A RPA-CRISPR-Cas12a detection method for SGIV virus and its application
The RPA-CRISPR-Cas12a kit and detection method solves the problem of existing SGIV detection being time-consuming and requiring specialized equipment, and achieves rapid, sensitive, and specific SGIV detection suitable for field samples.
Patent Information
- Application Number
- CN202410745418.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-11
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-06-11
AI Technical Summary
Existing SGIV detection methods require professional equipment and operations, are time-consuming, are not suitable for rapid on-site testing, and lack effective means for early detection of pathogens.
The RPA-CRISPR-Cas12a kit, which contains specific RPA primers, crRNA and ssDNA-FQ fluorescent reporter probes, is used in combination with the CRISPR-Cas12a system to achieve rapid and sensitive SGIV detection.
Rapid, sensitive and specific detection of SGIV was achieved, with a detection sensitivity of 10 copies/μL, which is suitable for on-site sample detection and has high accuracy and practicality.
Smart Images

Figure CN118792448B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of aquatic disease detection, and particularly to a kit and a detection method for RPA-CRISPR-Cas12a detection of Singapore grouper iridovirus (SGIV). Background Art
[0002] Grouper is an important commercial aquaculture fish species in southern my country and Southeast Asian countries. According to the 2023 Fisheries Statistical Yearbook, my country's grouper production exceeded 200,000 tons in 2022, ranking fourth among marine fish. With the expansion of grouper aquaculture and the promotion of intensive farming methods, various infectious diseases have frequently broken out and become epidemics. Singapore grouper iridovirus (SGIV) is a major epidemic strain of grouper iridovirus disease, belonging to a new species of the genus Ranavirus in the family Iridoviridae. SGIV primarily infects grouper (Epinephelus spp.) larvae and juveniles, with a mortality rate exceeding 90%, causing significant economic losses to the grouper aquaculture industry. Currently, there is no effective treatment for SGIV, and a "prevention-first" approach is primarily adopted. In addition to vaccination, early detection and diagnosis of pathogens, which shifts the focus of prevention and control, can also effectively prevent or mitigate disease outbreaks.
[0003] Early diagnosis of SGIV includes traditional detection methods such as electron microscopy, cell isolation and culture, and immunohistochemistry. Traditional detection methods require sophisticated equipment, professional operation, and are time-consuming. In recent years, with the development of biotechnology, a variety of SGIV detection methods have been developed, including conventional polymerase chain reaction (PCR) and real-time fluorescence quantitative PCR (qPCR), as well as new nucleic acid detection methods such as loop-mediated isothermal amplification (LAMP), aptamer-based detection methods (such as aptamer immunosorbent assay (Apt-ELISA) and aptamer flow chromatographic assay (Apt-LFD), and recombinase polymerase amplification (RPA). Compared with traditional detection methods, these methods are time-consuming and have improved sensitivity, but some detection methods still require professional operation and are not suitable for rapid on-site pathogen detection.
[0004] CRISPR (Clustered regularly interspaced short palindromic repeats) refers to clustered regularly interspaced short palindromic repeats. The CRISPR-Cas system is part of the innate immunity of bacteria or archaea and can be used to resist the invasion of foreign nucleic acids. The CRISPR-Cas12a system recognizes target dsDNA containing PAM under the guidance of guide RNA (crRNA), prompting the target dsDNA to melt; the target strand (TS) in the melted target dsDNA forms an Rloop with the guide RNA (crRNA), releasing the Ruvc active site in Cas12a; the melted non-target strand (NTS) will be cut by the Ruvc active site; after cutting, the target dsDNA is unwound, and the target strand (TS) is cut by the Ruvc active site; when Cas12a completes the cutting of the target strand (TS) and non-target strand (NTS) in the target dsDNA (cis cutting), the dsDNA will be released; and at this time, the Ruvc active site that leaves space will be cut once ssDNA enters (trans cutting). Based on this principle, CRISPR-Cas12a has been developed as a new nucleic acid detection and signal amplification technology. Recombinase polymerase amplification (RPA) is a new isothermal amplification technology that can be used in conjunction with the CRISPR-Cas12a method to further improve detection sensitivity. Therefore, the present invention constructs a kit for detecting SGIV based on RPA-CRISPR-Cas12a, which can be quickly and sensitively applied to the detection of field samples. Summary of the Invention
[0005] The purpose of the present invention is to provide an RPA-CRISPR-Cas12a kit and detection method for SGIV detection, which can detect SGIV quickly, sensitively and specifically.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] A detection kit for detecting grouper iridescent virus SGIV using RPA-CRISPR-Cas12a, comprising a specific RPA primer pair for detecting SGIV, crRNA, an ssDNA-FQ fluorescent reporter probe and a Cas12a enzyme (LbCas12a protein), wherein the RPA primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2; the nucleotide sequence of the crRNA is shown in SEQ ID NO.3.
