Rose monoterpene compound regulatory gene RrSSUII and application thereof

Abstract

The application discloses a rose monoterpene compound-regulating gene RrSSUII and application thereof, wherein a nucleotide sequence of the RrSSUII gene is shown as SEQ ID NO. 1, an mRNA sequence thereof is shown as SEQ ID NO. 2, and a protein amino acid sequence thereof is shown as SEQ ID NO. 3. The application identifies and clones the gene RrSSUII that can regulate synthesis of monoterpene compounds in roses for the first time. After co-expressing the RrSSUII gene and a rose linalool synthase RrLIS gene, the content of monoterpene compounds is obviously increased compared with the case of expressing the RrLIS alone, which proves that the RrSSUII can regulate accumulation of monoterpene metabolites in roses, and has important application values in aspects of enhancing synthesis of monoterpene metabolites and improving comprehensive quality of roses.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a rose monoterpenoid compound regulatory gene RrSSUII and an application thereof. Background Art

[0002] Rose (Rosa rugosa Thunb.), a deciduous shrub of the genus Rosa in the Rosaceae family, is known as the queen of flowers and is native to eastern Asia. Rose is an important economic plant in my country, enjoying ornamental, edible, fragrant, and medicinal uses. Its rich colors and rich fragrance are the source of rose essential oil, a highly prized "liquid gold." Therefore, the rose industry prioritizes its essential oil over its color. However, the essential oil content in rose flowers is very low, only about 0.03% of the total, and the primary component of rose essential oil is monoterpenoids.

[0003] The most important precursor of monoterpenes is geranyl diphosphate (GPP), which is formed by the head-to-tail condensation of one molecule of IPP and one molecule of DMAPP catalyzed by GPPS (EC2.5.1.1.). GPP, catalyzed by the monoterpene synthase TPS, then generates structurally diverse monoterpenes. Two distinct types of GPPS have been identified in the plant kingdom: homodimeric GPPS and heterodimeric GPPS. In vitro biochemical analyses have shown that both types can utilize DMAPP and IPP to generate GPP. Currently, heterodimeric GPPS has been cloned in non-model plants. This enzyme consists of two distinct subunits, large and small. The large subunit (LSU) shares a high degree of homology (greater than 50%) with geranylgeranyl diphosphate synthase (GGPPS). Unlike LSU, the small subunit (SSU) of the heterodimeric GPPS shares only 20-30% homology with GGPPS. Experiments have confirmed that the cloned SSU, while isolated, lacks GGPPS biochemical activity, but can modulate LSU's substrate recognition and binding ability, promoting GPP production. Currently, no SSU genes involved in the synthesis of monoterpenoids in roses have been reported. Therefore, identifying and cloning genes regulating rose monoterpenoid production will help elucidate the regulatory pathways of rose monoterpenoids, provide molecular tools for genetic engineering of rose varieties with high monoterpenoid content, and have the potential to improve the nutritional quality of roses. Summary of the Invention

[0004] The purpose of the present invention is to address the deficiencies in the prior art and provide a rose monoterpenoid regulatory gene RrSSUII to meet usage needs.

[0005] Another object of the present invention is to provide an application of the rose monoterpene compound regulatory gene RrSSUII, which provides a basis for increasing the content of rose monoterpene compounds.

[0006] In order to achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] A rose monoterpenoid regulatory gene RrSSUII, whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] The amino acid sequence of the expression protein of the rose monoterpenoid regulatory gene RrSSUII is shown in SEQ ID NO.3.

[0009] The application of the above-mentioned rose monoterpenoid regulatory gene RrSSUII in promoting the synthesis of rose monoterpenoid compounds.

[0010] An overexpression vector containing the rose monoterpenoid regulatory gene RrSSUII.

[0011] Furthermore, the overexpression vector containing the rose monoterpenoid regulatory gene RrSSUII is constructed using plasmid pRSFDuet-1. The overexpression vector is assembled with a promoter T7 promoter at the 5' end of the gene RrSSUII, which can overexpress the RrSSUII gene in Escherichia coli.

[0012] Beneficial effects of the present invention:

[0013] 1) We identified and cloned an amino acid sequence from rose 'Fenghua' that is homologous to Arabidopsis thaliana AtSSUII (ID: evm.model.Chr2.3334) and named it RrSSUII;

[0014] 2) The present invention constructed an overexpression vector pRSFDuet-RrGGPPS1-RrSSUII containing the rose monoterpene compound regulatory gene RrSSUII, and simultaneously transformed the overexpression vector pRSFDuet-RrGGPPS1-RrSSUII and the linalool synthase gene RrLIS (pET32a-RrLIS) into Escherichia coli. Quantitative detection by gas chromatography-mass spectrometry confirmed that RrSSUII can positively regulate rose monoterpene metabolites, which has important application value in improving rose quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the plasmid map of the vector pRSFDuet-RrGGPPS1-RrSSUII constructed in Example 2;

[0016] Figure 2The subcellular localization of RrSSUII in tobacco in Example 3;

[0017] Figure 3 These are the results of monoterpene content detection in Escherichia coli with different gene combinations in Example 4. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is described clearly and completely below with reference to the accompanying drawings and specific embodiments.

