Application of Rht1-D1b protein in regulation and control of tillering angle of wheat

Abstract

The invention discloses application of wheat Rht1-D1b protein in regulation and control of a wheat tillering angle, and belongs to the technical field of biological breeding. The technical problem to be solved by the invention is how to increase the tillering angle of plants. Therefore, the invention provides the application of the protein or a substance for regulating and controlling the expression of a protein coding gene or a substance for regulating and controlling the activity or content of the protein in regulating and controlling the tillering angle of the plant, wherein the protein can be Rht1-D1b protein; the Rht1-D1b protein can be a protein of which the amino acid sequence is as shown in SEQ ID No. 3. According to the application, the Rht1-D1b gene is finally localized through gene localization and map-based cloning. The gene significantly increases the tillering angle of wheat. The wheat gene Rht1-D1b can be widely applied to the plant fields of wheat germplasm resource improvement, wheat plant type genetic breeding and the like, and has an important application value for improving the wheat yield.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological breeding, and particularly relates to application of Rht1-D1b protein in regulating tilling angle of wheat. BACKGROUND

[0002] Wheat is one of the most important food crops in the world. To ensure China's food security, cultivating high-yield and stable-yield wheat varieties is the top priority in wheat breeding. Wheat plant type has an important influence on yield, and tilling angle is one of the key agronomic traits that determine wheat plant type, which can affect wheat group photosynthesis and ventilation and light transmission, and thus affect wheat yield and stress resistance. Therefore, analysis of the molecular mechanism of wheat tilling angle regulation is of great significance for plant type improvement and yield increase, and is also an important way to cultivate high-yield and stable-yield wheat new varieties.

[0003] Plant architecture is a key agronomic trait for wheat yield. During the Green Revolution in the 1960s, the introduction of gibberellin (GA) insensitive reduced plant height genes Rht-B1b and Rht-D1b significantly improved wheat yield. They encode a truncated DELLA protein, which significantly improves the lodging resistance and harvest index of wheat. Tilling angle is one of the most critical components of crop architecture, which can improve crop population yield by affecting planting density. In practice, extremely prostrate or extremely compact plant architecture is not conducive to wheat yield. Loose plants, although they can avoid some diseases caused by excessive humidity, occupy too much space and reduce crop yield per unit area; compact plants have low light acquisition efficiency and are more susceptible to diseases and pests, therefore, appropriate tilling angle is crucial for high-density planting to maximize wheat population yield. However, due to the large size of its genome and high repetitive sequences, it is still a difficult task to clone QTL in wheat, and there are few QTL cloned and functionally identified in wheat. SUMMARY

[0004] The technical problem to be solved by the present application is how to increase the tilling angle of plants.

[0005] To solve the above technical problems, the present application provides the application of a protein or a substance for regulating the expression of a gene encoding the protein or a substance for regulating the activity or content of the protein in any of the following, wherein the protein can be Rht1-D1b protein.

[0006] A1), application in regulating tilling angle of plants;

[0007] A2), application in preparing a product for regulating tilling angle of plants;

[0008] A3), application in plant breeding or plant assisted breeding;

[0009] A4) Use in the preparation of products for plant breeding or plant-assisted breeding;

[0010] The Rht1-D1b protein may be any of the following proteins:

[0011] a1) The amino acid sequence is the protein shown in SEQ ID No. 3;

[0012] a2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) and having more than 80% identity with the amino acid sequence shown in a1) and related to plant tillering angle;

[0013] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0014] Furthermore, in the application, the plant breeding index may include tillering angle.

[0015] Furthermore, in the application, the purpose of plant breeding may include cultivating plants with increased (appropriately increased) tillering angles.

[0016] Furthermore, in the application, the regulation may be improvement, promotion or upregulation.

[0017] Furthermore, in the application, the regulation may also be reduction, inhibition or down-regulation.

[0018] Furthermore, in the application, the protein may be derived from wheat.

[0019] In the present application, SEQ ID No. 3 consists of 559 amino acid residues.