[0008] SEQ ID NO.1: AAACCTAATGCACAACGCTGTAGAGCACGCTTCT;
[0009] SEQ ID NO.2:GGTAGTGTCCTTGCGCCGTCCTGACCCTGA;
[0010] SEQ ID NO.3: UAAUUUCUACUAAGUGUAGAUGACGCUUGGACACAGUUUAA;
[0011] Preferably, the ssDNA-FQ fluorescent reporter probe can complementarily bind to crRNA, and has a sequence of TTATT, wherein the 5' end is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quencher group BHQ1.
[0012] The sequence structure of the fluorescent reporter probe is 5'-FAM-TTATT-BHQ1-3'.
[0013] Preferably, the kit further comprises a positive plasmid standard (pcDNA3.1-3×HA-MCP), an enzyme powder mixture, a rehydration buffer, sterile water, a magnesium acetate solution and 10×HOLMES Buffer.
[0014] The present invention also provides the use of the above detection kit in detecting SGIV products.
[0015] The present invention also provides a method for detecting SGIV, comprising the following steps:
[0016] (1) Extracting genomic DNA from the sample to be tested;
[0017] (2) Using the DNA extracted in (1) as a template, specific RPA primers were used to perform RPA specific amplification to obtain the amplified product;
[0018] (3) Add the amplified product to a reaction system containing crRNA, fluorescent reporter probe, 10× HOLMES Buffer and Cas12a enzyme to perform CRISPR / Cas12a reaction;
[0019] (4) Perform real-time fluorescence detection on the mixture of step (3), set the FAM fluorescence detection channel, incubate at 37°C for 1 hour, detect the fluorescence value every 30 seconds, or place it in a gel imager for imaging under blue light irradiation and visual observation after the reaction is completed.
[0020] Preferably, the RPA amplification system includes: 29.5 μL Primer Free Rehydration Buffer, 2.4 μL RPA forward primer (10 μmol / L), 2.4 μL RPA reverse primer (10 μmol / L), 2 μL DNA template, 11.2 μL RNase-free water, 2.5 μL 280 mmol / L MgOAc, and a total volume of 50 μL.
[0021] Preferably, the RPA-CRISPR-Cas12a reaction system includes: 0.5 μL LbCas12a protein (4 μmol / L), specific 0.5 μL crRNA (2 μmol / L), 0.5 μL ssDNA-FQ reporter probe (6 μmol / L), 2 μL Target DNA, 2 μL of 10×HOLMES Buffer and supplemented to 20 μL with dd H2O.
[0022] Preferably, the result is judged as follows: the fluorescence value detected by the real-time fluorescence instrument indicates that the sample contains the SGIV virus, and the absence of a fluorescence value indicates that the sample does not contain the SGIV virus; when the reaction product is detected by a gel imager, the emission of a fluorescence signal under blue light irradiation indicates that the sample contains the SGIV virus, and the absence of a fluorescence signal indicates that the sample does not contain the SGIV virus.
[0023] Preferably, the RPA amplification conditions in step (2) are: a constant temperature amplification reaction at 37-42° C. for 20 minutes.
[0024] Preferably, the conditions of the CRISPR / Cas12a reaction in step (3) are: incubation at 37°C for 1 hour.
[0025] The present invention also provides the use of the above-mentioned detection kit or detection method in SGIV detection.
[0026] In the present invention, reporter molecule (ssDNA-FQ) does not produce fluorescent signal under normal circumstances, when LbCas12a protein is combined into special ternary complex with target and crRNA under crRNA guidance, double-stranded or single-stranded DNA target excites the trans-cleavage activity of LbCas12a, cutting non-specific sequence ssDNA-FQ, ssDNA-FQ is cut after the fluorescent group at both ends and the quenching group are separated and produce fluorescent signal in real time. Therefore, when SGIV virus is contained in the sample to be tested, real-time fluorescence instrument can detect fluorescence value and emit fluorescence under the blue light irradiation of gel imaging system. This detection method has good specificity, higher sensitivity and clinical sample detection practicality, and has certain application prospects.
