Cellulase mutants and uses thereof

By using directed evolution technology to introduce specific amino acid sequence mutations into cellulase, cellulase mutants are formed, which solves the problem of low catalytic efficiency of neutral cellulase at 50℃, and achieves a significant increase in enzyme activity and a reduction in production costs.

CN118792285BActive Publication Date: 2025-11-28QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411183018.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-26
Publication Date
2025-11-28
Estimated Expiration
2042-08-26

AI Technical Summary

Technical Problem

Existing neutral cellulases have low catalytic efficiency at 50°C, leading to high production costs and increased energy consumption in the textile industry.

Method used

By using directed evolution technology to introduce specific amino acid sequence mutations, such as N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, and D239A, cellulase mutants are formed and recombinantly expressed in Trichoderma reesei to improve the specific activity of the enzyme.

Benefits of technology

At 50℃, the specific activity of the cellulase mutant is significantly increased, reducing enzyme usage, lowering production costs, and improving textile processing efficiency.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering and protein modification, and particularly relates to a cellulase mutant with improved specific activity and application thereof. The cellulase mutant has higher specific activity under the condition of 50 DEG C. Compared with the wild type, the specific activity of the cellulase mutant provided by the present application, which respectively contains N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, D239A single-point mutations, is generally increased by 8.6%-35.7% under the condition of 50 DEG C. Among them, the specific activity of the L78V single-point mutant and the N124Q single-point mutant is increased by 30% and 35.7% respectively, thereby facilitating the wide application of the cellulase in the textile field.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and protein modification, and particularly relates to a cellulase mutant with improved specific activity and application thereof. BACKGROUND

[0002] Cellulase is a complex induced enzyme system composed of multiple hydrolytic enzymes, which refers to a group of enzymes that can degrade cellulose to produce cellobiose and glucose and other small molecules. The decomposition of cellulose by cellulase requires the synergistic action of at least three different enzymes: 1. Endoglucanase, which acts on the non-crystalline region of cellulose and randomly hydrolyzes the β-1, 4-glucosidic bond to produce shorter oligosaccharides with a non-reducing end. 2. Exoglucanase, which acts on the non-reducing end of the cellulose molecule and hydrolyzes the β-1, 4-glucosidic bond to produce cellobiose. 3. β-glucosidase, which hydrolyzes cellobiose to glucose.

[0003] According to the application conditions of cellulase, cellulase is divided into acid cellulase, neutral cellulase and alkaline cellulase.

[0004] Cellulase widely exists in organisms in nature. Nearly 200 kinds of microorganisms can degrade cellulose, including bacteria, actinomycetes and fungi. Cellulase commonly used in industrial production is mostly derived from fungi, such as Aspergillus niger, Trichoderma viride and Trichoderma reesei.

[0005] The industrial application of cellulase is mainly concentrated in the fields of bioenergy, detergent industry, textile finishing and denim washing. In the field of bioenergy, cellulase can completely degrade cellulose through hydrolysis, and the hydrolysis products can be further fermented to produce ethanol, hydrogen and biodiesel, etc. This field requires high-activity acid cellulase. In the detergent industry, alkaline cellulase can be added to detergents to improve washing effect. In the field of textile finishing and denim washing, neutral cellulase has great advantages due to its low reaction temperature, mild reaction conditions, good fabric finishing effect, etc. The finished fabric is fluffy, full, soft, smooth, clear, has good drape and strong moisture absorption, and has certain "silk light" effect. The dosage of cellulase is 0.5%-3%, which can achieve satisfactory finishing effect.

[0006] The neutral cellulase currently used in the textile industry usually has high catalytic efficiency at 50℃. In order to save cost and reduce energy consumption, there is an urgent need for enzyme preparations with good performance and high specific activity at around 50℃. SUMMARY

[0007] Therefore, the present application provides a cellulase mutant. The specific activity of the mutant is significantly improved compared with the wild type, and the mutant can be widely applied in the field of textile processing.

[0008] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions.

[0009] The present application relates to a cellulase mutant, which comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and at least one amino acid substitution at positions 60, 78, 92, 124, 125, 169, 187, 230, and 239 compared with SEQ ID NO: 1.

[0010] In some embodiments of the present application, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity compared with SEQ ID NO: 1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity compared with SEQ ID NO: 1.

[0012] In some embodiments of the present application, the mutant comprises at least one amino acid substitution selected from the group consisting of N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, and D239A.