[0020] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0021] a3) The connection may be via a peptide bond.

[0022] A protein tag is a polypeptide or protein that is fused with a target protein using in vitro DNA recombination techniques to facilitate expression, detection, tracing, and / or purification of the target protein. Examples of protein tags include Flag, His, MBP, HA, myc, GST, and / or SUMO tags.

[0023] Furthermore, in the application, the substance that regulates the expression of the protein encoding gene or the substance that regulates the activity or content of the protein may be a biological material, and the biological material may be any of the following:

[0024] B1), a nucleic acid molecule encoding the above-mentioned Rht1-B1b protein;

[0025] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0026] B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0027] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0028] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0029] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0030] B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2) or a transgenic plant organ containing the recombinant vector described in B3).

[0031] Furthermore, in the application, the expression cassette described in B2) refers to a DNA capable of expressing the Rht1-B1b protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the Rht1-B1b protein encoding gene, but also a terminator and / or enhancer sequence for terminating transcription of the Rht1-B1b protein encoding gene.

[0032] In some embodiments of the present application, the recombinant vector described in B3) may be a PC186-Rht-D1b plasmid, which can express the Rht1-D1b protein having an amino acid sequence of SEQ ID No. 3.

[0033] Furthermore, in the application, the recombinant microorganism in B4) can specifically be yeast, bacteria, algae and fungi.

[0034] Furthermore, in the application, the plant tissue in B6) can be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0035] Furthermore, in the application, the transgenic plant organ in B7) can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0036] Furthermore, in the above application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ may or may not include propagation materials.

[0037] Furthermore, in the application, the nucleic acid molecule in B1) may be a DNA molecule as described in any one of g1) to g3) below:

[0038] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0039] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0040] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the tillering angle of the plant.

[0041] Furthermore, in the application, the plant can be selected from monocotyledonous plants.

[0042] Furthermore, in the application, the monocotyledonous plant can be selected from the grass family.

[0043] Furthermore, in the application, the grass plant can be selected from the genus Triticum.

[0044] Furthermore, in the application, the Triticum plant can be selected from wheat (Triticum aestivum L.).

[0045] Furthermore, in the above application, regulating the plant tillering angle may be increasing the plant tillering angle.

[0046] The present application also provides a method for increasing the tillering angle of a plant, which may include introducing a nucleic acid molecule encoding the above-mentioned Rht1-B1b protein into a recipient plant to increase the tillering angle of the plant.

[0047] Furthermore, in the method described above, the nucleic acid molecule may be a DNA molecule described in any one of g1) to g3) below:

[0048] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0049] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0050] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the tillering angle of the plant.

[0051] Furthermore, in the method, the plant can be selected from monocotyledonous plants.

[0052] Furthermore, in the method, the monocotyledonous plant can be selected from the grass family.

[0053] Furthermore, in the method described above, the grass plant can be selected from the genus Triticum.

[0054] Furthermore, in the method described above, the Triticum plant can be selected from wheat (Triticum aestivum L.).

[0055] The present application also provides a method for obtaining target wheat with increased tillering angle, which may include introducing a nucleic acid molecule encoding the above-mentioned Rht1-B1b protein into a recipient wheat to obtain target wheat with increased tillering angle.

[0056] Furthermore, in the method described above, the nucleic acid molecule may be a DNA molecule described in any one of g1) to g3) below:

[0057] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0058] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0059] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the tillering angle of the plant.

[0060] In some embodiments of the present application, the nucleic acid molecule is introduced into the recipient plant in the form of a recombinant expression vector.

[0061] In some embodiments of the present application, the recombinant expression vector may be a PC186-Rht-D1b plasmid, which can express the Rht1-D1b protein with an amino acid sequence of SEQ ID No. 3.

[0062] The present application also provides the above-mentioned protein and / or the biological material.

[0063] In the present application, the identity refers to the identity of the amino acid sequence or the nucleotide sequence. The identity of the amino acid sequence (or the nucleotide sequence) can be determined using the homology search site on the Internet, such as the BLAST webpage of the NCBI homepage website. For example, the identity of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and performing a search in Advanced BLAST 2.1, and then the value of the identity (%) can be obtained.