[0027] Compared with existing virus detection technologies, the advantages of the present invention are:
[0028] (1) The present invention designs and screens a composition for detecting Singapore grouper iridovirus (SGIV), which consists of specific RPA primers, specific crRNA, and ssDNA-FQ reporter probes. The primer-probe group used can specifically amplify and target the target sequence, and has no cross-reaction with other viruses, thereby improving the specificity of SGIV detection.
[0029] (2) The present invention designs an ssDNA-FQ reporter probe, which utilizes the trans-cleavage activity of LbCas12a to cut ssDNA-FQ to generate a fluorescent signal, and the detection results can be visualized.
[0030] (3) The present invention combines RPA and CRISPR-Cas12a to construct a detection method for SGIV, which greatly improves the detection sensitivity to 10 copies / μL. In addition, RPA-CRISPR-Cas12a has accuracy and practicality in the detection of clinical samples. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Schematic diagram of the SGIV detection method based on RPA-CRISPR-Cas12a.
[0032] Figure 2 Pathogen specificity determination of the RPA-CRISPR-Cas12a detection method. (A) Real-time fluorescence value graph detected by fluorescence quantitative PCR instrument; (B) Endpoint fluorescence brightness graph observed by gel imaging instrument.
[0033] Figure 3 Sensitivity measurement of the RPA-CRISPR-Cas12a detection method. (A) Real-time fluorescence value graph detected by fluorescence quantitative PCR instrument; (B) Endpoint fluorescence brightness graph observed by gel imaging instrument.
[0034] Figure 4 Results of SGIV detection in clinical samples using RPA-CRISPR-Cas12a and PCR. (A) Real-time fluorescence images of clinical samples detected by RPA-CRISPR-Cas12a using a fluorescence quantitative PCR instrument; (B) Endpoint fluorescence brightness images of clinical samples observed by RPA-CRISPR-Cas12a using a gel imaging instrument; (C) Electrophoresis results of nucleic acid detection in clinical samples using PCR. DETAILED DESCRIPTION
[0035] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0036] Example 1: Design of RPA-CRISPR-Cas12a primers and probes for detecting SGIV
[0037] (1) RPA primer design for the SGIV major structural protein MCP: Based on the SGIV MCP gene sequence (YP_164167.1) published in GenBank, specific primers were designed using PrimerPremier 5.0 software according to the RPA primer design principles and the instructions of Twist DX: forward primer MCP-207F (SEQ ID NO. 1) and reverse primer MCP-207F (SEQ ID NO. 2). RPA specific primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer information is as follows:
[0038] SEQ ID NO.1: AAACCTAATGCACAACGCTGTAGAGCACGCTTCT;
[0039] SEQ ID NO. 2: GGGTAGTGTCCTTGCGCCGTCCTGACCCTGA.
[0040] (2) Design of crRNA and sequence specificity analysis: The sequence amplified by MCP-207F / R in the RPA reaction was used as the target sequence. According to the PAM sequence of LbCas12a, which is 5'-TTTN-3' (where N is an arbitrary nucleotide), the PAM sequence in the target sequence was searched, and the 20 to 23 nucleotides after the PAM sequence were selected and could not overlap with the sequence of the RPA primer. The sequence specificity was compared and analyzed using NCBI online BLAST to confirm whether the sequence was only present in SGIV. A hairpin structure fixed by LbCas12a was added before the 5' end of 20 nucleotides. crRNA (SEQ ID NO.3) was synthesized by Shanghai Bioengineering Co., Ltd.
[0041] SEQ ID NO. 3: UAAUUUCUACUAAGUGUAGAUGACGCUUGGACACAGUUUAA.
[0042] (3) Design of ssDNA-FQ reporter probe: Based on the trans-cleavage activity of CRISPR-Cas12a, ssDNA-FQ was non-specifically cleaved to design the ssDNA-FQ reporter probe required for the fluorescence detection system. Since the LbCas12a protein has better cleavage activity for adenine A and thymine T, the basic sequence of ssDNA-FQ was selected as TTATT, with a fluorescent reporter group FAM group added to the 5' end and a fluorescent quencher group BHQ1 group added to the 3' end. The ssDNA-FQ reporter probe was synthesized by Shanghai Bioengineering Co., Ltd.
[0043] The sequence structure of the ssDNA-FQ reporter probe is: 5'-FAM-TTATT-BHQ1-3'.