[0013] In some embodiments of the present application, the mutant comprises the following substitutions or combinations of substitutions:

[0014] N60Q;

[0015] N60Q+L78V;

[0016] N60Q+A92E;

[0017] N60Q+S111N;

[0018] N60Q+N124Q;

[0019] N60Q+Q147R;

[0020] N60Q+Q169E;

[0021] N60Q+A92E+S111N;

[0022] N60Q + A92E + N124Q;

[0023] N60Q + S111N + N124Q;

[0024] N60Q + N124Q + Q169E;

[0025] N60Q + N124Q + S230G;

[0026] N60Q + N124Q + D239A;

[0027] L78V;

[0028] L78V + A92E;

[0029] L78V + S111N;

[0030] L78V + N124Q;

[0031] L78V + Q147R;

[0032] L78V + M125I;

[0033] L78V + Q187R;

[0034] L78V + S230G;

[0035] L78V + A92E + S111N;

[0036] L78V + A92E + N124Q;

[0037] L78V + A92E + Q147R;

[0038] L78V + S111N + N124Q;

[0039] L78V + S111N + Q187R;

[0040] L78V + N124Q + Q147R;

[0041] L78V + N124Q + M125I;

[0042] L78V + N124Q + Q187R;

[0043] L78V + N124Q + D239A;

[0044] L78V + Q147R + M125I;

[0045] L78V + Q147R + Q169E;

[0046] L78V + M125I + Q187R;

[0047] L78V + Q147R + S230G;

[0048] L78V + M125I + D239A;

[0049] L78V + S111N + N124Q + Q147R;

[0050] L78V + S111N + N124Q + Q187R;

[0051] L78V + N124Q + Q147R + Q169E;

[0052] L78V + N124Q + Q147R + Q187R;

[0053] L78V + N124Q + Q147R + Q169E;

[0054] L78V + N124Q + Q147R + Q187R;

[0055] L78V + Q147R + Q169E + S230G;

[0056] L78V + Q147R + Q169E + D239A;

[0057] L78V + L78V + N124Q + Q147R + Q169E;

[0058] L78V + L78V + N124Q + Q147R + Q187R;

[0059] L78V + S111N + N124Q + Q147R + Q187R;

[0060] L78V + N124Q + Q147R + M125I + Q187R;

[0061] L78V + N124Q + Q169E + Q187R + S230G;

[0062] L78V + N124Q + Q147R + Q169E + Q187R + D239A;

[0063] A92E;

[0064] A92E + S111N;

[0065] A92E + Q147R;

[0066] A92E + M125I;

[0067] A92E + Q187R;

[0068] A92E + N124Q + Q187R;

[0069] A92E + N124Q + S230G;

[0070] A92E + N124Q + D239A;

[0071] S111N + N124Q;

[0072] S111N + D239A;

[0073] S111N + Q147R + Q187R;

[0074] S111N + N124Q + Q147R + Q187R;

[0075] S111N + N124Q + Q147R + Q187R + D239A;

[0076] N124Q;

[0077] N124Q + Q147R;

[0078] N124Q + M125I;

[0079] N124Q + Q187R;

[0080] N124Q + Q169E;

[0081] N124Q + Q147R + M125I;

[0082] N124Q + Q147R + Q187R;

[0083] N124Q + Q147R + S230G;

[0084] N124Q + M125I + Q187R;

[0085] N124Q + Q147R + M125I + Q187R;

[0086] Q147R + M125I;

[0087] Q147R + Q187R;

[0088] Q147R + M125I + Q187R;

[0089] M125I;

[0090] M125I + Q169E;

[0091] M125I + Q187R;

[0092] M125I + S230G;

[0093] M125I + D239A;

[0094] M125I + Q187R + D239A;

[0095] Q147R;

[0096] Q147R + Q187R;

[0097] M125I;

[0098] M125I + Q187R;

[0099] M125I + D239A;

[0100] Q169E;

[0101] Q169E + S230G;

[0102] Q169E + D239A;

[0103] Q169E + Q187R + D239A;

[0104] Q187R;

[0105] S111N + Q187R;

[0106] Q187R + D239A;

[0107] S230G;

[0108] D239A.

[0109] The present application also relates to a DNA molecule encoding the above cellulase mutant.

[0110] The present application also relates to a recombinant expression vector comprising the above DNA molecule.

