR / Cas12a for MecA gene detection, and when the MecA gene exists, the amplification reaction of RCA and the cleavage reaction of CRISPR / Cas12a can be activated, and the change of the fluorescence ratio signal is realized; when the MecA gene does not exist, RCA and CRISPR / Cas12a cannot be activated, and the change of the fluorescence ratio signal does not occur.

[0023] The present application successfully realizes specific detection of methicillin-resistant Staphylococcus aureus by optimization of the detection system. Rolling circle amplification uses circular DNA as a template, and through a short DNA primer (complementary to part of the circular template), dNTPs are converted into single-stranded DNA under the catalysis of an enzyme, and the single-stranded DNA contains hundreds of repeated template complementary fragments, which contain a large number of target sequence fragments capable of activating Cas12a; Cas12a activates its trans-cleavage activity after recognizing the RCA amplification fragment, and efficiently and non-specifically cleaves the reporter probe, and through the combination of rolling circle amplification and CRISPR / Cas12a technology, the target signal is doubled, the sensitivity of the detection is greatly reduced, and aM methicillin-resistant Staphylococcus aureus determination is realized. Through linear determination, a good linear relationship is shown in the range of 100 aM to 1 pM Figure 3 B), the correlation coefficient (R 2 ) is 0.9562. It shows that it has great potential for sensitive detection of MecA gene.

[0024] The FRET-based nucleic acid probe has high sensitivity and anti-interference, and has significant advantages such as anti-interference. The ratio signal of the FRET probe can be used as an internal standard to compensate for the non-uniform distribution of the analyte due to signal / noise improvement. Allow correction to take into account environmental fluctuations, so that it has great advantages in complex physiological environments. The present application realizes sensitive detection in 10% of complex food matrices such as beef and pear juice by using FRET probes instead of traditional FQ probes, and has stronger anti-interference ability.

[0025] The present application has comparable sensitivity and specificity to the PCR method reported in the literature. It is more superior in terms of detection time. The present application only needs 4 h to complete the detection, while the traditional K-B diffusion method and VITEK2 method need 18~24 h. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 : Fluorescence spectra obtained by using different reaction components for MecA gene analysis; wherein the concentration of the MecA gene is 10 pM.

[0027] Figure 2: The results of the optimization of the reaction system. (A) The results of the optimization of the amount of ligase Splint R; (B) the results of the optimization of the amount of polymerase phi29; (C) the results of the concentration of Cas12a; (D) the results of the optimization of the ring formation time; (E) the results of the optimization of the RCA time; (F) the results of the optimization of the CRISPR / Cas12a cleavage time. The error bars represent the standard deviation of three measurements.

[0028] Figure 3 : The results of the sensitivity detection. The error bars represent the standard deviation of three measurements.

[0029] The results show that the fluorescence intensity of the solution has a linear relationship with the change of the concentration of MecA, and the concentration of MecA ranges from 100 aM to 1 pM.

[0030] Figure 4 : The control diagram of three different common pathogenic bacteria: Escherichia coli, methicillin-sensitive S. aureus (MSSA) and Pseudomonas aeruginosa. When the target is MRSA, the generated fluorescence ratio signal intensity is significantly enhanced, and compared with MRSA, the ratio fluorescence signal of other pathogenic bacteria groups is the same as that of the blank group, indicating that the proposed method can specifically distinguish MRSA from other pathogenic bacteria. DETAILED DESCRIPTION

[0031] The examples described below by reference to the accompanying drawings are exemplary and are intended to serve only for explaining the present application and cannot be understood as a limitation of the present application.

[0032] The report probe used in the traditional CRISPR / Cas technology is a linear FQ report molecule, which mainly cuts the oligonucleotide used to connect the fluorescent group and the quenching group through its trans-cleavage activity, so that the fluorescence is restored, and then the signal is read by a fluorescence detector. However, this is easily disturbed by the environment, and only one readout wavelength does not have self-regulating ability.