[0044] Example 2: RPA-CRISPR-Cas12a reaction system for detecting SGIV
[0045] (1) RPA reaction amplification: According to Twist The reaction system was prepared according to the instructions in the Basic Kit (purchased from Twist DX) and a standard RPA amplification reaction was performed. The specific experimental steps are as follows: ① The reaction system was prepared according to the kit instructions. To the RPA reaction tube, 29.5 μL of Primer Free Rehydration Buffer, 2.4 μL of Primer A (MCP-207F), 2.4 μL of Primer B (MCP-207R), 2 μL of DNA template (standard plasmid pcDNA3.1-3×HA-MCP), and 11.2 μL of RNase-free water were added for a total volume of 47.5 μL. Sterile water was used as a negative control. ② After thoroughly mixing the components in the reaction tube, 2.5 μL of 280 mmol / L MgOAc was added and the tube was incubated in a 39°C water bath for 20 minutes. After the reaction, the amplified product was purified using phenol / chloroform (1:1, volume ratio). 2 μL of the purified RPA amplified product was used as the target DNA for the subsequent CRISPR-Cas12a reaction.
[0046] (2) RPA-CRISPR-Cas12a reaction system and detection process: The RPA-CRISPR-Cas12a reaction system was determined according to the instructions of LbCas12a (Tolo Biotechnology Co., Ltd.) and the applicable concentrations of crRNA and ssDNA. ① The reaction system was as follows: 10×HOLMES Buffer (Tolo Biotechnology Co., Ltd.) 2 μL, LbCas12a 0.5 μL (using concentration 4 μmol / L), crRNA 0.5 μL (using concentration 2 μmol / L), ssDNA-FQ 0.5 μL (using concentration 6 μmol / L), Target DNA 2 μL, dd H2O 14.5 μL, and the total reaction volume was 20 μL. ② Place a 0.2mL centrifuge tube on ice and add the RPA-CRISPR-Cas12a reaction components as described above. Mix thoroughly and transfer to a quantitative plate. After a brief centrifugation, place the tube on a QuantStudio5 fluorescence quantitative PCR instrument (ABI). Set the FAM fluorescence detection channel and incubate at 37°C for 1 hour. Measure the fluorescence intensity every 30 seconds. Save the data after completion and analyze the final fluorescence peak and the time to reach the peak. ③ After the reaction, transfer the reaction product to a 0.2mL centrifuge tube and place it in an 85°C constant temperature water bath for 5 minutes to inactivate it. After completion, place it on a gel and chemiluminescence imaging system (BIO-RAD). Select the blue light channel to observe the fluorescence state, take pictures, record, and analyze. Figure 1 Schematic diagram of the SGIV detection method based on RPA-CRISPR-Cas12a.
[0047] Example 3: Specificity evaluation of RPA-CRISPR-Cas12a detection
[0048] To validate the specificity of RPA-CRISPR-Cas12a detection, genomic DNA from SGIV, LMBV, ISKNV, Vibrio harveyi, Aeromonas hydrophila, and Streptococcus agalactiae was used as templates for RPA-CRISPR-Cas12a detection, with sterile water serving as a negative control. RPA-CRISPR-Cas12a reactions were performed under the optimal detection system to evaluate the pathogen specificity of the target RPA-CRISPR-Cas12a detection method.
[0049] (1) DNA extraction of samples:
[0050] DNA from virus-infected cells, bacterial pathogens, or clinical fish tissue samples was extracted using the tissue / cell genomic DNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.) according to the instructions. The specific steps are as follows: a. Centrifuge the homogenate of ground fish tissue, virus-infected cells, or bacterial culture at 10,000 rpm for 1 minute, pour off the supernatant, add 200 μL of buffer GA, and shake until thoroughly suspended; b. Add 20 μL of proteinase Mix the K solution and place it at 56°C until the tissue is dissolved; c. Add 200 μL of buffer GB, mix thoroughly by inversion, and place it at 70°C for 10 minutes until the solution becomes clear; d. Add 200 μL of anhydrous ethanol, shake and mix thoroughly for 15 seconds, and a flocculent precipitate will appear; e. Add the above solution to the adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube; f. Add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid; g. Repeat step f; h. Place column CB3 back into the collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the waste liquid and place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material. i. Transfer the adsorption column CB3 to a clean centrifuge tube and dropwise add 50-200 μL of elution buffer TE to the middle part of the adsorption membrane. Place the tube at room temperature for 2-5 minutes and centrifuge at 12,000 rpm for 2 minutes. Collect the solution into a centrifuge tube. j. Determine the concentration and purity of the extracted DNA using a NanoDrop 2000 ultra-micro nucleic acid analyzer (Thermo) and store at -20°C until use.
