A method for obtaining TCR diversity information of non-model species

Abstract

The present invention provides a method for obtaining TCR diversity information of T cell receptors of non-model species, including: obtaining reference genome data of non-model target species and TCR data of homologous species and collating and annotating them to obtain TCR data of target species; using TCR data to create a reference database; determining primer design regions based on TCR data and designing primers for the region to target amplify the TCR region of the target species, thereby constructing a TCR library of the target species and sequencing and analyzing it to obtain TCR diversity information of the target species. The present invention also relates to primers for the construction of single-cell TCR repertoires and their applications. The method of the present invention can be applied to non-model species with unknown or incomplete TCR information, so that TCR repertoire research is no longer limited to specific species, and the designed primer set is species-specific and covers the TCR region, thereby improving the integrity and accuracy of TCR diversity information analysis.

Description

Technical Field

[0001] The present invention relates to the technical field of bioinformatics, and more specifically, to a method for obtaining TCR diversity information of non-model species T cell receptors, a universal multiplex PCR primer set for constructing a single-cell TCR repertoire, and its application in constructing a single-cell TCR repertoire and obtaining TCR diversity information. Background Art

[0002] The immune repertoire (IR) refers to the sum of all functionally diverse B cells and T cells in the circulation system of an individual at any given time. The T cell repertoire (TCR repertoire) refers to the sum of T cell clones in the immune circulation of the body at a specific time, and its diversity is closely related to human health.

[0003] The T cell receptor (TCR) is composed of α chain and β chain or γ and δ chain, of which αβ TCR is the most common form. The TCR gene is composed of multiple gene segments, including the variable region (V), the variable region (D, β chain), the joining region (J) and the constant region (C), namely the V(D)J structure. The diversity of TCR is generated by the random rearrangement of V(D)J gene segments, especially in the antigen complementarity determining region (CDR3), which leads to a high degree of TCR diversity. By targeted amplification of TCR CDR3, the complete diversity information of the TCR repertoire within a specific time can be effectively obtained.

[0004] Traditional immune repertoire research techniques can often only detect the sequence information of one chain of TCR, and cannot evaluate the diversity of the immune system at the level of a single cell. The single-cell immune repertoire sequencing technology (scVDJ-seq) launched by 10x Genomics can simultaneously obtain the sequence diversity of the α chain and β chain of TCR of a single cell, providing a more efficient platform for immunogenomic research, and has broad application prospects in research fields such as tumor microenvironment, infectious diseases, and autoimmune diseases.

[0005] However, 10x Genomics' single-cell immune repertoire sequencing technology currently only supports human and mouse samples, because the immune systems of these two species have been studied in depth, the corresponding reference sequence information and analysis methods are relatively mature, and there are supporting TCR region enrichment primers and bioinformatics analysis methods. For non-model species, due to insufficient research, there are incomplete or unclear reference sequence information, so it is impossible to directly obtain the TCR region annotation and sequence information of the species, which further leads to the lack of TCR region enrichment primers suitable for scVDJ-seq and bioinformatics analysis methods for sequencing data, limiting related research on such species. Summary of the invention

[0006] (1) Technical issues to be solved

[0007] Since there is no TCR information or the TCR information is incomplete for non-model species, it is impossible to design primers for the TCR region of non-model species, and thus it is impossible to sequence and perform diversity analysis on the TCR region of non-model species.

[0008] (2) Technical solution

[0009] In a first aspect, the present invention provides a method for obtaining TCR diversity information of non-model species T cell receptors, the method comprising:

[0010] (1) retrieving and downloading the reference genome data of the target species from the NCBI database, wherein the target species is a non-model species;

[0011] (2) retrieving, downloading and organizing TCR data of homologous species from the IMGT database, wherein the homologous species is homologous to the target species;

[0012] (3) annotating the reference genome data of the target species and the TCR data of the homologous species through homologous comparison to obtain the TCR data of the target species;

[0013] (4) using the TCR data of the target species, creating a VDJ analysis reference database;

[0014] (5) determining the primer design region based on the TCR data of the target species;

[0015] (6) designing a universal multiple nested PCR primer set for the primer design region;

[0016] (7) using the universal multiple nested PCR primer set to target and amplify the TCR region of the target species, thereby constructing a TCR library of the target species;

[0017] (8) sequencing the TCR library of the target species to obtain sequencing data of the target species;

[0018] (9) Based on the VDJ analysis reference database, the sequencing data of the target species is analyzed to obtain TCR diversity information of the target species.