[0064] The above-mentioned 80% or more identity can be 80%, 85%, 90% or 95% or more identity.

[0065] The above-mentioned 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above-mentioned 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above-mentioned 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above-mentioned 95% or more identity can be at least 95%, 96%, 97%, 98% or 99% identity.

[0066] The beneficial technical effects obtained by the present application are as follows:

[0067] The present application is finally located to the Rht1-D1b gene through gene mapping and map-based cloning. The gene significantly increases the tiller angle. The wheat gene Rht1-D1b can be widely applied in the fields of wheat germplasm improvement and wheat plant type genetic breeding, and has important application value for improving the yield of wheat. BRIEF DESCRIPTION OF DRAWINGS

[0068] Figure 1 To clone the Rht1-D1b gene and verify its new function of regulating the tiller angle of wheat. DETAILED DESCRIPTION

[0069] The present application is further described in detail below in conjunction with specific embodiments. The examples provided are only for the purpose of illustrating the present application and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvements by those skilled in the art and do not in any way limit the present application.

[0070] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0071] The competent DH5α in the following examples: MAX DH5α (Weidi Biotechnology, WD0462947);

[0072] The competent EHA105 in the following examples: EHA105 (Weidi Biotechnology, WD0453243);

[0073] pBM27 / 10×Topo smart in the following examples: pBM27 Vector (BioMed Biotech, 775969AH);

[0074] Green Taq Mix in the following examples: Green Taq Mix (Vazyme, 037E3210CA);

[0075] KOD FX / KOD FX Buffer / dNTPs in the following examples: KOD FX (TOYOBO, 2406054);

[0076] LR Enzyme Mix / Proteinase K in the following examples: Gateway TM LR Clonase TM II (Invitrogen, 2755278);

[0077] The PC186 vector used in the following examples was kindly donated by Professor Fu Daolin of Shandong Agricultural University and is disclosed in the document "Isochorismate-based salicylic acid biosynthesis confers basal resistance to Fusarium graminearumin barley." The public can obtain the relevant biomaterial from the applicant. The obtained biomaterial can only be used for verification of the examples of this application and cannot be used for other purposes.

[0078] The wheat material Kenong 199 (abbreviated as KN199) in the following examples was kindly donated by Researcher Li Junming of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The approval number of Kenong 199 wheat is Guoshenmai 2006017.

[0079] The WLS-AS medium formulation in the following examples is as follows: 1 / 100 volume 10×LS major salts, 1 / 1000 volume 100×FeEDTA, 1 / 1000 volume 100×LS trace salts, 1 / 1000 volume 100×MS vitamins, 8 g / L agarose, 10 mg / L glucose, 0.5 g / L MES, 0.85 mg / L AgNO₃, 100 μM AS, 1.25 mg / L CuSO₄·5H₂O, and the remainder water.

[0080] The WLS-Res medium in the following examples has the following formula: 1 / 10 volume 10× LS major salts, 1 / 100 volume 100× FeEDTA, 1 / 10 volume 100× LS trace salts, 0.5 mg / L 2,4-D, 1 / 100 volume 100× MS vitamins, 2.2 mg / L picloram, 0.75 g / L MgCl2·6H2O, 0.5 g / L glutamine, 0.1 g / L casein hydrolysate, 40 g / L maltose, 1.95 g / L MES, 5 g / L agarose, 250 mg / L carbenicillin, 100 mg / L ascorbic acid, 0.85 mg / L AgNO3, 100 mg / L cefotaxime, and the remainder is water.