[0051] The genomic DNA of Vibrio harveyi, Aeromonas hydrophila, and Streptococcus agalactiae was extracted according to the instructions of the bacterial genomic DNA rapid extraction kit (Guangzhou Double Helix Gene Technology Co., Ltd.). The specific steps are as follows: a. Perform pre-enrichment treatment in accordance with GB 4789 or other industry standards; b. Take 1-2 mL of the enrichment solution, centrifuge at 10,000 rpm for 3-5 minutes, and discard the supernatant; c. Add 500 μL of sterile 0.9% NaCl aqueous solution or medical saline, vortex mix vigorously, centrifuge at 10,000 rpm for 3-5 minutes, and discard the supernatant; d. Vortex mix the extract, add 100-300 μL of the extract to the precipitate, vortex mix vigorously, heat at 100°C for 5-10 minutes, and quickly cool (place in a refrigerator) for 10 minutes after heating; e. Centrifuge at 10,000 rpm for 3 minutes, transfer the supernatant to a new centrifuge tube for use, and the resulting supernatant is the extracted genomic DNA; f. The concentration and purity of the extracted DNA are measured using a NanoDrop2000 ultra-micro nucleic acid analyzer (Thermo) and stored at -20°C for use.
[0052] (2) Detection of samples by RPA-CRISPR-Cas12a: The DNA extracted in (1) was used as a template and amplified using the RPA reaction system in (1) of Example 2. The amplified and purified product was used as the target DNA for RPA-CRISPR-Cas12a. Detection was performed according to the RPA-CRISPR-Cas12a reaction system and detection process in (2) of Example 2. Figure 2 As shown in the figure, the SGIV group can detect obvious fluorescence values, while the other pathogen groups and the negative control group have almost no obvious fluorescence values. The end point fluorescence brightness diagram shows that the SGIV group produces obvious fluorescence signals, while the other pathogen groups and the negative control group do not produce fluorescence signals ( Figure 2 ). Therefore, RPA-CRISPR-Cas12a detection has strong specificity.
[0053] Example 4: Sensitivity evaluation of RPA-CRISPR-Cas12a detection
[0054] (1) Construction of recombinant plasmid standard pcDNA3.1-3×HA-MCP: Escherichia coli competent cells DH5α were purchased from Guangzhou Qingke Biotechnology Co., Ltd. The specific steps for constructing the recombinant plasmid standard pcDNA3.1-3×HA-MCP are as follows: a. The genomic DNA of SGIV-infected cells extracted in Example 3 was used as a template to perform PCR amplification on the target gene sequence. The primer information used for amplification was MCP-KZ-F: ATGACTTGTACAACGGGTGCTGG, MCP-KZ-R: TTACAAGATAGGGAACCCCATGGAACC). After amplification, the OMEGA GAL Extraction Kit was used to perform gel excision and recovery according to the instructions to obtain a purified target fragment; b. The recovered target fragment and the pcDNA3.1-3×HA vector were double-enzyme digested and ligated. The ligation product was transformed into DH5α competent cells, plated on a solid LB plate containing ampicillin, and cultured at 37°C overnight; c. Monoclonal colonies were picked for bacterial liquid PCR, and the positive monoclonal bacterial liquid was sent for sequencing; d. The correctly sequenced strain was inoculated into LB liquid medium containing ampicillin and cultured at 37°C with shaking; e. The plasmid was extracted according to the instructions of the plasmid extraction kit. After the extraction, the concentration of the extracted plasmid was measured using a NanoDrop2000 ultra-micro nucleic acid analyzer and the plasmid was placed at -20°C for use.
[0055] (2) Calculation of plasmid copy number: The copy number of the extracted plasmid was calculated according to the following formula: copies / μL = 6.02 × 1023 × plasmid concentration (ng / μL) × 10 -9 / (plasmid base number × 660).
[0056] (3) Dilute the extracted plasmid to 10 7 The plasmid standard was diluted 10-fold with deionized water to obtain a concentration of 10 copies / μL. 6 -10 0 The diluted standard was used as a template and the detection was performed according to the RPA-CRISPR-Cas12a reaction system and detection process in Example 2 (2). Figure 3 As shown in the real-time fluorescence numerical graph, the concentration of 10 1 -10 6 The plasmid standard with a concentration of 10 copies / μL detected a significant fluorescence value and the endpoint fluorescence value was significantly higher than that of the plasmid standard with a concentration of 1 copy / μL. Similarly, it can be seen from the endpoint fluorescence brightness graph that 10 2 -10 6 The plasmid standard with 10 copies / μL produced a strong fluorescence signal. 1 The plasmid standard with a concentration of 1 copy / μL produced a weak fluorescence signal, while the plasmid standard with a concentration of 1 copy / μL and the negative control did not produce any fluorescence signal. This indicates that the minimum detection limit of RPA-CRISPR-Cas12a detection is 10 1 copies / μL( Figure 3 ).