[0033] The appearance of fluorescence resonance energy transfer (FRET) technology solves this problem. The basic principle of FRET was first described by Theodor Förster in 1948. Energy can be transferred from one excited-state fluorophore (donor) to another fluorophore (acceptor) in a non-radiative manner through dipole-dipole interactions, i.e. when two fluorescent groups are close enough and the emission spectrum of the two groups partially overlaps, the donor and the acceptor can undergo such energy transfer, so that the fluorescence of the donor is weakened and the fluorescence of the acceptor is enhanced. The nucleic acid probe based on FRET has the advantages of high sensitivity and anti-interference, and has been widely used in the research of biosensing and tumor treatment in the past few decades. The ratio signal of the FRET probe can be used as an internal standard to compensate for the non-uniform distribution of the analyte due to signal / noise improvement. It allows correction to take into account environmental fluctuations, making it a great advantage in complex physiological environments.

[0034] Based on the problems of long time-consuming, easy to be disturbed, unstable detection effect and the like of the existing detection methods, the methicillin-resistant Staphylococcus aureus detection method based on CRISPR and rolling circle amplification comprises the following steps:

[0035] Step 1: Mix the padlock probe with the genomic DNA of methicillin-resistant Staphylococcus aureus, anneal and treat, the annealing conditions are 95°C, 5min, 0.1°C / s slowly reduced to room temperature and kept for 5min, and then stored at 4°C; incubate with DNA ligase in a DNA ligase reaction buffer system, the incubation conditions are 25°C for 10-120min; then terminate the reaction by heat treatment, the heat treatment conditions are 65°C for 10min; obtain the circular DNA template; the sequence of the padlock probe is WEI P-TGATCCCAATTATACCACGTTTGGGCGTGTTAACCCACGCCGAATAATGAATGACGCTA.

[0036] Preferably, 10nM padlock probe is mixed with methicillin-resistant Staphylococcus aureus genomic DNA, annealing treatment, 3-10U DNA ligase is incubated in a 20μL ligase reaction buffer system, and then the reaction is terminated by heat treatment to obtain a circular DNA template;

[0037] Step 2: Incubate the circular DNA template with DNA polymerase, dNTPs, recombinant albumin, primers and polymerase reaction buffer, the incubation conditions are 30°C for 0.5-6h; then terminate the reaction by heat treatment, the heat treatment conditions are 65°C for 10min; obtain the RCA product; the sequence of the primer is TTAACACGCCCAAACGTGGTA;

[0038] Preferably, 5 μL of circular DNA template is incubated with 3-15 U of DNA polymerase, 3 μL of dNTPs, 1 μL of recombinant albumin, 1 μL of primer, and 2 μL of polymerase reaction buffer, and then the reaction is terminated by heat treatment to obtain the RCA product.

[0039] Step 3: Pre-assembled Cas12a-crRNA, RCA product, and FRET fluorescent probe are added to 1X NEBuffer™ r2.1 buffer, and incubated at 37℃ for 10-180 min; the sequence of the crRNA is:

[0040] Preferably, the concentration ratio of Cas12a to crRNA is 20-100 nM:100 nM.

[0041] Preferably, the sequence of the FRET fluorescent probe is 6-FAM-TTTTTT-CY3.

[0042] Step 4: Measurement of fluorescence signal.

[0043] The present application also provides a kit for detecting methicillin-resistant Staphylococcus aureus, comprising: a padlock probe, methicillin-resistant Staphylococcus aureus genomic DNA, a Splint R ligase, dNTPs, recombinant albumin, a primer, phi29 DNA polymerase, Cas12a-crRNA, and a FRET fluorescent probe.