[0019] In a second aspect, the present invention provides a universal multiplex PCR primer set for single cell TCR repertoire construction, characterized in that the universal multiplex nested PCR primer set comprises five primers having nucleotide sequences as described in SEQ ID NOs. 1 to 5. Preferably, the universal multiplex PCR primer set consists of five primers having nucleotide sequences as described in SEQ ID NOs. 1 to 5.

[0020] The present invention provides, in a third aspect, the universal multiplex PCR primer set described in the second aspect of the present invention for use in constructing a cynomolgus monkey ( Macaca fascicularis ) Single cell TCR repertoire and cynomolgus monkey ( Macaca fascicularis )’s TCR diversity information.

[0021] (3) Technical Effect

[0022] The present invention uses homologous species with known TCR data as references, obtains TCR data of non-model species based on homologous comparisons, designs universal multiple nested PCR primer sets that can cover a variety of V genes and J genes, thereby establishing a non-model species TCR database and using the established TCR database to perform TCR diversity analysis, thereby improving the comprehensiveness and accuracy of the analysis results. Compared with the prior art, the present invention can achieve the following technical effects:

[0023] (i) The method of the present invention can be applied to non-model species with unknown or incomplete TCR information, so that the study of TCR repertoire is no longer limited to specific species.

[0024] (ii) The method of the present invention designs a universal multiple nested PCR primer set that is species-specific and covers the TCR region, thereby improving the completeness and accuracy of TCR diversity information analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The S1 sample showed that the J gene family of α chain and β chain was detected.

[0026] Figure 2 The S1 sample showed that the V gene family of α chain and β chain were detected.

[0027] Figure 3 The S2 sample showed that the J gene family of α chain and β chain was detected.

[0028] Figure 4 The S2 sample showed that the V gene family of α chain and β chain were detected.

[0029] Figure 5 The S3 sample showed that the J gene family of α chain and β chain was detected.

[0030] Figure 6The S3 sample showed that the V gene family of α chain and β chain were detected. DETAILED DESCRIPTION

[0031] As described above, the present invention provides, in a first aspect, a method for obtaining TCR diversity information of a non-model species T cell receptor, the method comprising:

[0032] (1) retrieving and downloading the reference genome data of the target species from the NCBI database, wherein the target species is a non-model species;

[0033] (2) retrieving, downloading and organizing TCR data of homologous species from the IMGT database, wherein the homologous species is homologous to the target species;

[0034] (3) annotating the reference genome data of the target species and the TCR data of the homologous species through homologous comparison to obtain the TCR data of the target species;

[0035] (4) using the TCR data of the target species, creating a VDJ analysis reference database;

[0036] (5) determining the primer design region based on the TCR data of the target species;

[0037] (6) designing a universal multiple nested PCR primer set for the primer design region;

[0038] (7) using the universal multiple nested PCR primer set to target and amplify the TCR region of the target species, thereby constructing a TCR library of the target species;

[0039] (8) sequencing the TCR library of the target species to obtain sequencing data of the target species;

[0040] (9) Based on the VDJ analysis reference database, the sequencing data of the target species is analyzed to obtain TCR diversity information of the target species.

[0041] In some preferred embodiments, the NCBI database in step (1) is the NCBI-Assembly database.

[0042] Preferably, the reference genome of the target species in step (1) is a representative genome. In the NCBI database, if a species has only one genome registered, then that genome is the representative genome of the species. If a species has multiple genomes registered, the database will indicate one of the genomes as the representative genome of the species. In step (1) of the method of the present invention, the reference genome of the target species is preferably the representative genome indicated by the database.

[0043] In the method of the present invention, the homologous species is preferably a species of the same genus as the target species.

[0044] It is also preferred that the reference genome data of the target species is a genome sequence file and a GTF annotation file of the target species.

[0045] Preferably, step (1) further comprises the step of processing the downloaded target species reference genome data as follows: using STAR software to create a reference genome index. More preferably, the --runMode parameter of the STAR software is set to genomeGenerate.

[0046] Preferably, in step (2), the TCR data of the homologous species includes the TCR α chain corresponding to TRA and the TCR β chain corresponding to TRB in the IMGT database.

