Soluble antimicrobial microneedle patch for deliverable adipose tissue apoptotic vesicles, methods of making and use thereof
By designing a soluble antibacterial microneedle patch, combining apoptotic vesicles from adipose tissue and an antibacterial substrate, the complexity and trauma problems of traditional injection methods were solved, achieving painless and non-invasive treatment of infected wounds, and promoting the healing of infected wounds and high-quality skin regeneration.
Patent Information
- Application Number
- CN202410824663.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-25
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-06-25
AI Technical Summary
In the existing technology, the traditional injection method of apoptotic vesicles is complex, has poor patient tolerance, is prone to secondary trauma, and the bacterial biofilm on the infected wound affects the efficacy. The preparation of stem cell exosome microneedles is limited by the cell source and extraction efficiency. Long-term use of antibiotics may lead to drug resistance. The drug dissolution medium affects the wound microenvironment, making it difficult to achieve painless, non-invasive and effective treatment of infected wounds.
A soluble antibacterial microneedle patch was designed, which includes a microneedle matrix and an antibacterial substrate. The microneedle matrix is composed of apoptotic vesicles from adipose tissue and methacryloylated hyaluronic acid hydrogel, and the substrate is composed of methacryloylated hyaluronic acid and methacryloylated polylysine hydrogel. It is prepared by 3D printing and UV light curing to achieve painless and non-invasive drug delivery. The antibacterial substrate inhibits bacterial growth and promotes wound healing.
It achieves the painless, non-invasive and slow release of apoptotic vesicles in adipose tissue, inhibits bacterial colonization and growth in wounds, promotes high-quality healing of infected wounds and skin regeneration, reduces scar formation, and is suitable for engineering mass production and clinical application.
Smart Images

Figure CN118806687B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of medical biomaterials, and particularly relates to a soluble antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles, a preparation method and application thereof. BACKGROUND
[0002] The incidence and mortality of acute and chronic wound infections remain high, which brings a huge burden to the global health care system. Although the treatment strategy for infected wounds has been standardized, biofilm formation, delayed healing, and drug resistance make the diagnosis and treatment of wound infections still face great challenges. For diabetic patients, wound infection can also cause difficult-to-heal diabetic foot ulcers. Therefore, it is of great significance to develop a new treatment strategy to promote the healing of infected wounds.
[0003] The transplantation of adipose tissue or its components is a high-potential wound treatment strategy. Some studies have achieved good therapeutic effects in treating skin wounds with adipose tissue, but the underlying mechanism is not clear. The theory that cells release growth factors, cytokines and extracellular vesicles (such as exosomes) through paracrine after cell transplantation has been widely recognized. However, recent studies have found that transplanted cells undergo extensive apoptosis in a short time, and the process of cell apoptosis may play a direct role in the regenerative capacity of transplanted cells. The vesicles formed during the process of apoptosis are called apoptotic vesicles.
[0004] Apoptotic vesicles are double-layered vesicles containing various proteins, lipids and regulatory nucleic acids, and the outer membrane of the exosome layer can prevent the degradation of the contents. Adipose tissue-derived apoptotic vesicles can be directly extracted from the adipose tissue obtained by liposuction, which has a wide source and a simple extraction process. The nanoscale particle size is suitable for minimally invasive drug delivery methods. Apoptotic vesicles not only have the advantages of other extracellular vesicles such as exosomes, such as not needing to consider cell activity, avoiding the risk of tumorigenesis, low immunogenicity, etc., but also have higher efficiency in producing apoptotic vesicles compared to exosomes produced by living cells. The process of cell apoptosis can be completely controlled through standardized operations, and apoptotic vesicles are more suitable for engineered mass production and clinical translation applications than exosomes.