[0081] The WLS-P5 medium formulation in the following examples is as follows: 1 / 10 volume 10×LS major salts, 1 / 100 volume 100×FeEDTA, 0.5 mg / L 2,4-D, 1 / 10 volume 100×LS trace salts, 1 / 100 volume 100×MS vitamins, 2.2 mg / L picloram, 0.1 g / L casein hydrolysate, 0.5 g / L glutamine, 0.75 g / L MgCl2·6H2O, 5 g / L agarose, 40 g / L maltose, 1.95 g / L MES, 100 mg / L ascorbic acid, 250 mg / L carbenicillin, 5 mg / L glufosinate, 0.85 mg / L AgNO3, and the remainder water.

[0082] The LSZ-P5 medium formula in the following examples is as follows: 1 / 10 volume of 10x LS major salts, 1 / 100 volume of 100x FeEDTA, 1 / 100 volume of 100x LS trace salts, 20 g / L sucrose, 1 / 100 volume of 100x modified LS vitamins, 5 mg / L zeatin, 0.5 g / L MES, 2.5 mg / L CuSO4·5H2O, 250 mg / L carbenicillin, 8 g / L agar, 100 mg / L cefotaxime, 5 mg / L phosphinothricin, and the rest is water.

[0083] The LSF-P5 medium formula in the following examples is as follows: 1 / 10 volume of 10x LS major salts, 1 / 100 volume of 100x FeEDTA, 1 / 100 volume of 100x LS trace salts, 0.5 g / L MES, 1 / 100 volume of 100x modified LS vitamins, 15 g / L sucrose, 3 g / L Gelrite, 0.2 mg / L IBA, 250 mg / L carbenicillin, 5 mg / L phosphinothricin, and the rest is water.

[0084] The antibiotics in the following examples are used at the commonly used working concentrations, and no special instructions are given. Kanamycin is 50 μg / mL; rifampicin is 40 μg / mL; spectinomycin is 100 μg / mL.

[0085] The quantitative test in the following examples is set up in triplicate, and the results are averaged.

[0086] The data in the following examples are processed using GraphPad Prism statistical software, and the experimental results are expressed as mean ± standard deviation. The t-test is used, and P<0.01 (**) indicates a very significant difference.

[0087] Example 1. QTL positioning and cloning of a gene related to the tillering angle of wheat

[0088] Dwarf resistant 58 (also referred to as AK58) is a widely cultivated allohexaploid wheat variety, and has been a major parent in Chinese wheat breeding due to its high yield and strong adaptability to environmental conditions. Dwarf resistant 58 not only exhibits a reduction in plant height, but also exhibits a loose plant structure at the adult stage and a significantly larger tillering angle than Doumai (also referred to as Doumai) Figure 1(A and B in the middle). To explore the tiller angle regulatory genes of Aikang 58, we used a high-generation RIL population (F9) derived from Aikang 58 and bean wheat. The RIL populations were planted in Beijing and Tai'an, respectively, and the tiller angles at the adult stage were measured. The segregation of tiller angles in the RIL populations was normally distributed under different growth conditions. We also obtained the genotype data of the RIL population by using a 55K SNP gene chip. We combined the phenotypic and genotypic data to locate a stable QTL on wheat chromosome 4D, named qTta-4D ( Figure 1 C). qTta-4D can explain 13.4% of the total phenotypic variation of tiller angle (Table 1). qTta-4D is mainly distributed in the region between two molecular markers M1 and M2 on chromosome 4D ( Figure 1 Using the remaining heterozygotes, we fine-mapped qTta-4D to a 0.52 Mb region between markers M16 and M17, which contains three candidate genes, TraesCS4D02G040200, TraesCS4D02G040300, and the “Green Revolution” gene Rht-D1 ( Figure 1 Sequence analysis showed that Rht-D1 had a single base substitution from GAG in soybean to TAG (stop codon) in dwarf anti-58 ( Figure 1 E), has the same mutation as the classic "Green Revolution" gene allele Rht-D1b, which results in translational restart at the ATG codon following the stop codon and produces an N-terminally truncated protein ( Figure 1 F). The resulting coding strand genomic sequence of the Rht-D1b gene (5'-3', including 2000 bp upstream of the ATG and 1000 bp downstream of the stop codon) is SEQ ID No. 1. The coding sequence of the coding strand of the Rht-D1b gene is SEQ ID No. 2, encoding the Rht-D1b protein. The amino acid residue sequence of the Rht-D1b protein is SEQ ID No. 3.

