A molecular marker related to peanut protein content and related applications
By identifying gene mutations on peanut chromosome 1 and providing the molecular marker Chro1-KH and its primers, the problem of controlling peanut protein content was solved, and efficient judgment of high- and low-protein peanuts was achieved, thereby improving peanut breeding efficiency.
Patent Information
- Application Number
- CN202410866880.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-01
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-07-01
AI Technical Summary
In the existing technology, the main effect gene controlling the peanut protein content has not been discovered, and the research on related regulatory mechanisms is relatively lagging, resulting in low efficiency of genetic analysis of peanut protein content and affecting peanut breeding efficiency.
A molecular marker Chro1-KH and its primers are provided to identify the gene mutation at 95485614bp to 95490150bp on peanut chromosome 1 through PCR amplification and genotype analysis. The forward primer ACTTCTTTTCATAGGCCCAGCTC and the reverse primer ACTAGTGGAGCCATATTGACGGTG are used to detect the peanut protein content, thereby achieving efficient judgment of high-protein and low-protein peanuts.
The efficiency of judging the protein content of peanuts has been improved, and the efficiency of peanut breeding has been improved. The variation interpretation rate of the molecular marker Chro1-KH is as high as 95.20%, which can accurately distinguish between high-protein and low-protein peanuts.
Smart Images

Figure CN118773362B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a molecular marker related to peanut protein content and related applications. BACKGROUND
[0002] Peanut is an important oil crop and economic crop in the world, and plays an important role in ensuring grain and oil safety and food safety. The nutritional value of peanut protein is not much different from that of animal protein, and is similar to that of meat, milk, eggs and other foods, which is higher than that of grain crops. Peanut protein contains 8 kinds of essential amino acids for the human body, and is also rich in arginine, glutamic acid and asparagine, which is beneficial to regulating blood sugar, protecting the liver, and has a good effect on brain cell development and memory enhancement. Moreover, the peanut protein content is higher than that of other nuts (peanut 24-27%, cashew 15%, walnut 15%). Peanut is mainly used for baking, frying, boiling, or used as raw material to make peanut candy, protein powder, and peanut beverage, etc., and is called "plant meat". It is also an important food in space travel. With the continuous improvement of people's living standards, the proportion of edible peanuts is gradually increasing, so it is of great significance to strengthen the research on edible peanuts, especially high-protein peanuts.
[0003] In the current genetic research on peanut protein, the existing technology analyzes the peanut protein population and concludes that the genetic effect of peanut protein content is mainly additive; another study suggests that both additive and non-additive genetic effects affect peanut quality, and concludes that protein content is significantly affected by the environment; related technical personnel constructed a spatial prediction model of peanut protein content based on 9 ecological factors affecting peanut protein, and the results showed that the protein content in peanuts in the northern hemisphere increases from high latitude to low latitude, which also proves that the protein content of peanuts is greatly affected by environmental factors; another study shows that through population analysis, protein genes have no major gene effect and are controlled by multiple genes with small effects, and the interaction between different varieties and different environments is different, and the maturity of peanuts has a greater impact on protein. The existing technical personnel used GeneFishing technology to induce mutation treatment of Huayu 22 seeds, and through RT-PCR verification, 3 genes related to protein synthesis were obtained. Further analysis of the transcriptome of peanut protein mutant grains at different development stages obtained 2936, 3329 and 2849 differentially expressed genes, and 15 candidate genes related to protein synthesis were screened from them. However, the major gene controlling peanut protein content has not been discovered, and the related regulatory mechanism research is relatively lagging behind. SUMMARY
[0004] In view of this, the present invention provides an efficient selection tool for breeding new high-protein peanut varieties. The molecular markers related to peanut protein content provided by the present invention can effectively improve the efficiency of judging peanut protein content and improve peanut breeding efficiency.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides a molecular marker Chro1-KH related to peanut protein content. The nucleotide sequence of the forward primer of the molecular marker Chro1-KH is shown in SEQ ID No. 1: ACTTCTTTTCATAGGCCCAGCTC, and the nucleotide sequence of the reverse primer is shown in SEQ ID No. 2: ACTAGTGGAGCCATATTGACGGTG.