[0005] The construction of an apoptotic vesicle drug delivery system is an important carrier for its clinical translation. In existing studies, apoptotic vesicles are mainly injected into the lesion site through multiple points and multiple times of traditional injection. This operation method is complex, has poor patient tolerance, and requires professional personnel to operate. The needle holes generated during the injection process can also cause secondary trauma and secondary infection to the patient. In addition, the bacterial biofilm of infected wounds can have unpredictable effects on the efficacy of the vesicles.
[0006] Patent CN 116440060 A discloses a preparation method of a microneedle loaded with stem cell exosomes to promote rapid epithelialization of the region. However, the preparation of existing stem cell exosome microneedle patches is limited by the source of stem cells and the extraction efficiency of cell exosomes, making it difficult to achieve mass production. Patent CN 115381767A discloses a microneedle patch for preventing or treating skin infection and a preparation method thereof. The microneedle of the patent contains a modified natural bactericide and nanotigecycline, and the substrate contains a bacteriostatic agent. Tigecycline is a broad-spectrum antibiotic commonly used to treat various microbial infections caused by multiple drug-resistant gram-positive and gram-negative pathogens. Although it can quickly play a bacteriostatic role as a microneedle tip, its long-term use can cause antibiotic resistance in bacteria, which is a long-term and irreversible damage to patients with chronic infections. Furthermore, in the patent, the ratio of sucrose to sodium chloride is adjusted as a drug dissolution medium. Whether as a tip or a substrate, if the osmotic pressure does not match the skin wound, it will affect the microenvironment of the wound edge cells, and thus affect wound healing and cell regeneration.
[0007] Therefore, there is an urgent need to develop a painless, non-invasive and antibacterial drug delivery carrier with a wide range of raw materials, so that apoptotic vesicles can be effectively controlled and released at infected wounds, while inhibiting the growth of bacteria on the wound, thereby promoting the healing of infected wounds and high-quality skin regeneration. SUMMARY
[0008] One of the purposes of the present application is to provide a soluble antibacterial microneedle patch that can deliver adipose tissue apoptotic vesicles, which can achieve painless and non-invasive drug delivery, inhibit the colonization, growth and proliferation of bacteria on the wound, and slowly release adipose tissue apoptotic vesicles at the diseased site to promote the healing of infected wounds and high-quality skin regeneration.
[0009] The second purpose of the present application is to provide a preparation method of the soluble antibacterial microneedle patch.
[0010] The third purpose of the present application is to provide an application of the soluble antibacterial microneedle patch.
[0011] To achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows:
[0012] The soluble antibacterial microneedle patch for delivering adipose tissue apoptotic vesicles (ApoEVs-AT) disclosed by the present application comprises a microneedle matrix and an antibacterial substrate. The microneedle matrix comprises adipose tissue apoptotic vesicles and methacrylated hyaluronic acid hydrogel. The substrate comprises methacrylated hyaluronic acid hydrogel and methacrylated polylysine hydrogel.
[0013] In some embodiments of the present application, the mass ratio of the methacrylated hyaluronic acid hydrogel and the methacrylated polylysine hydrogel in the substrate is 3-10:3-5; preferably 5:4.
[0014] In some embodiments of the present application, the content of the adipose tissue apoptotic vesicles in each microneedle patch is 320-480 μg / piece.
[0015] In some embodiments of the present application, the diameter of the microneedle base is 250-300 μm, the height of the microneedle is 600-800 μm, and the distance between the tips of the microneedles is 550-700 μm; preferably, the size of the patch and the number of microneedles are adapted to the size of the wound.
[0016] The present application discloses a preparation method of a soluble antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles, comprising the following steps:
[0017] Step 1. Preparation of bio-ink: mixing adipose tissue apoptotic vesicles with a methacrylated hyaluronic acid hydrogel solution to form a bio-ink;
[0018] Step 2. Preparation of a mixed antibacterial hydrogel solution of methacrylated hyaluronic acid and methacrylated polylysine water (HAMA / PLMA);
[0019] Step 3. Dropping the bio-ink into the mold, removing bubbles, heating and concentrating;
[0020] Preferably, after concentration, the bio-ink is added again, heated and concentrated;
[0021] Step 4. Adding the mixed antibacterial hydrogel solution to the mold again, heating and concentrating to prepare an antibacterial substrate;
[0022] Step 5. UV light curing, demolding to obtain a soluble antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles.