[0044] The above technical solutions are further described in combination with the accompanying drawings and specific examples:

[0045] 1. Methicillin-resistant Staphylococcus aureus detection method

[0046] The oligonucleotide sequences required by the present method are listed in Table 1-1 and are synthesized by Shenguo Biotechnology Co., Ltd., as follows:

[0047] Sequences used in the present application

[0048]

[0049] Table 1-1

[0050] Rolling circle amplification (RCA) is an efficient isothermal enzymatic reaction that uses a circular probe as a template to generate long concatemeric single-stranded DNA or RNA products under the priming of short primers. When the target MecA gene is absent, or only one of them is present, the padlock is an independent single-stranded structure and cannot initiate the subsequent rolling circle amplification reaction, and the reaction is terminated. When the target MecA gene is present, it is annealed and can be connected into a circular template under the action of Splint R ligase, and with the help of primer DNA and phi29 polymerase, it can be amplified along the circular template to generate thousands of single-stranded DNA products that can trigger the CRISPR / Cas12a system. Cas12a is used to cut the FRET fluorescent probe to produce fluorescence that can be detected.

[0051] The embodiment of the application is a methicillin-resistant Staphylococcus aureus detection method based on CRISPR and rolling circle amplification, and the specific steps are as follows:

[0052] Step 1: Formation of circular template

[0053] In order to synthesize circular DNA template in 20 μL circular reaction system, 10 nM padlock probe and various concentrations of target MecA gene were annealed before the templating cyclization process, and the annealing conditions were 95°C, 5 min, 0.1°C / s slowly reduced to room temperature for 5 min, and then stored at 4°C. The circular template was connected by incubating 8 U of Splint R ligase in 1x Splint R Buffer at 25°C for 45 min, and the process was terminated by heat treatment (65°C, 10 min) to obtain the circular DNA template (CDT). Stored at -20°C refrigerator for use in step 2.

[0054] Step 2: Generation of RCA amplification product

[0055] For RCA reaction, 5 μL of CDT prepared in step 1 above was incubated with phi29 DNA polymerase (8 μL, 1 U / μL), dNTPs (3 μL, 5 mM), recombinant albumin (1 μL, 2 mg / ml), primer DNA (1 μL, 10 nM) and polymerase reaction buffer (2 μL, 10x). The reaction mixture was incubated at 30°C for 2 hours, and then terminated by heat treatment (65°C, 10 min). Stored at -20°C refrigerator for use in step (3).

[0056] Step 3: Activation of CRISPR / Cas12a reverse enzyme cutting function

[0057] Cas12a proteins (LbCpf1, FnCpf1, AsCpf1) have both forward (cis) and reverse (trans) cleavage activities of single-stranded DNA. When Cas12a forms a ternary complex with a specific crRNA and its target DNA, the complex acquires strong reverse cleavage activity and cuts single-stranded DNA into 2-4 nucleotide fragments. Using this property of Cas12a, we first convert the signal detection of methicillin-resistant Staphylococcus aureus into a DNA signal that can be amplified by a rolling circle amplification reaction, and then the single-stranded repeat units of the rolling circle amplification reaction are complementary to the designed crRNA and stimulate the reverse cleavage activity of Cas12a for cutting the FRET signal probe to produce a detectable ratio fluorescence signal change.

[0058] Reaction conditions for activating the reverse enzyme cleavage function of CRISPR / Cas12a: The CRISPR / Cas12a cleavage assay was performed in 1x NEBuffer 2.1. The pre-assembled Cas12a-crRNA (80 / 100 nM) was added to 10 μL of activator (the product of RCA) and 0.5 μM FRET fluorescent probe to make the total system size 20 μL, and incubated at 37°C for 60 min. Left for use in step (5).

[0059] Step 4: Measurement of fluorescence signal

[0060] Because one end of the FRET probe is modified with a fluorescent group FAM and the other end is modified with a fluorescent group CY3, when the probe maintains its intact structure, fluorescence resonance energy transfer occurs between the fluorescent groups FAM and CY3 due to the close distance, and at this time the fluorescence of CY3 can be detected; after the probe is cut into fragments by the reverse cleavage activity of Cas12a, spatial separation occurs, and at this time the fluorescence detected is mainly emitted by FAM.