[0007] In the present invention, the molecular marker is located at 95,485,614bp to 95,490,150bp on peanut chromosome 1. Analysis of the mutated sequence revealed that the gene is located on its complementary strand, with an A in the low-protein group and a T in the high-protein group. The protein encoded by the KH domain-containing protein gene has a mutation at amino acid position 410 to isoleucine in high-protein peanuts, while in low-protein peanuts, the amino acid at position 410 is lysine.
[0008] The present invention also provides a kit for detecting peanut protein content, which comprises the forward primer and reverse primer of the molecular marker Chro1-KH according to claim 1.
[0009] The present invention also provides the use of the molecular marker Chro1-KH and / or the kit in determining the content of peanut protein.
[0010] The present invention also provides a method for detecting the content of peanut protein, which comprises the following steps:
[0011] 1) using the extracted peanut DNA as a template, performing PCR amplification using the primers for the molecular marker Chro1-KH according to claim 1 to obtain a PCR product;
[0012] 2) When the PCR product amplified in step 1) is cloned and the 1229th base position of the CDS sequence of the class 1 KH RNA binding domain is T, the peanut being tested is a high-protein peanut;
[0013] When the PCR product amplified in step 1) is cloned and the 1229th base position of the CDS sequence of the class 1 KH RNA binding domain is A, the peanut being tested is a low-protein peanut.
[0014] In the present invention, the reaction conditions for the PCR amplification step are: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 30 seconds, 65°C annealing for 30 seconds, 72°C extension for 60 seconds, 14 cycles; 95°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 60 seconds, 35 cycles; 72°C extension for 2.5 minutes. In the present invention, the PCR amplification system includes: per 25 μL, 1.0 μL of 10 μM forward primer, 1.0 μL of 10 μM reverse primer, 1.0 μL of 0.5-1.0 ng / μL peanut DNA, 12.5 μL of 2×Taq Master MassterMix, and 9.5 μL of ddH2O.
[0015] The present invention also provides the use of the molecular marker Chro1-KH and / or the kit in cultivating high-protein peanut seeds. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The frequency distribution of protein content in single peanut kernels in the F2 population;
[0017] Figure 2 This is the chromosome-wide distribution map of ED2 values corresponding to peanut protein SNP sites based on BSA-Seq analysis;
[0018] Figure 3 This is an alignment of DNA sequences of some F2 individuals amplified by primer pair Chro1KH;
[0019] The arrows in the figure indicate differential bases, where D represents low protein and G represents high protein;
[0020] Figure 4 This is the amino acid sequence alignment diagram deduced from high- and low-protein F2 individuals;
[0021] In the figure, D represents low protein, G represents high protein, red represents consistent amino acid comparison, and blue represents amino acid mutation sites; the gene function annotation results are shown in Table 4;
[0022] Figure 5 Signal peptide prediction. DETAILED DESCRIPTION
[0023] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0024] Example 1
[0025] The test utilizes the line selection material C--Za--454-2 (Lu Hua 12 variant) and Fu Hua 19 to cross, to obtain a F2 population, and to detect the quality of the harvested F2 population by using a near-infrared instrument, to scan each single peanut three times, to detect the quality of the F2 single peanut, and to determine the protein content in the range of 15% to 34% (0.000064) ). Figure 1 The K-S test shows that the significant test value (sig. value) is 0.228>0.05, and the normal distribution is met; the chi-square fitness test is performed by taking 26% as the high-protein standard, and the protein trait segregation ratio is 3:1 (Table 1).
[0026] Table 1 Genetic rule analysis of the population
[0027]
[0028]
[0029] The harvested seeds are detected by near-infrared single detection, and 30 high-protein (near-infrared quality detection content≥29%) and low-protein (near-infrared quality detection≤23%) single seeds are selected to construct a BSA-Seq mixed pool. Based on the ED method, BSA analysis is performed, Manhattan plots are drawn, and peaks above the threshold line are obtained on chromosomes 1, 19 and 16, and the peak on chromosome 1 is the highest.
[0030] Based on the non-synonymous mutant SNP sites and annotation information screened on chromosome 1, software is used to design primers on the upstream and downstream 150bp-400bp of the marker. The primer design requirements are that the TM value of the primer is adjusted to 55°C-65°C, the GC content is 40%-60%, the GC content of the left and right primers does not exceed 60%, the last base at the 3' end is set to G / C, and a total of 34 pairs of PCR primers are designed for the specific site, of which 7 pairs of primers can amplify clear single bands, and the genotype information obtained by amplifying Chro1-KH by the primers and the descriptive statistics are shown in Tables 2 and 3.