[0111] The present application also relates to a host cell comprising the above recombinant expression vector.

[0112] In some embodiments of the present application, the host cell is Trichoderma reesei.

[0113] The above recombinant expression vector is transformed into the Trichoderma reesei host cell for recombinant expression, and the cellulase mutant obtained has higher specific activity.

[0114] The present application also relates to the use of the above cellulase mutant in the field of textiles.

[0115] The cellulase mutant provided by the application has higher specific activity under the condition of 50 DEG C. Compared with the wild type, the specific activity of the cellulase mutant containing N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, D239A single-point mutation respectively is generally increased by 8.6%-35.7% under the condition of 50 DEG C. Among them, the specific activity of the L78V single-point mutant and the N124Q single-point mutant is increased by 30% and 35.7% respectively, and unexpected technical effects are achieved.

[0116] In addition, the L78V+S111N, S111N+N124Q, N124Q+Q169E, N124Q+Q147R, Q169E+D239A two-point mutant; L78V+S111N+N124Q, L78V+S111N+Q187R, L78V+N124Q+Q187R, S111N+Q147R+Q187R, N124Q+Q147R+S230G three-point mutant; L78V+S111N+N124Q+Q187R, L78V+N124Q+Q147R+Q187R, L78V+Q147R+Q169E+S230G four-point mutant; L78V+S111N+N124Q+Q147R+Q187R, S111N+N124Q+Q147R+D179S+Q187R, L78V+N124Q+Q169E+Q187R+S230G five-point mutant, and L78V+N124Q+Q147R+Q169E+Q187R+D239A six-point mutant provided by the application have specific activity generally increased by 10%-72.5% than the wild type cellulase NT45 under the condition of 50 DEG C, and unexpected technical effects are achieved.

[0117] In summary, the cellulase mutant provided by the application is more suitable for application in the field of textile industry than the wild type, can greatly reduce the dosage of cellulase, save working hours and energy, and reduce production cost. DETAILED DESCRIPTION

[0118] The application uses conventional techniques and methods used in the field of genetic engineering and molecular biology, such as the methods recorded in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, the application is not limited to any specific method, experimental scheme and reagent described.

[0119] The medium formula used in the embodiments of the present application is as follows:

[0120] LB+Amp medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0121] Upper layer medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0122] Lower layer medium: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agarose;

[0123] Fermentation medium: 1.5% glucose, 1.7% lactose, 2.5% corn syrup, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements.

[0124] The present application is described in detail below with reference to the specific embodiments.

[0125] Example 1 Screening of cellulase mutants

[0126] In order to improve the specific activity of wild-type cellulase NT45 (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2), the applicant screened a large number of mutations of the amino acids near the active site of the enzyme by directed evolution technology.

[0127] PCR primers NtE-F1 and NtE-R1 were designed as follows:

[0128] NtE-F1: GGC GAATTC ATGCGCTCCT CCACCATTC (underlined is the restriction endonuclease EcoRI recognition site);

[0129] NtE-R1: ATA GCGGCCGC TTAGGCGCACTGGTGGTAGTAGTC (underlined is the restriction endonuclease NotI recognition site).

[0130] The wild type cellulase NT45 gene (SEQ ID NO: 2) is used as a template, and the above-mentioned primers are used for PCR amplification by using a GeneMorph II random mutation PCR kit (Stratagene). The PCR product is recovered by gel, and is subjected to enzyme treatment by EcoRI and NotI, and then is connected with a pET21a vector subjected to the same enzyme treatment. The mixture is transformed into E. coli BL21 (DE3), and is coated on an LB+Amp plate, and is subjected to inverted culture at 37℃. After the appearance of the transformants, the transformants are picked by toothpicks one by one, 150 μL of LB+Amp medium containing 0.1 mM IPTG is added to each hole, and culture is carried out at 37℃ and 220 rpm for about 6 hours. The supernatant is discarded by centrifugation, and the bacterial body is resuspended with a buffer, and is repeatedly frozen and thawed to break the wall, so as to obtain an E. coli cell lysate containing cellulase.

[0131] 50 μL of the lysate is taken out to two new 96-hole plates, and the cellulase enzyme activity and the protein content are respectively measured at 50℃, and the specific activity of different mutants is calculated.