[0089] Example 2: Preparation of Rht1-D1b-OE overexpressing plants and functional verification of Rht1-D1b protein

[0090] To further verify the role of Rht-D1b in controlling wheat tiller angle, we overexpressed Rht1-D1b in the KN199 background. Phenotypic observation and statistical analysis showed that Rht1-D1b-OE plants had larger tiller angles and lower plant heights compared with wild type plants ( Figure 1 These results indicate that the G-to-T transition in the Rht1-D1b allele is responsible for the increased tillering angle in Aikang 58.

[0091] 2.1 Construction of overexpression vector

[0092] The full-length coding sequence of Rht-D1b was amplified using the genomic DNA of the wheat variety Chinese Spring as a template using primers Rht-D1F and Rht-D1R.

[0093] The reaction system consisted of 1 μL of KOD FX, 25 μL of KOD FX Buffer, 10 μL of dNTPs, 1 μL of Chinese Spring genomic DNA, 1.5 μL of Rht-D1F, and 1.5 μL of Rht-D1R. HO was added to a total volume of 50 μL. The reaction conditions were: initial denaturation at 94°C for 2 minutes, followed by 30 cycles of denaturation at 98°C for 10 seconds, 60°C for 30 seconds, and 68°C for 2 minutes, followed by extension at 60°C for 5 minutes. The PCR product was harvested and used in the next step. The nucleotide sequences of primers Rht-D1F and Rht-D1R are as follows (5'-3'):

[0094] Rht-D1F: ACCGAGGCAAGCAAAAGCTTC;

[0095] Rht-D1R:AACTTGAGGTAGGGGCAGGA.

[0096] The PCR product was diluted 200-fold and used as a template to amplify the full-length Rht-D1b coding sequence with adapters using primers Rht-D1b-p27F and Rht-D1b-p27R. The reaction system consisted of 1 μL of KOD FX, 25 μL of KOD FX buffer, 10 μL of dNTPs, 1 μL of Chinese Spring genomic DNA, 1.5 μL of Rht-D1F, and 1.5 μL of Rht-D1R. HO was added to a total volume of 50 μL. The reaction conditions were: initial denaturation at 94°C for 2 minutes, followed by 30 cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 30 seconds, and extension at 68°C for 2 minutes, followed by extension at 68°C for 5 minutes. The PCR product was harvested and used in the next step. The nucleotide sequences of primers Rht-D1b-p27F and Rht-D1b-p27R are as follows (5'-3'):

[0097] Rht-D1b-p27F: CACCATGGCCATGGGGATGGGCGG;

[0098] Rht-D1b-p27R: TCACGGCCCGGCCAGGCCGCC.

[0099] PCR products were gel-recovered using a kit. Ligate the recovered product into the pBM27 vector. The ligation reaction system consisted of: 1 μL of pBM27 vector, 1 μL of 10× Topo smart, 1 μL of recovered product (100 ng / μL), and HO to a total volume of 10 μL. The reaction was performed at 25°C for 15 minutes. The ligated product was harvested and transformed into E. coli DH5α.

[0100] Transformation method: Add the entire ligation product to competent E. coli DH5α, gently pipette to mix, and incubate on ice for 30 minutes. After the ice incubation, heat shock the cells at 42°C for 45 seconds, then quickly transfer to ice and incubate again for 3 minutes. Add 600 μL of antibiotic-free LB liquid medium and incubate on a shaker at 37°C for 40 minutes. Then, spread the plate onto LB solid medium supplemented with spectinomycin and incubate at 37°C for 10 hours.

[0101] Monoclonal colonies were screened using the common primers M13-F and M13-R by PCR amplification. The reaction system consisted of 7.5 μL of Green Taq Mix, 0.6 μL of M13-F, and 0.6 μL of M13-R, with HO added to a total volume of 15 μL. The reaction conditions were: 95°C denaturation for 2 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 2 minutes, followed by extension at 72°C for 5 minutes.