[0023] The preparation method of the mold of the present application is a prior art. As some embodiments of the present application, the preparation method of the mold comprises the following steps: 3D printing a resin microneedle positive mold, and preparing a polydimethylsiloxane mold by molding method; the specifications of the resin microneedle positive mold can be adjusted according to the specifications of the final required soluble antibacterial microneedle patch (ApoEVs-AT@MN) capable of delivering adipose tissue apoptotic vesicles, as well as the epidermis thickness of different species of hosts.
[0024] In some embodiments of the present application, the content of adipose tissue apoptotic vesicles in the bio-ink is 400-600 μg / ml; preferably 500 μg / ml;
[0025] or / and the concentration of the methacrylated hyaluronic acid is 3-10% w / v; preferably 5-10% w / v, more preferably 5% w / v.
[0026] In some embodiments of the present application, the concentration of the methacrylated hyaluronic acid hydrogel in the mixed antibacterial hydrogel solution is 3-10% w / v; preferably 5-10% w / v, more preferably 5% w / v.
[0027] or / and the concentration of the methacrylated polylysine hydrogel is 3-5% (w / v), preferably 4%.
[0028] In some embodiments of the present application, in step 3, the bio-ink droplet is dropped into the mold, and the bubbles are removed under vacuum.
[0029] Preferably, after vacuum degassing, the sample is heated and concentrated in an oven at 35-37°C for 5-6 hours.
[0030] Preferably, after the second drop of bio-ink, the sample is heated and concentrated in an oven at 35-37°C for 5-6 hours.
[0031] Preferably, 300-600 μl of bio-ink is added each time, more preferably 400 μl.
[0032] In some embodiments of the present application, in step 4, 300-400 μl of mixed antibacterial hydrogel solution is added.
[0033] Preferably, after adding the mixed antibacterial hydrogel solution, the sample is heated and concentrated in an oven at 35-37°C for 10-18 hours, more preferably 12 hours, to prepare the antibacterial substrate.
[0034] The application of a soluble antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles disclosed in the present application includes the application in the preparation of an external preparation for wound treatment.
[0035] Preferably, the wound includes acute or / and chronic infected suppurative wounds.
[0036] Preferably, the wound includes refractory infected wounds accompanied by various underlying diseases.
[0037] In the present application, "% (w / v)" means mass / volume concentration, for example, the concentration of methacrylated hyaluronic acid hydrogel is 5% (w / v), which means that 100 ml of aqueous solution contains 5 g of methacrylated hyaluronic acid hydrogel.
[0038] The preparation method of adipose tissue apoptotic vesicles in the present application is a prior art. The adipose tissue apoptotic vesicles can be extracted from fat tissue or liposuction waste liquid of rats, pigs, humans, etc.
[0039] Compared with the prior art, the present application has the following beneficial effects:
[0040] The present application is designed scientifically and ingeniously, and utilizes fat tissue apoptosis vesicles and an antibacterial substrate to form a microneedle patch, which can achieve painless and non-invasive drug delivery, can inhibit the colonization, growth and proliferation of bacteria on a wound surface, and can achieve slow release of fat tissue apoptosis vesicles at a diseased site.
[0041] The microneedle matrix in the soluble antibacterial microneedle patch can painlessly and non-invasively deliver fat tissue apoptosis vesicles to an infected wound surface in a controllable, precise and efficient manner, can effectively promote the healing of an infected and suppurative wound surface and high-quality skin regeneration, including the regeneration of skin appendages such as hair follicles, sebaceous glands and sweat glands, and can reduce the formation of scars; at the same time, the antibacterial substrate can effectively inhibit the growth and reproduction of bacteria on the infected wound surface. The synergistic effect of the two can significantly promote the healing of the infected wound surface and high-quality skin regeneration on the basis of anti-infection treatment of the infected wound surface.