[0047] It is also preferred that in step (2), the TCR data of the homologous species are the TRAV, TRAJ, TRAC, TRBV, TRBD, TRBJ and TRBC sequence files of the homologous species under the TR "V-REGION", "D-REGION", "J-REGION", "C-GENEexon" sets in the IMGT database.

[0048] Preferably, in step (2), the arrangement includes merging the TRA and TRB sequence files and replacing the spaces in the sequence names with underscores. Preferably, in step (3), the TCR data of the homologous species obtained in step (2) is aligned to the reference genome index of the target species obtained in step (1), and the alignment result BAM file is output. More preferably, the alignment is performed using STAR alignment software.

[0049] Preferably, in step (4), the BAM file is sorted to obtain TCR data of the target species. More preferably, the TCR data includes the sequence of the TCR region and VDJ gene annotation information.

[0050] It is further preferred that

[0051] Step (4) includes organizing the target species TCR data obtained in step (3) to comply with the input requirements of the Cell Ranger software mkvdjref command to obtain a VDJ analysis reference database of the target species; preferably, the content of the organization includes converting the sequence to uppercase, extracting gene annotation information and standardizing the sequence naming.

[0052] Preferably, in step (5), the TCR data of the target species is the TCR sequence of the target species and the VDJ gene annotation information of the sequence, and the primer design region is the conserved region in the TCR sequence; preferably, the primer design region is the EX1 region of TCR. In step (6), a universal multiple nested PCR primer set is designed for the primer design region. Preferably, in the primer design region, a forward universal primer is designed upstream of the region using Primer3 software, and a reverse inner primer and a reverse outer primer are designed downstream of the region to be used in conjunction with the forward universal primer, respectively, and the universal multiple amplification primer is used to target the amplification of the TRA and TRB regions of the target species.

[0053] In the present invention, only one forward universal primer is designed, and two downstream reverse primers (i.e., a reverse inner primer and a reverse outer primer) are designed downstream to be used in pairs with the upstream universal primer, respectively, so that multiple genes can be covered. Therefore, these primers are called "universal multiple nested PCR primer set" in the present invention.

[0054] Preferably, the universal multiplex nested PCR primer set can amplify VDJ gene sequences in the TRA and TRB regions. Also preferably, the universal multiplex nested PCR primer set can cover the diversity of the TRA and TRB regions, respectively.

[0055] It is further preferred that the sequence of the forward universal primer is as shown in SEQ ID NO. 1; the reverse outer primer includes a first reverse outer primer for TRA region amplification having a nucleotide sequence as shown in SEQ ID NO. 2 and a second reverse outer primer for TRB region amplification having a nucleotide sequence as shown in SEQ ID NO. 4; the reverse inner primer includes a first reverse inner primer for TRA region amplification having a nucleotide sequence as shown in SEQID NO. 3 and a second reverse inner primer for TRB region amplification having a nucleotide sequence as shown in SEQ ID NO. 5.

[0056] The universal multiplex nested PCR primer set designed according to the method of the present invention only requires a small number of primer pairs to effectively cover the diversity of T cells of non-model target species.

[0057] It is also preferred that in step (9), the analysis is performed using Cell Ranger software.

[0058] Preferably, the non-model species is an animal species other than humans and mice. More preferably, the non-model species is a Macaca mulatta ( Macaca ). It is further preferred that the non-model species is cynomolgus monkey ( Macaca fascicularis ).

[0059] In a second aspect, the present invention provides a universal multiplex nested PCR primer set for single cell immune repertoire, the universal multiplex nested PCR primer set comprising five primers having nucleotide sequences as described in SEQ ID NOs. 1 to 5. Preferably, the multiplex nested PCR primer set consists of five primers having nucleotide sequences as described in SEQ ID NOs. 1 to 5.

[0060] The present invention provides, in a third aspect, the multiple nested PCR primer set described in the second aspect of the present invention for constructing a cynomolgus monkey ( Macaca fascicularis ) Single cell TCR repertoire and cynomolgus monkey ( Macaca fascicularis )’s TCR diversity information. Example

[0061] The present invention will be further described below in the form of examples, but the scope of the present invention is not limited to these examples. Unless otherwise specified, the raw materials used in the examples are all commercially available conventional raw materials.