[0057] Example 5: Detection of clinical samples based on RPA-CRISPR-Cas12a
[0058] 12 clinical fish samples suspected of being infected with SGIV were collected from grouper farms in Guangdong and Hainan and artificially infected in the recirculating aquaculture system of South China Agricultural University. RPA-CRISPR-Cas12a and PCR (primers MCP-PCR-F: AACCAGTGGCTTCATAGATTTG, MCP-PCR-R: AAAGAACGGCAACGGGAGC) were used to detect SGIV in clinical samples under optimal reaction conditions, and the clinical practicality and accuracy of the RPA-CRISPR-Cas12a detection method were analyzed. The sample tissue DNA was extracted using the method in (1) of Example 3, and the extracted DNA was used as a template for detection according to the RPA-CRISPR-Cas12a reaction system and detection process in (2) of Example 2. Figure 4As shown in the real-time fluorescence value graph, only samples 5, 7, 8 and the negative control were not detected with obvious fluorescence values, while other samples and the positive control were detected with obvious fluorescence values. Figure 1 The results of PCR showed that no target bands were amplified in samples 5, 7, 8 and negative controls, which was consistent with the results of RPA-CRISPR-Cas12a detection ( Figure 4 ). Therefore, RPA-CRISPR-Cas12a detection has high accuracy and detection practicality for clinical samples.
[0059] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements or improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A detection kit for detecting grouper iridescent virus SGIV using RPA-CRISPR-Cas12a, characterized in that: It includes a specific RPA primer pair for detecting SGIV, crRNA, a fluorescent reporter probe and a Cas12a enzyme, wherein the RPA primer pair includes an upstream primer whose nucleotide sequence is shown in SEQ ID NO.1 and a downstream primer whose nucleotide sequence is shown in SEQ ID NO.2; the nucleotide sequence of the crRNA is shown in SEQ ID NO.
3.
2. The detection kit according to claim 1, characterized in that The sequence of the fluorescent reporter probe is TTATT, wherein the 5' end is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quencher group BHQ1.
3. The detection kit according to claim 1, characterized in that The kit also includes a positive plasmid standard, an enzyme dry powder mixture, a rehydration buffer, sterile water, a magnesium acetate solution, and a 10× HOLMES Buffer.
4. Use of the detection kit according to any one of claims 1 to 3 in the preparation of a product for detecting grouper iridovirus SGIV.
5. The use according to claim 4, characterized in that The detection of grouper iridovirus SGIV comprises the following steps: (1) Extracting genomic DNA from the sample to be tested; (2) performing RPA specific amplification using the primer pair described in claim 1 to obtain an amplified product; (3) Add the amplified product to a reaction system containing crRNA, fluorescent reporter probe, 10× HOLMES Buffer and Cas12a enzyme to perform CRISPR / Cas12a reaction; (4) Interpretation of RPA-CRISPR-Cas12a reaction results: Detect the fluorescence value through a real-time fluorescence instrument or observe the fluorescence signal with the naked eye under blue light irradiation of a gel imaging system.
6. The use according to claim 5, characterized in that The fluorescence value detected by the real-time fluorescence instrument indicates that the sample contains SGIV virus, and no fluorescence value is detected, which indicates that the sample does not contain SGIV virus. When the reaction product is detected by a gel imager, the emission of a fluorescence signal under blue light indicates that the sample contains SGIV virus, and the absence of a fluorescence signal indicates that the sample does not contain SGIV virus.
7. The use according to claim 5, characterized in that The conditions for RPA specific amplification in step (2) are: a constant temperature amplification reaction at 37-42°C for 20 min.
8. The use according to claim 5, characterized in that The conditions of the CRISPR / Cas12a reaction in step (3) are: incubation at 37°C for 1 h.
Citation Information
Patent Citations
LFD-RPA primer probe group, kit and detection method for detecting iridovirus of micropterus salmoides
CN116042910A
Multi-target double-dye isothermal amplification rapid detection method and kit
WO2021164050A1