[0061] Measurement conditions of fluorescence signal: 80 μL of enzyme-free water was added to the reaction solution of step 3, and then a fluorescence measuring instrument was used to measure the ratio fluorescence signal change at 528 nm and 571 nm with 475 nm wavelength light excitation.

[0062] The feasibility of the method was studied by detecting the fluorescence intensity with a fluorescence measuring instrument. As shown in Figure 1 only when the target MecA gene is present, RCA amplification can be completed, the reverse cleavage activity of Cas12a is activated, the FRET probe is cut, and the fluorescence intensity is restored.

[0063] 2. Optimization of reaction system

[0064] As shown in Figure 2The concentrations of ligase Splint R, polymerase phi29 and Cas12a were optimized, respectively, as well as the incubation time for forming circular template, RCA amplification time and Cas12a cleavage, and the optimal reaction conditions were obtained.

[0065] Example 1: Sensitivity detection

[0066] Linear response to analyte is the key to analysis, we use FRET probe as reporter molecule, as shown in Figure 3 As shown in A, with the gradual increase of MecA gene concentration along the arrow direction, the fluorescence signal intensity ratio of the probe at 528 nm wavelength to that at 571 nm wavelength gradually increases, according to Figure 3 B shows that the intensity of the ratio fluorescence signal has a good linear relationship with the logarithm of MecA concentration, the correlation coefficient (R 2 ) is 0.9718, and the response range is 100 aM to 1 pM. The linear regression equation of MecA is Y = 0.4224X - 0.5971, respectively. These results show that the biosensor has great potential for sensitive detection of MecA gene.

[0067] Example 2: Accuracy detection

[0068] The detection ability of the detection method in complex food matrix was studied by standard addition recovery, that is, quantitative standard substance was added to the sample matrix without the measured substance, and the ratio of the results to the theoretical value was obtained according to the sample processing steps. The specific process is as follows: first, 10% pear juice and 100 aM standard MecA gene sample were added to the buffer solution of rolling circle amplification reaction, and after rolling circle amplification reaction, the method of the application was used for detection. The results show that the detected MecA gene concentration is 107 aM, the recovery rate is 106.70%, and the relative standard deviation (RSD) is 2.22%.

[0069] Example 3: Accuracy detection

[0070] The detection ability of the detection method in complex food matrix was studied by standard addition recovery, that is, quantitative standard substance was added to the sample matrix without the measured substance, and the ratio of the results to the theoretical value was obtained according to the sample processing steps. The specific process is as follows: first, 10% raw beef tissue grinding liquid and 100 aM standard MecA gene sample were added to the buffer solution of rolling circle amplification reaction, and after rolling circle amplification reaction, the method of the application was used for detection. The results show that the detected MecA gene concentration is 106 aM, the recovery rate is 106.64%, and the relative standard deviation (RSD) is 6.68%.

[0071] Embodiment 4: A kit for detecting methicillin-resistant Staphylococcus aureus

[0072] The kit comprises: a padlock probe, methicillin-resistant Staphylococcus aureus genomic DNA, a splint R ligase, dNTPs, recombinant albumin, primers, phi29 DNA polymerase, Cas12a-crRNA and FRET fluorescent probe;

[0073] The sequence of the padlock probe is shown in SEQ ID NO. 1, the sequence of the primer is shown in SEQ ID NO. 2, the sequence of the crRNA is shown in SEQ ID NO. 3, and the sequence of the MecA gene fragment is shown in SEQ ID NO. 4.

[0074] In specific implementation, the specific amount of each component in the kit is referred to the content described in the first point above.

[0075] Although the embodiments of the present application have been shown and described above, it should be understood that the above-described embodiments are exemplary and should not be construed as limiting the present application, and those of ordinary skill in the art can make changes, modifications, replacements and variations to the above-described embodiments without departing from the principles and purposes of the present application within the scope of the present application.