[0062] Example 1

[0063] This embodiment provides a method for obtaining T cell receptor TCR diversity information of a non-model species, the method comprising:

[0064] (1) Retrieve and download the target species cynomolgus monkey ( Macaca fascicularis ) (i.e., cynomolgus monkey genome sequence file and GTF annotation file) were used to create a reference genome index using STAR software with the --runMode parameter of STAR software set to genomeGenerate;

[0065] (2) Retrieve and download the rhesus macaque species homologous to the cynomolgus macaque from the IMGT database (https: / / www.imgt.org / vquest / refseqh.html) (Macaca mulatta According to the search, the only species in the same genus as the crab-eating macaque is the rhesus macaque) TCR data (i.e., TRAV, TRAJ, TRAC, TRBV, TRBD, TRBJ, TRBC sequence files under the TR "V-REGION", "D-REGION", "J-REGION", "C-GENEexon" sets of the IMGT database). The downloaded sequence files were merged and the spaces in the sequence names were replaced with underscores.

[0066] (3) Using STAR software, through homologous alignment, annotation is performed based on the reference genome data of the target species and the TCR data of the homologous species to obtain the target species TCR data (i.e., the sequences and gene annotation data of the TCR α chain and β chain of the cynomolgus macaque are obtained), that is, the homologous species TCR sequence data obtained in step (2) is aligned to the reference genome index of the target species obtained in step (1), and the aligned BAM file is output.

[0067] (4) organizing the target species TCR data (including TCR sequence and gene annotation information) obtained in step (3) to meet the input requirements of the Cell Ranger software mkvdjref command, including converting the sequence to uppercase, extracting gene annotation information and standardizing the sequence naming, thereby using the target species TCR data to create a VDJ analysis reference database for use in TCR diversity analysis of the target species in subsequent steps;

[0068] (5) Based on the target species TCR data (including the TCR sequence and gene annotation information of the target species), determine the primer design region, specifically the EX1 region of TCR;

[0069] (6) Design multiple nested amplification primers covering multiple TCR genes for the primer design region; specifically, use Primer3 software to design a forward universal primer upstream of the primer design region, and design a reverse inner primer and a reverse outer primer (for specific sequences, see Table 1 below) to be used in conjunction with the forward universal primer downstream of the region. Then use these primers to target and amplify the TCR region of the target species.

[0070] (7) The TCR region of the target species is targeted and amplified using the amplification primers designed in step (6), thereby constructing a single-cell TCR group library of the target species. The upstream primers are uniformly set to: GATCTACACTCTTTCCCTACACGACGC (SEQ ID NO. 1). To ensure the amplification efficiency and specificity of the downstream primers paired therewith, the downstream primers are respectively set to outer primers and inner primers, as shown in Table 1 below; Based on these primers, the DNA TCRs of three cynomolgus monkey samples are amplified by multiple PCR and a sequencing library is constructed to obtain a single-cell TCR group library.

[0071] (8) using the Illumina NovaSeqX Plus system (Illumina, Inc., USA) to sequence the single-cell TCR repertoire of the target species to obtain sequencing data of the target species;

[0072] (9) Based on the target species VDJ analysis reference database, the target species sequencing data is subjected to bioinformatics analysis using Cell Ranger software to obtain TCR diversity information of the target species.

[0073] The results are shown in Table 2 and Figures 1 to 4 shown.

[0074] Table 1. Primer sequences for detecting the immune repertoire of cynomolgus monkeys

[0075]

[0076] Table 2. Statistics of data results from three cynomolgus monkey samples

[0077]

[0078] As shown in Table 2, the TCR sequencing of the three cynomolgus macaque samples detected the TRAJ and TRAV gene families on the α chain, and the TRBJ and TRBV gene families on the β chain (e.g. Figures 1 to 6 As shown), it can be determined that the multiple nested PCR primers designed by the present invention for detecting the TCR region of cynomolgus monkeys and the constructed supporting reference database can effectively cover the diversity of T cells.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the main purpose of the technical solutions of the embodiments of the present invention.