[0042] The microneedle matrix of the present application is composed of a biological ink prepared from fat tissue apoptosis vesicles and methacrylated hyaluronic acid hydrogel, which rapidly absorbs interstitial fluid into its grid after penetrating the skin, realizes the characteristics of material swelling but not dissolving, generates micropores in the gel that can deliver vesicles, and the fat tissue apoptosis vesicles are delivered into the body through the micropores of the hydrogel under the action of interstitial fluid penetration and diffusion. The slow release of fat tissue apoptosis vesicles at the diseased site is realized, and the action efficiency of fat tissue apoptosis vesicles is improved. The hydrogel can play a certain slow-release role, but pure hydrogel dressing cannot penetrate the epidermis and deliver effective ingredients to the dermis. The drug loading mode of the hydrogel microneedle adopted in the present application can ensure that the effective ingredients can be efficiently delivered to the dermis while playing a slow-release role on the internal active mediators.
[0043] At the same time, the fine pores formed by microneedle penetration can automatically heal within a few hours without causing bleeding and trauma, so that painless and non-invasive drug delivery can be achieved. In addition, the antibacterial substrate is prepared from a mixed solution of methacrylated hyaluronic acid and methacrylated polylysine hydrogel, which can directly act on bacterial biofilm to inhibit the colonization, growth and proliferation of bacteria on the wound surface, thereby assisting the microneedle matrix in promoting the healing of the infected wound surface.
[0044] The active agent contained in the present application is adipose tissue apoptosis vesicles, which not only have the advantages of stem cell exosomes, such as no need to consider cell activity, no self-replication to avoid the risk of tumorigenesis, low immunogenicity, etc., but also have higher efficiency in producing apoptosis vesicles compared with exosomes produced by living cells, and the cell apoptosis process can be completely controlled through standardized operation, which is more suitable for engineering batch production and clinical transformation application than exosomes. In addition, the present application directly induces apoptosis of adipose tissue ex vivo, extracts adipose tissue-derived apoptosis vesicles, without the process of extracting and culturing a large number of living cells, greatly reducing the technical cycle and technical cost. BRIEF DESCRIPTION OF DRAWINGS
[0045] Figure 1 Preparation method flowchart of the soluble antibacterial microneedle patch capable of delivering adipose tissue apoptosis vesicles of the present application;
[0046] Figure 2 In vivo action process schematic diagram of the soluble antibacterial microneedle patch capable of delivering adipose tissue apoptosis vesicles of the present application;
[0047] Figure 3 Comparison chart of histological structure of natural adipose tissue and apoptotic adipose tissue;
[0048] Figure 4 TUNEL staining comparison chart of natural adipose tissue and apoptotic adipose tissue, wherein the left chart is natural adipose tissue and the right chart is apoptotic adipose tissue;
[0049] Figure 5 Transmission electron microscope scanning result chart of adipose tissue apoptosis vesicles;
[0050] Figure 6 Annexin V protein expression immunofluorescence staining result chart of adipose tissue apoptosis vesicles;
[0051] Figure 7 Particle size distribution result chart of adipose tissue apoptosis vesicles;
[0052] Figure 8 Western blot detection of adipose tissue apoptosis vesicle marker protein expression chart result chart;
[0053] Figure 9 Appearance chart of hydrogels of different concentrations;
[0054] Figure 10 Viscosity investigation result chart of hydrogels of different concentrations;