[0019] In the following examples, plasmid pRSFDuet-1 was purchased from Novagen; competent Agrobacterium was purchased from Sinopharm Group; competent Escherichia coli was purchased from Qingke Biotechnology; restriction enzymes were purchased from New England Biolabs; antibiotics and hormones were purchased from Solebro; RNA extraction kits were purchased from Tiangen Biochemical Technology Co., Ltd.; reverse transcription kits and high-fidelity enzymes were purchased from TAKARA Biotechnology; product purification kits, bacterial PCR Taq enzyme, plasmid extraction kits, homologous recombination enzymes, fluorescent reverse transcription reagents, and fluorescent quantitative PCR reagents were purchased from Nanjing Novozymes Biotechnology Co., Ltd., but the present invention is not limited to these.

[0020] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0021] Example 1

[0022] The RrSSUII gene was identified and cloned through transcript homology comparison:

[0023] Based on the AtSSUII gene, which has been reported in Arabidopsis to regulate monoterpenoid production, a homologous alignment with the rose genome identified a rose RrSSUII with 69% similarity. This gene, containing a complete open reading frame (ORF), was named RrSSUII. Using total RNA from rose floral organs as a template, the RrSSUII ORF sequence (cDNA sequence) was cloned and transferred into a cloning vector. The insert was positively screened and sequenced. Sequencing results confirmed the complete RrSSUII gene after correct alignment.

[0024] I. Primer Design

[0025] The RrSSUIIORF primer pair is:

[0026] ORF-F: 5'-ATGGCGTTCTCAGTGGTTTCGACTC-3',

[0027] ORF-R: 5'-TTAAAGACTAAAACTTCTATCAACT-3';

[0028] II. ORF sequence cloning

[0029] (1) Reverse transcription;

[0030] The reverse transcription reaction system is: 2 μg Total RNA, 1 μL dNTP Mix, 1 μL Oligo dT Primer, 4 μL 10X RT Buffer, 0.5 μL RNase Inhibitor, 1 μL M-MLV Reverse Transcriptase, and Nuclease-free Water is added to 20 μL.

[0031] The reaction procedure was as follows: 42°C for 90 min and 70°C for 20 min to obtain the cDNA template.

[0032] (2) PCR amplification;

[0033] The PCR reaction system was as follows: KeyPo Master Mix (2×) 25 μL, ORF-F primer 1 μL, ORF-R primer 1 μL, cDNA 2 μL, Nuclease-free ddH O 21 μL;

[0034] The reaction program was as follows: 98°C for 15 s, 60°C for 10 s, and 72°C for 15 s, for 35 cycles to obtain the PCR product.

[0035] (3) Ligation of the cloning vector;

[0036] Ligate with the 5×TA / Blunt-Zero Cloning Mix cloning vector. The ligation system (5 μL) is: 1 μL PCR purified product, 0.5 μL 5×TA / Blunt-Zero Cloning Mix, 3.5 μL ddH2O. The reaction conditions are: 37°C, 10 min, to obtain the ligation product.

[0037] (4) E. coli transformation;

[0038] Take 3 μL of ligation product and add it to 100 μL of E. coli competent cells, flick to mix, and let it stand on ice for 30 minutes; in a 42°C water bath for 45 seconds, quickly place it on ice for 5 minutes; add 800 μL of antibiotic-free LB liquid culture medium, 37°C, 200 rpm for recovery for 1 hour; centrifuge at 6000 rpm for 5 minutes, aspirate the upper 650 μL culture medium, mix the remaining bacterial liquid, evenly spread it on the LB screening culture plate containing antibiotics, and culture it upside down at 37°C overnight.

[0039] (5) Screening and sequencing of positive clones;

[0040] Single colonies were selected from overnight culture plates and inoculated into LB liquid medium containing Kan. Cultures were incubated overnight at 37°C, 220 rpm, and the resulting bacterial suspension was used as a template for PCR. The PCR reaction system consisted of 9.5 μL of ddH2O, 12.5 μL of Rapid Taq Master Mix (2×), 1 μL of M13F primer, 1 μL of M13R primer, and 1 μL of bacterial suspension. The reaction procedure was as follows: 95°C for 5 min (preliminary denaturation); 95°C for 30 sec, 55°C for 20 sec, 72°C for 30 s, 30 cycles; and 72°C for 10 min (extension). Positive bacterial suspensions were sent to Sangon Biotech (Shanghai) for sequencing.