Claims

1. A method for obtaining a non-model species, cynomolgus monkey ( Macaca fascicularis ) T cell receptor TCR diversity information, characterized in that, The method comprises: (1) retrieving and downloading reference genome data of the target species from the NCBI database, wherein the target species is a non-model species; (2) retrieving and downloading TCR data of homologous species from the IMGT database and collating them, wherein the homologous species is homologous to the target species; (3) annotating the reference genome data of the target species and the TCR data of the homologous species through homologous comparison to obtain the TCR data of the target species; (4) using the TCR data of the target species, creating a VDJ analysis reference database; (5) Based on the TCR data of the target species, determining that the primer design region is the EX1 region of TCR; (6) Designing a universal multiple nested PCR primer set for the primer design region, wherein a forward universal primer is designed upstream of the primer design region, and a reverse inner primer and a reverse outer primer are designed downstream of the region to be used in conjunction with the forward universal primer, respectively, wherein the sequence of the forward universal primer is as shown in SEQ ID NO. 1; the reverse outer primer comprises a first reverse outer primer for amplifying the TRA region having a nucleotide sequence as shown in SEQ ID NO. 2 and a second reverse outer primer for amplifying the TRB region having a nucleotide sequence as shown in SEQ ID NO. 4; the reverse inner primer comprises a first reverse inner primer for amplifying the TRA region having a nucleotide sequence as shown in SEQ ID NO. 3 and a second reverse inner primer for amplifying the TRB region having a nucleotide sequence as shown in SEQ ID NO. 5; (7) using the universal multiple nested PCR primer set to target and amplify the TCR region of the target species, thereby constructing a TCR library of the target species; (8) sequencing the TCR library of the target species to obtain sequencing data of the target species; (9) Based on the VDJ analysis reference database, the sequencing data of the target species is analyzed to obtain TCR diversity information of the target species.

2. The method according to claim 1, characterized in that: In step (1): The NCBI database is the NCBI-Assembly database; The reference genome of the target species is a representative genome; and / or The reference genome data of the target species are the genome sequence file and GTF annotation file of the target species.

3. The method according to claim 1, characterized in that Step (1) also includes the step of processing the downloaded reference genome data of the target species as follows: creating a reference genome index using STAR software, wherein the --runMode parameter of the STAR software is set to genomeGenerate.

4. The method according to any one of claims 1 to 3, It is characterized by: In step (2), the TCR data of the homologous species includes TRA, i.e., TCR α chain, and TRB, i.e., TCR β chain, from the IMGT database; In step (2), the TCR data of the homologous species are the TRAV, TRAJ, TRAC, TRBV, TRBD, TRBJ and TRBC sequence files of the homologous species under the TR "V-REGION", "D-REGION", "J-REGION", "C-GENE exon" sets in the IMGT database; In step (2), the arrangement includes merging the TRA and TRB sequence files and replacing spaces in the sequence names with underscores; and / or In step (5), the TCR data of the target species is the TCR sequence of the target species and the VDJ gene annotation information of the sequence.

5. The method according to any one of claims 1 to 3, characterized in that: In step (3), the TCR data of the homologous species obtained in step (2) is aligned to the reference genome index of the target species obtained in step (1), and the alignment result BAM file is output; In step (3), the alignment is performed using STAR software; In step (4), the BAM file is sorted to obtain TCR data of the target species, wherein the TCR data includes the sequence of the TCR region and VDJ gene annotation information; step (4) includes sorting the target species TCR data obtained in step (3) to meet the input requirements of the mkvdjref command of the Cell Ranger software to obtain a VDJ analysis reference database of the target species; The content of the arrangement includes converting the sequence to uppercase, extracting gene annotation information and standardizing sequence naming; and / or In step (9), the analysis is performed using Cell Ranger software.

6. The method according to any one of claims 1 to 3, characterized in that: In the primer design region, the universal multiplex nested PCR primer set is designed using Primer3 software, and the universal multiplex nested PCR primer set is used to target and amplify the TRA and TRB regions of the target species.

7. The method according to any one of claims 1 to 3, characterized in that: The universal multiplex nested PCR primer set targets and amplifies the VDJ gene sequences in the TRA and TRB regions.

8. The method according to any one of claims 1 to 3, characterized in that: The universal multiplex nested PCR primer set can cover the diversity of TRA and TRB regions respectively.

9. A universal multiplex nested PCR primer set for single cell TCR repertoire construction, characterized in that: The universal multiple nested PCR primer set includes five primers whose nucleotide sequences are shown as SEQ ID NOs. 1 to 5.

10. The universal multiple nested PCR primer set of claim 9 is used to construct the cynomolgus monkey ( Macaca fascicularis ) Single cell TCR repertoire and cynomolgus monkey ( Macaca fascicularis )’s TCR diversity information.

Images