[0102] The nucleotide sequences of primers M13-F and M13-R are as follows (5'-3'):

[0103] M13-F: GTTGTAAAACGACGGCCAG;

[0104] M13-R: CAGGAAACAGCTATGAC.

[0105] Positive monoclonal colonies were selected for sequencing. After sequencing, monoclonal colonies with sequences consistent with the reference sequence were screened for plasmid extraction. Rht-D1b was then cloned into the PC186 vector using the Gateway system. The reaction system consisted of 2 μL of LR Enzyme Mix, 2 μL of pBM27-Rht-D1b, and 2 μL of the PC186 vector. HO was added to a total volume of 10 μL. The reaction was performed at 25°C for 1 hour.

[0106] After the reaction is complete, add 1 μL of Proteinase K and incubate at 37°C for 10 minutes. Harvest the ligation product and transform it into E. coli DH5α. The transformation method is as follows: add the entire ligation product to competent E. coli DH5α, gently pipette to mix, and incubate on ice for 30 minutes. After the ice incubation, heat shock the culture at 42°C for 45 seconds, then quickly transfer to ice and incubate again for 3 minutes. Add 600 μL of antibiotic-free LB liquid medium and incubate at 37°C in a shaker for 40 minutes. Then, spread the plate onto LB solid medium supplemented with kanamycin and incubate at 37°C for 10 hours.

[0107] Monoclonal colonies were screened using primers PC186-F and Rht-D1-186R by PCR amplification. The reaction system consisted of 7.5 μL of Green Taq Mix, 0.6 μL of PC186-F, and 0.6 μL of Rht-D1-186R, with HO added to a total volume of 15 μL. The reaction conditions were: 95°C pre-denaturation for 2 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, followed by extension at 72°C for 5 minutes. Positive monoclonal colonies were selected for sequencing verification, and plasmids were extracted from the confirmed clones for future use. The resulting plasmid was designated PC186-Rht-D1b. The sequence (5'-3') of the PC186-Rht-D1b plasmid is SEQ ID No. 4, wherein positions 2252-3261 of SEQ ID No. 4 are the nucleotide sequence of the Ubi Promoter, positions 3334-5013 are the nucleotide sequence of the Rht-D1b coding sequence (CDS), and positions 5062-5314 are the nucleotide sequence of the Nos Terminator.

[0108] The nucleotide sequences of primers PC186-F and Rht-D1-186R are as follows (5'-3'):

[0109] PC186-F: CTGCCTTCATACGCTATTTATTTGC;

[0110] Rht-D1-186R:GCAGCGCGTAGATGCTGCT.

[0111] 2.2 Preparation of overexpression plants

[0112] The PC186-Rht-D1b plasmid was transformed into EHA105 competent Agrobacterium. The transformation method was as follows: Thaw the EHA105 bacterial suspension on ice, add 1 μL of the PC186-Rht-D1b plasmid (100 ng / μL), and incubate on ice for 10 minutes. The bacterial suspension was then transferred to an ice-chilled electroporation cuvette. The cuvette was quickly transferred to an electroporator with the following parameters: C = 25 μF, PC = 200 ohms, and V = 2400 V. After the electroporation, the cuvette was quickly placed on ice, 1 mL of antibiotic-free LB liquid medium was added, and the cuvette was transferred to an empty competent tube. Incubate at 28°C with shaking for 2 hours. A 50 μL aliquot of the bacterial suspension was spread onto solid LB medium containing kanamycin and rifampicin and incubated for 48 hours. This Agrobacterium was then used for subsequent wheat transformation.