[0041] Analysis of the sequencing results showed that the DNA of RrSSUII is 1265bp long, and its sequence is shown in SEQ ID NO.1; the ORF of RrSSUII is 990bp long, and its sequence is shown in SEQ ID NO.2; the corresponding RrSS UII protein sequence is 329 amino acid residues, and its sequence is shown in SEQ ID NO.3.

[0042] Example 2

[0043] Construction of an overexpression vector containing the rose monoterpenoid regulatory gene RrSSUII:

[0044] Primers RrSSUIIduet-F: 5'-taagaaggagatatacatatgATGGCGTTCTCAGTG GTTTCG-3', and RrSSUIIduet-R: 5'-ggtttctttaccagactcgagTTAAAGACTAAAA CTTCTATCAACTGCATAA-3' were designed. RrSSUIIduet-F and RrSSUIIduet-R were used to amplify the RrSSUII fragment. pRSFDuet-RrGGPPS1 was digested with NdeI / XhoI restriction endonucleases (NEB) and the linear product was recovered. The RrSSUII fragment was inserted into the pRSFDuet-RrGGPPS1 vector using the ClonExpress II One-Step Cloning Kit (Vazyme) to construct the vector pRSFDuet-RrGGPPS1-RrSSUII.

[0045] Figure 1This is the plasmid map of the vector pRSFDuet-RrGGPPS1-RrSSUII constructed in Example 2. It can be seen that on the basis of the original plasmid pRSFDuet-1, the two genes RrGGPPS1 and RrSSUII were introduced at the two multiple cloning sites, respectively, to construct the vector pRSFDuet-RrGGPPS1-RrSSUII.

[0046] Example 3

[0047] Subcellular localization of RrSSUII protein:

[0048] (1) pCAMBIA 1300-35S-EGFP was digested with SacI / XbaI restriction endonucleases (NEB) and the linearized product was recovered;

[0049] (2) Subcellular localization vector primers RrSSUII-1300-F: gagaacacgggggacgagctcATGGCGTTCTCAGTGGTTTCG, and RrSSUII-1300-R: gctcaccatgtcgactctagaAAGACTAAAACTTCTATCAACTGCATAATC were designed, and the RrSSUII fragment was inserted into the pCAMBIA 1300-35S-EGFP vector using the ClonExpress II one-step cloning kit (Vazyme);

[0050] (3) Use the freeze-thaw method to transform the constructed vector plasmid and the empty vector (control) into Agrobacterium tumefaciens GV3101. Pick out a single positive Agrobacterium and culture it in LB medium until the OD 600 When the value reaches 0.5-0.6, centrifuge, discard the supernatant, and resuspend the pellet with resuspension buffer (1MMES; 20μM AS; 1M MgCl2) to OD 600 =1.0 and then injected into 5-6 week old tobacco leaves. Fluorescence of tobacco plant leaves was detected at 488 nm using a Zeiss LSM 880 confocal microscope to obtain GFP fluorescence signal images.

[0051] Figure 2 This is the subcellular localization of RrSSUII in tobacco in Example 3, where the GFP image represents the location of RrSSUII protein expression, the Autofluorescence image represents the plastid autofluorescence image, and the Merge image represents the superposition of the GFP image and the Autofluorescence image. Some yellow dot-like fluorescence images can be seen in the image, proving that RrSSUII is mainly located in the plastid.

[0052] Example 4

[0053] Monoterpene content detection:

[0054] (1) Overexpression in Escherichia coli: ① single expression of linalool synthase gene RrLIS plasmid (pET32a-RrLIS), ② co-expression plasmid pRSFDuet-RrGGPPS1 and plasmid pET32a-RrLIS, ③ co-expression plasmid pRSFDuet-RrGGPPS1-RrSSUII (construction method is the same as Example 2) and plasmid pET32a-RrLIS, and obtain three strains with different gene combinations, which are respectively recorded as RrLIS, RrGGPPS1+RrLIS, and RrGGPPS1+RrSSUII+RrLIS;

[0055] (2) Select a single positive colony and inoculate it into LB medium containing the corresponding antibiotics (100 μg / mL ampicillin and 34 μg / mL chloramphenicol for the RrLIS strain, 50 μg / mL kanamycin and 34 μg / mL chloramphenicol for the RrGGPPS1+RrLIS and RrGGPPS1+RrSSUII+RrLIS strains), and culture it in a shaking incubator at 37°C until the culture OD reaches 0. 600 Reach 0.4-0.6, then add 0.4 mM isopropyl β-d-thiogalactoside (IPTG), incubate at 16°C and 200 rpm for 12 h, induce recombinant protein for 24 h, and finally use n-hexane to extract linalool in Escherichia coli, and use gas chromatography-mass spectrometry (GC-MS) instrument to detect the content of linalool.