Claims

1. A method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification, characterized in that, The method described is used to detect methicillin-resistant Staphylococcus aureus (MRSA) in food samples. The specific steps are as follows: A circular DNA template is synthesized in a circularization reaction system; the circularization reaction system includes a padlock probe, a target gene, 1×Splint R Buffer, Splint R ligase, and water, wherein the sequence of the padlock probe is as follows: P-TGATCCCAATTATACCACGTTTGGGCGTGTTAACCCACGCCGAATAATGAATGACGCTA; The circular DNA template was incubated with DNA polymerase, dNTPs, recombinant albumin, primers, and polymerase reaction buffer, and then the reaction was terminated by heat treatment to obtain the RCA amplification product; the sequence of the primers is: TTAACACGCCCAAACGTGGTA; The pre-assembled Cas12a-crRNA, RCA amplification product, and FRET fluorescent probe were added to a buffer solution and incubated to generate a detectable ratio fluorescence signal change, thus obtaining the sample solution to be tested; the sequence of the crRNA is UAAUUUCUACUAAGUGUAGAUGGCGUGUUAACCCACGCCGAAU. Fluorescence signals are measured to determine the presence of MRSA or the content of its MecA gene in food samples; the measurement involves detecting fluorescence intensity at 528 nm and 571 nm and calculating their ratio.

2. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 1, characterized in that: The circular DNA template is prepared by mixing a padlock probe with the genomic DNA of methicillin-resistant Staphylococcus aureus, annealing, incubating with DNA ligase in a ligase reaction buffer system, and then terminating the reaction by heat treatment to obtain a circular DNA template.

3. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 2, characterized in that: The process parameters for preparing the circular DNA template are as follows: annealing conditions: 95°C, 5 min, slowly reduced to room temperature at 0.1°C / s and held for 5 min, then stored at 4°C; incubation conditions: 25°C, 10–120 min; heat treatment conditions: 65°C, 10 min.

4. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 1, characterized in that: The process parameters for preparing the RCA amplification product are as follows: incubation conditions: incubation at 30°C for 0.5 to 6 hours; heat treatment conditions: 65°C for 10 minutes.

5. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 4, characterized in that: The volume ratio of the circular DNA template to DNA polymerase, dNTPs, recombinant albumin, DNA primers, and polymerase reaction buffer is 5:3 to 15:3:1:1:

2.

6. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 1, characterized in that: The conditions for incubating the pre-assembled Cas12a-crRNA, RCA amplification product, and FRET fluorescent probe in the buffer solution are as follows: incubation at 37°C for 10–180 min.

7. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 6, characterized in that: The concentration ratio of Cas12a to crRNA is 20–100 nM: 100 nM.

8. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 7, characterized in that: The sequence of the FRET fluorescent probe is: 6-FAM-TTTTTT-CY3.

9. The method for detecting methicillin-resistant Staphylococcus aureus based on CRISPR and rolling circle amplification according to claim 1, characterized in that: The fluorescence signal was measured by adding 80 μL of enzyme-free water to the sample solution, exciting it with light at a wavelength of 475 nm, and measuring the changes in ratio fluorescence signal at 528 nm and 571 nm.

10. A kit for detecting methicillin-resistant Staphylococcus aureus, characterized in that: The method for implementing the CRISPR-based and rolling circle amplification-based detection method for methicillin-resistant Staphylococcus aureus as described in any one of claims 1-9 includes a padlock probe, methicillin-resistant Staphylococcus aureus genomic DNA, Splint R ligase, dNTPs, recombinant albumin, primers, phi29 DNA polymerase, Cas12a-crRNA, and FRET fluorescent probe.

Citation Information

Patent Citations

  • PSA detection method based on CRISPR / Cas12a and hybrid chain amplification reaction

    CN114990195A

  • Kit for detecting methicillin-resistant staphylococcus aureus

    CN116769944A