[0113] Wheat genetic transformation method: Select the Kenong 199 wheat variety, obtain immature wheat embryos that are more than 14 days old after flowering, and perform transformation. Use the Agrobacterium strain obtained by previous transformation to transfer the overexpression vector into the immature embryos of wheat. After completing Agrobacterium infection, the embryos are cultured in WLS-AS medium. After two days of culture, the upper and lower embryonic axes of the embryos are excised and transferred to WLS-Res medium. After 5 days of culture, the explants are transferred to WLS-P5 medium and cultured for 14 days. The explants are then divided into two parts and transferred to WLS-P10 medium and cultured for 21 days to induce callus formation. The callus is then transferred to LSZ-P5 medium to induce aerial regeneration, and the regenerated part is transferred to LSF-P5 medium until roots elongate. The transformed wheat plants are planted in a greenhouse, and the positive plants are screened using Bar protein detection paper.

[0114] The positive plants selected were named Rht-D1b-OE1 and Rht-D1b-OE2, and were designated as T0 generation plants. The T0 generation positive plants were self-pollinated for two consecutive generations, and the T2 generation positive plants were selected for trait verification.

[0115] KN199, Rht-D1b-OE1, and Rht-D1b-OE2 were planted in a field, with each material planted in 8 rows, 8 plants per row, 20 cm spacing between plants, and 25 cm spacing between rows. The tillering angles of wheat were measured during the wheat plant growth stage.

[0116] Phenotypic observation and statistical analysis showed that Rht1-D1b-OE plants had larger tiller angles and lower plant heights compared to the wild type ( Figure 1 In Figures G and H, the tiller angles of both Rht1-D1b-OE lines were significantly greater than those of the wild type. These results indicate that increasing the content or activity of the Rht1-D1b protein and / or increasing the expression of the gene encoding the Rht1-D1b protein can increase the tiller angle of wheat.

[0117] Table 1. Results of QTL mapping for wheat tiller angle

[0118]

[0119] Table 2. Partial sequences in the present application

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126] The present application has been described in detail. Those skilled in the art who are familiar with these technologies can implement the present application in a wider range of equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present application, and without unnecessary experiments. Although the present application gives special examples, it should be understood that further improvements can be made to the present application. In summary, according to the principles of the present application, the present application is intended to include any modification, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application.

Claims

1. Use of a protein or a substance that regulates the expression of a gene encoding the protein or a substance that regulates the activity or content of the protein in any of the following items, wherein the protein is Rht1-D1b protein; A1) Application in regulating plant tillering angle; A2) Application in the preparation of products for regulating plant tillering angle; A3) Application in plant breeding or plant-assisted breeding; A4) Use in the preparation of products for plant breeding or plant-assisted breeding; The Rht1-D1b protein is any one of the following proteins: a1) The amino acid sequence is the protein shown in SEQ ID No. 3; a2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) and having more than 80% identity with the amino acid sequence shown in a1) and related to plant tillering angle; a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The use according to claim 1, characterized in that The substance that regulates the expression of the protein-encoding gene or the substance that regulates the activity or content of the protein is a biological material, and the biological material is any one of the following: B1), a nucleic acid molecule encoding the Rht1-D1b protein according to claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2) or a transgenic plant organ containing the recombinant vector described in B3).

3. The use according to claim 2, characterized in that B1) The nucleic acid molecule is a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 1; g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the tillering angle of the plant.

4. The use according to any one of claims 1 to 3, characterized in that The plant is selected from monocotyledonous plants.

5. The use according to claim 4, wherein the monocotyledonous plant is selected from the grass family. The use according to claim 5 , wherein the grass plant is selected from the genus Triticum.

7. The use according to claim 6, wherein the Triticum plant is selected from wheat (Triticum aestivum L.).

8. A method for increasing the tillering angle of a plant, characterized in that: The method comprises introducing a nucleic acid molecule encoding the Rht1-D1b protein of claim 1 into a recipient plant to increase the tillering angle of the recipient plant.

9. The method according to claim 8, characterized in that The nucleic acid molecule is a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 1; g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates the tillering angle of the plant.

10. A method for obtaining wheat with increased tillering angle, characterized in that: The method comprises introducing a nucleic acid molecule encoding the Rht1-D1b protein of claim 1 into a recipient wheat to obtain wheat with an increased tillering angle.

Images