[0056] Figure 3 The results of monoterpene content detection in Escherichia coli with different gene combinations in Example 4 are shown. In the figure, different letters indicate significant differences (ANOVA, P < 0.05). The results show that the RrGGPPS1-RrSSUII-RrLIS strain produces more linalool (increase of approximately 150%) compared with the RrLIS strain expressing alone.

[0057] SEQ ID NO.1

[0058] RrSSUII gene DNA sequence

[0059]

[0060] SEQ ID NO.2

[0061] RrSSUII gene mRNA sequence

[0062] ATGGCGTTCTCAGTGGTTTCGACTCCGGCGCATTTCCACCTACCGAAAAAGCTTACTTTCCGAATTCGGTGCTGCGCGGCTTCATCGGTTTCGACCCGATCAAAGTCGACCCGGTTCGATTTGAAAACCTACTGGACGACGCTGATCGCCGATATCAACAACAAGCTTAACGAGGCGGTTCCGGTTCGGTATCCTGAGCTGATCTACGAGTCCATGCGCTACTCCGTTCTCGCCGACGGCGCCAAGAGGGCTTCTCCGGTCATGTGCGTCGCCGCCTGTGAGCTCTTCGGCGGTGACCGCCTCGCCGCCTTCCCCACCGCCTGTGCTCTCGAAATGGTACATGCAGCTTCACTCATACACGATGATCTCCCTTGCATGGATGACGACCCGTCTCGTCGCGGGCAGCCTTCTAACCACACAGTCTACGGCGAAGACATGGCAATTCTTGCTGGTGATGCTCTGTTTCCTTTAGGATTTCAGCACATTGTGTCAAACACGCCTTCAGATCTTGTGCCAGAGGCTCGACTTCTGCGTGTGATAGCGGAGATTGCCAGAACTGTTGGGTCCACCGGCATGGCGGCTGGTCAGTTCCTTGACCTGGAAGGAGGGCCTAATGCGGTTGAATTCGTGCAGGAGAAGAAGTTTGGGGAAATGGGTGAGTGTTCTGCTGTTTGCGGAGGACTGCTAGCTGGTGCCGAAGATGAGGAGGTAGACAGACTGAGGAGGTACGGGAGAGCTGTTGGGGTTTTGTATCAAGTGGTTGATGATATTCTTGAAGAGAAGAAGAATGGTAAGGATGAGAATGAGAAGAAGGAGAAGAAAGGGAAGAGCTATGTGAAAGTTTATGGGGTTGAAAAGGCTATGGAGGTAGCAGAGAAGCTTAGATCCCAAGCTAAGCAGGAGTTAGATGGGTTTGAGAAGTATGGTGATGGTGTGGTGCCACTTCATAGCTTTGTGGATTATGCAGTTGATAGAAGTTTTAGTCTTTAA

[0063] SEQ ID NO.3

[0064] Amino acid sequence of RrSSUII protein

[0065] MAFSVVSTPAHFHLPKKLTFRIRCCAASSVSTRSKSTRFDLKTYWTTLIADINNKLNEAVPVRYPELIYESMRYSVLADGAKRASPVMCVAACELFGGDRLAAFPTACALEMVHAASLIHDDLPCMDDDPSRRGQPSNHTVYGEDMAILAGDALFPLGFQHIVSNTPSDLVPEARLLRVIAEIARTVGSTGMAAGQFLDLEGGPNAVEFVQEKKFGEMGECSAVCGGLLAGAEDEEVDRLRRYGRAVGVLYQVVDDILEEKKNGKDENEKKEKKGKSYVKVYGVEKAMEVAEKLRSQAKQELDGFEKYGDGVVPLHSFVDYAVDRSFSL。

Claims

1. Application of the rose monoterpenoid regulatory gene RrSSUII in promoting the synthesis of rose monoterpenoids, characterized in that: The nucleotide sequence of the gene RrSSUII is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein of the gene RrSSUII is shown in SEQ ID NO.

3.

2. Use of an overexpression vector containing the rose monoterpenoid regulatory gene RrSSUII in promoting the synthesis of rose monoterpenoids, characterized in that: The nucleotide sequence of the gene RrSSUII is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein of the gene RrSSUII is shown in SEQ ID NO.

3.

3. The use according to claim 2, characterized in that The overexpression vector containing the rose monoterpenoid regulatory gene RrSSUII is constructed using plasmid pRSFDuet-1. The overexpression vector is assembled with a promoter T7 promoter at the 5' end of the gene RrSSUII, so that the RrSSUII gene is overexpressed in Escherichia coli.

Images