[0132] The experimental results show that some mutations have no influence on the specific activity of cellulase at 50℃, some mutations even make the specific activity worse, and some mutations can improve the specific activity of cellulase, but the enzymatic properties of the mutants are changed significantly after mutation, which do not meet the requirements. Finally, the applicant obtains the mutation sites with significantly improved specific activity at 50℃, which are N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, and D239A.

[0133] Based on the cellulase NT45, the application provides cellulase mutants containing single mutation sites of N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, and D239A, respectively.

[0134] The present application also provides a cellulase mutant comprising at least two, at least three, at least four, at least five, at least six mutation sites of N60Q, L78V, A92E, N124Q, M125I, Q169E, Q187R, S230G, and D239A. For example, two-point mutants of L78V+S111N, S111N+Q187R, N124Q+Q169E, N124Q+Q147R, Q169E+D239A, Q187R+D239A, etc.; three-point mutants of L78V+S111N+N124Q, L78V+S111N+Q187R, L78V+N124Q+Q187R, S111N+Q147R+Q187R, N124Q+Q147R+S230G, etc.; four-point mutants of L78V+S111N+N124Q+Q187R, L78V+N124Q+Q147R+Q187R, L78V+Q147R+Q169E+S230G, etc.; five-point mutants of L78V+S111N+N124Q+Q147R+Q187R, S111N+N124Q+Q147R+D179S+Q187R, L78V+N124Q+Q169E+Q187R+S230G, etc.; and six-point mutant of L78V+N124Q+Q147R+Q169E+Q187R+D239A, etc.

[0135] Example 2 Expression of cellulase mutants in Trichoderma reesei

[0136] According to the codon bias of Trichoderma, the gene sequence of cellulase NT45 SEQ ID NO: 2 and the gene sequence of the mutant were respectively optimized and synthesized, and KpnI and MluI two enzyme cutting sites were added at the 5' and 3' ends of the synthesized sequence.

[0137] 2.1 Construction of expression vector

[0138] The synthesized plasmid was subjected to enzyme cutting with restriction endonuclease KpnI (Fermentas) and XbaI; meanwhile, the plasmid pTGII was subjected to enzyme cutting with restriction endonuclease KpnI (Fermentas) and XbaI; the enzyme cutting products were purified using a gel purification kit, and the two enzyme cutting products were connected using T4 DNA ligase (Fermentas); the connection product was transformed into Trans5α E. coli (Transgen), and ampicillin was used for selection, and a number of clones were sequenced (Invitrogen) to ensure accuracy. After correct sequencing, the recombinant plasmid containing the cellulase gene was obtained.

[0139] The plasmid was purified from the E. coli clone with correct sequencing result using a plasmid miniprep kit (Axygen).

[0140] 2.2 Preparation of protoplasts

[0141] Trichoderma reesei U4 spore suspension was inoculated on PDA plates and incubated at 30°C for 6 days. After the spores were abundant, about 1 cm x 1 cm of the colony was cut and placed in a liquid medium containing 120 mL YEG+U (0.5% yeast extract, 1% glucose, 0.1% uridine) and incubated at 30°C with 220 rpm shaking for 14-16 h. The mycelium was collected by sterile gauze filtration and washed once with sterile water. The mycelium was placed in a flask containing 20 mL of 10 mg / mL lysozyme solution (Sigma L1412) and incubated at 30°C with 90 rpm for 1-2 h. The progress of protoplast transformation was observed and detected under a microscope.

[0142] Pre-cooled 20 mL of 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) was added to the above flask, shaken gently, and the filtrate was collected by sterile Miracloth filter cloth, centrifuged at 3000 rpm at 4°C for 10 min. The supernatant was discarded, 5 mL of pre-cooled 1.2 M sorbitol solution was added to suspend the mycelium, and centrifuged at 3000 rpm at 4°C for 10 min. The supernatant was discarded, and an appropriate amount of pre-cooled 1.2 M sorbitol was added to suspend and dispense (200 μL / tube, protoplast concentration 10 8

[0143] 2.3 Transformation of expression vector and strain verification

[0144] All the following operations were carried out on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution, followed by 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2), and the tube was shaken gently and mixed, and placed on ice for 20 min. 2 mL of 25% PEG was added, mixed, and placed at room temperature for 5 min. 4 mL of 1.2 M sorbitol was added, mixed gently, and poured into the upper medium which was melted and kept at 55°C. After gentle mixing, it was spread on the prepared lower medium and incubated at 30°C for 5-7 d until the transformants grew. The transformants were picked to the lower medium plate for re-screening, and incubated at 30°C for 2 d. The strains with smooth colony edges were positive transformants.