[0031] Table 2 F2 generation individual protein content and genotype (primer pair Chro1-KH) information statistical table
[0032] Seed size Protein content (%) Genotype (Chro1-KH marker) D1 23.07 TT D2 24.34 TT D3 22.31 TT D4 24.53 TT D5 25.12 TT D6 21.00 - G1 35.57 AA G2 37.04 AA G3 32.98 AA G4 35.80 AA G5 36.86 AA G6 35.66 AA
[0033] Table 3 F2 individual information table for single marker analysis t test
[0034]
[0035] For single marker analysis, genotypes were counted based on sequencing results and grouped according to genotype. An independent sample t-test was performed on the protein content data. The results showed that only one primer pair (primers for the molecular marker Chro1-KH) showed highly significant differences in protein content between F2 individuals of different genotypes (t=14.6581, df=9, P=0.0000<0.01) by t-test. Investigation revealed clear differences in protein content among F2 individuals grouped by genotype, with one group characterized by high protein and the other by low protein. This marker explained 95.20% of the phenotypic variation. Figure 3 Figure 3 shows the sequence alignment results of some F2 individuals amplified by primer pair Chro1-13. The arrow positions of high-protein individuals are all A, and the arrow positions of low-protein individuals are all T.
[0036] Analysis of the mutated sequence revealed that the gene was on its complementary chain, and at this position (base 1229 of the CDS sequence) the low-protein group had an A and the high-protein group had a T, resulting in a mutation from lysine (Lys / K) to isoleucine (Ile / I) (amino acid 410 of the protein). Figure 4 The Khomology (KH) RNA-binding domain, type I, is located at amino acid positions 362 to 428 of the protein sequence. It is speculated that the mutation at amino acid position 410 in this study affected RNA binding.
[0037] Table 4 Functional annotation of genes where markers are located
[0038]
[0039] The protein encoded by the high protein sequence KH domain-containing protein was predicted. The results showed that the gene is composed of 484 amino acids, with a molecular weight of 51068.47Da and a molecular formula of C 2235 H 3621 N 619 O 730 S7, with an estimated half-life of 30 h, a protein isoelectric point of 5.42, and an instability index of 22.31, is a stable protein.
[0040] The results of the high-protein gene analysis using Signal P 3.1 software showed that the maximum C value in the amino acid sequence was 29, the Y value was 35, and the S value was 7. However, the sequence had no signal peptide signal and no transmembrane region, and was predicted not to be a secretory protein.
[0041] Example 2
[0042] The population verification was expanded, with a total of 40 samples, including existing varieties and self-bred lines for verification. Single-grain near-infrared instrument detection was used, and single marker analysis was performed using primers of the molecular marker Chro1-KH. Sequence analysis showed that at the 1229th base site of the CDS sequence of the type 1 KH RNA-binding domain (Khomology (KH) RNA-binding domain, type I), the base at the 1229th base site was T in seeds with a protein content above 29%, and the base at the site with a protein content below 23% was A.
[0043] Table 5 Sample verification results
[0044]
[0045]
[0046] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A method for detecting peanut protein content, characterized in that: The detection method comprises the following steps: 1) Using the extracted peanut DNA as a template, PCR amplification was performed using primers for the molecular marker Chro1-KH to obtain a PCR product; 2) When the PCR product amplified in step 1) is cloned and the 1229th base position of the CDS sequence of the class 1 KH RNA binding domain is T, the peanut being tested is a high-protein peanut; When the PCR product amplified in step 1) is cloned and the 1229th base position of the CDS sequence of the class 1 KH RNA binding domain is A, the peanut being tested is a low-protein peanut; The nucleotide sequence of the forward primer of the molecular marker Chro1-KH is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer is shown in SEQ ID No.
2.
2. The detection method according to claim 1, characterized in that The reaction conditions for PCR amplification in the step are: pre-denaturation at 95°C for 3 min; 14 cycles of denaturation at 95°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 60 s; 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s; and extension at 72°C for 2.5 min.
3. The detection method according to claim 1, wherein The PCR amplification system includes: 1.0 µL of 10 µM forward primer, 1.0 µL of 10 µM reverse primer, 1.0 µL of 0.5-1.0 ng / µL peanut DNA, 12.5 µL of 2×TaqMaster MassterMix, and 9.5 µL of ddH2O per 25 µL.