[0145] ​Take the appropriate amount of mycelium in 2 mL centrifuge tube, add 100 mg sterile quartz sand and 400 μL extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS); use the bead beater instrument to shake vigorously for 2 min; after 20 min in 65℃ water bath, add 200 μL 10 M NH4AC, ice bath for 10 min; centrifuge at 13000 rpm for 10 min; take the supernatant, add 2 times the volume of absolute ethanol, -20℃ for 30 min; centrifuge at 13000 rpm for 10 min, discard the supernatant; wash twice with 70% ethanol; dry, add water to dissolve, store at -20℃.

[0146] The above extracted transformant genomic DNA was used as a template, and primers M6-F and M6-R were used to perform PCR amplification of the target gene for verification.

[0147] M6-F: ATGCGCTCCT CCACCATTC;

[0148] M6-R: TTAGGCGCACTGGTGGTAGTAGTC.

[0149] The PCR amplification conditions were 94℃ for 4 min; 94℃ for 40 s; 58℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 16℃; the PCR amplification product was recovered using a gel recovery kit and subjected to sequencing analysis.

[0150] According to the above method, the applicant constructed a recombinant Trichoderma reesei engineering strain of cellulase NT45 and the above mutant, respectively.

[0151] Example 3 Fermentation verification

[0152] The above constructed Trichoderma reesei engineering strain was inoculated into a PDA solid plate, and cultured at 30℃ for 6d. When the spores were abundant, two 1cm diameter mycelial blocks were inoculated into 250mL flasks containing 50mL fermentation medium, and cultured at 30℃ for 48h, and then at 25℃ for 48h. The fermentation broth was centrifuged to obtain fermentation supernatant containing cellulase NT45 and the above mutant, respectively.

[0153] 3.1 Enzyme activity determination

[0154] (1) Definition of cellulase enzyme activity

[0155] The amount of enzyme required to degrade 1 μmol of reducing sugar from a 5mg / ml solution of sodium hydroxymethyl cellulose per minute at 50℃ and pH 6.0 is defined as one enzyme activity unit U, and the reducing sugar is equivalent to glucose.

[0156] (2) Cellulase enzyme determination method

[0157] Take three test tubes each add 0.5 mL CMC substrate, with the enzyme to be tested liquid together 50℃ water bath preheating 5 min. In the first, second test tube each add 0.5 mL of the test liquid, and timing, 50℃ water bath reaction 15 min. Reaction complete in three test tubes each add 1.5 mL DNS reagent, and in the third test tube total 0.5 mL of the test enzyme liquid. Take out and shake three test tubes after, in boiling water bath reaction 5 min. Rapidly cooled to room temperature, with water to 5.0 mL. With the third test tube test solution as control in 540 nm wavelength conditions under the first, second test tube test solution absorbance, absorbance between 0.25-0.35 is appropriate. The difference between the absolute value of the measured enzyme liquid reaction liquid absorbance and the level of control enzyme liquid absorbance is not more than 0.015.

[0158] Enzyme activity X = (glucose equivalent value / 180 / 15 / 0.5) x n.

[0159] X - enzyme activity unit, IU / g (mL);

[0160] 180 - glucose from microgram to convert into micromole;

[0161] 15 - the reaction time of the test liquid and substrate;

[0162] 0.5 - the amount of test enzyme added to the reaction;

[0163] n - dilution factor.

[0164] (3) determination results

[0165] According to the above method for enzyme activity detection, the results show that: the recombinant expression of wild type cellulase NT45 and its mutants of Trichoderma reesei engineering bacteria fermentation supernatant under the condition of 50℃ enzyme activity is 90-180 U / mL.

[0166] 3.2 protein content determination

[0167] (1) determination method:

[0168] Bradford method for determination of protein content is a combination of colorimetric method and pigment method. Coomassie brilliant blue G-250 in acid solution is brown red, when combined with protein to blue, and in the certain concentration range of protein meets Beer's law, can be determined by colorimetry at 595 nm. In 3-5 min, a large amount of absorption, at least stable 1 h. In the range of 10-1000 μg / mL, the absorbance is proportional to the protein concentration.

[0169] The enzyme solution and the coomassie brilliant blue solution were mixed at a volume ratio of 1:5, and then left to stand for 10 min. The protein content was determined by the coomassie brilliant blue (Bradford) binding method.

[0170] (2) Protein content determination results

[0171] The cellulase protein content in the fermentation supernatant of the above Trichoderma reesei engineering bacteria was detected by the above method. The results showed that the protein content of the fermentation supernatant of the Trichoderma reesei engineering bacteria expressing the wild-type cellulase NT45 and its mutants was 0.04-0.1 mg / mL at 50℃.

[0172] 3.3 Calculation of specific activity

[0173] The "specific activity" refers to the number of units of enzyme activity per unit weight of protein, which is generally expressed as U / mg of protein. Generally, the higher the specific activity of an enzyme, the purer the enzyme.

[0174] The specific activity calculation formula is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0175] The specific activity of the fermentation supernatant of the Trichoderma reesei engineering bacteria expressing the recombinant cellulase NT45 and its mutants obtained in Example 3 of the present application was 0.04-0.1 mg / mL at 50℃, as shown in Table 1.

[0176] Table 1 Specific activity of cellulase NT45 and its mutants at 50℃

[0177] Cellulase 50 °C specific activity Cellulase NT45 280 N60Q single point mutant 298 L78V single point mutant 365 A92E single point mutant 350 N124Q single point mutant 380 M125I single point mutant 345 Q169E single point mutant 340 Q187R single point mutant 320 S230G single point mutant 304 D239A single point mutant 330

[0178] As can be seen from the results in Table 1, compared with the wild type, the specific activity of the single-point mutant provided by the present application at 50℃ is generally increased by 8.6%-35.7%, thereby indicating that the specific activity of the single-point mutant provided by the present application at 50℃ is significantly improved. Among them, the specific activity of the L78V single-point mutant and the N124Q single-point mutant is increased by 30% and 35.7%, respectively, achieving an unexpected technical effect.

[0179] In addition, the L78V+S111N, S111N+N124Q, N124Q+Q169E, N124Q+Q147R, Q169E+D239A two-point mutant, L78V+S111N+N124Q, L78V+S111N+Q187R, L78V+N124Q+Q187R, S111N+Q147R+Q187R, N124Q+Q147R+S230G three-point mutant, L78V+S111N+N124Q+Q187R, L78V+N124Q+Q147R+Q187R, L78V+Q147R+Q169E+S230G four-point mutant, L78V+S111N+N124Q+Q147R+Q187R, S111N+N124Q+Q147R+D179S+Q187R, L78V+N124Q+Q169E+Q187R+S230G five-point mutant, and L78V+N124Q+Q147R+Q169E+Q187R+D239A six-point mutant provided by the application have a specific activity at 50℃ that is 10%-72.5% higher than that of the wild-type cellulase NT45, and an unexpected technical effect is achieved.

[0180] Example 4: Application of the cellulase mutant in the application of jeans fabric in the processes of raising and removing hair

[0181] The application temperature is 35-55℃;

[0182] The treatment time is 10-60min;

[0183] The pH range is 4.0-8.5;

[0184] The above process conditions can be applied to the processes of removing hair and raising in the desizing and separate stone washing conditions; the applicable bath ratio range is 1:5-1:30, the type of the equipment used is an industrial washing machine, and the dosage of the cellulase mutant is 180-600U / L.

[0185] The cellulase mutant provided by the application can remove hair cleanly, raise uniformly, and has smaller flower points and less loss of fabric strength.

[0186] In addition, compared with the wild-type cellulase NT45, the dosage of the cellulase mutant required to achieve the same treatment effect is reduced by 28-80%, thereby significantly reducing the enzyme cost in the processing process and being beneficial to further reduce the production cost.

Claims

1. A cellulase mutant, characterized in that, The mutant is a cellulase with the amino acid sequence SEQ ID NO: 1 in which the 125th amino acid is changed from Met to Ile.

2. A DNA molecule encoding the cellulase mutant of claim 1.

3. A recombinant expression vector having the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression vector of claim 3; the host cell is neither a plant cell nor an animal cell.

5. The host cell of claim 4, wherein The host cell is Trichoderma reesei Trichoderma reesei ).

6. The application of the cellulase mutant of claim 1 in the textile field.

Citation Information

Patent Citations

  • Cellulase mutant and application thereof

    CN104450653A

  • Color protective cellulose and mutant thereof

    CN104789543A