[0055] Figure 11 Dynamic modulus investigation result chart of hydrogels of different concentrations;
[0056] Figure 12Figure for the growth inhibition of different hydrogels on high concentration of S. aureus;
[0057] Figure 13 Figure for the bacterial area count of different hydrogels on high concentration of S. aureus;
[0058] Figure 14 Figure for the comparison of bacterial OD value of different hydrogels after 0 hour and 24 hours of co-culture with bacteria;
[0059] Figure 15 Figure for ApoEVs-AT@MN of the present application, wherein the right figure is an enlarged view of the left figure;
[0060] Figure 16 Figure for the needle angle statistics of ApoEVs-AT@MN of the present application;
[0061] Figure 17 Figure for the three-dimensional reconstruction of ApoEVs-AT@MN prepared by fluorescently labeled methacrylated hyaluronic acid hydrogel;
[0062] Figure 18 Figure for the scanning electron microscope of ApoEVs-AT@MN, wherein the right figure is an enlarged view of the left figure;
[0063] Figure 19 Figure for the axial compression experiment micrograph of ApoEVs-AT@MN;
[0064] Figure 20 Figure for the axial compression experiment mechanical strength result statistics of ApoEVs-AT@MN;
[0065] Figure 21 Figure for the three-dimensional reconstruction of DiO-labeled ApoEVs-AT@MN under fluorescence confocal microscope;
[0066] Figure 22 Figure for the protein release curve of ApoEVs-AT@MN;
[0067] Figure 23 Figure for the result of fibroblast uptake of DiO-labeled ApoEVs-AT released by ApoEVs-AT@MN;
[0068] Figure 24 Figure for the result of fibroblast proliferation test;
[0069] Figure 25 Figure for the Transwell test micrograph;
[0070] Figure 26 Figure for the Transwell test result statistics;
[0071] Figure 27 Graph of ApoEVs-AT promoting expression of adipogenic related genes;
[0072] Figure 28 Graph of endothelial cells uptaking DiO-labeled ApoEVs-AT released by ApoEVs-AT@MN;
[0073] Figure 29 Graph of the results of the endothelial cell proliferation test;
[0074] Figure 30 Micrograph of the results of the scratch test;
[0075] Figure 31 Graph of the results of the scratch test;
[0076] Figure 32 Micrograph of the results of the Transwell test;
[0077] Figure 33 Graph of the results of the Transwell test;
[0078] Figure 34 Micrograph of the results of the tube formation test;
[0079] Figure 35 Graph of the results of the tube formation test;
[0080] Figure 36 Timeline graph of the animal experiment of Test Example 5.
[0081] Figure 37 Wound graph of the animal experiment of Test Example 5 at different time points;
[0082] Figure 38 Wound healing pattern graph of Test Example 5;
[0083] Figure 39 Graph of the percentage of wound healing of Test Example 5;
[0084] Figure 40 H&E and Masson staining graphs of the tissue sections of the infected wound area on day 8 and day 16 of Test Example 5;
[0085] Figure 41 Graph of the detection results of the skin tissue collected on day 16 of Test Example 5 for the adipogenic related protein Perilipin A and the angiogenic related protein Platelet-Endothelial Cell Adhesion Molecule (CD31).
[0086] Figure 42 Graph of the results of the investigation of the thickness of the new skin on day 16 of Test Example 5;
[0087] Figure 43Figure for investigating the expression amount of CD31 of the skin tissue collected on day 16 of test example 5 of each group;
[0088] Figure 44 Figure for investigating the expression amount of perilipin A of the skin tissue collected on day 16 of test example 5 of each group;
[0089] Figure 45 Figures of H&E and Masson staining of the tissue section of the infected wound area on day 8 and day 16 of test example 5;
[0090] Figure 46 Figures for investigating the expression amount of collagen type I (Col 1), alpha-smooth muscle actin (α-SMA) and collagen type III (Col 3) of the skin tissue collected on day 16 of test example 5 of each group;
[0091] Figure 47 Figure for counting the hair follicles of rats on day 16 of test example 5;
[0092] Figure 48 Figure for counting the expression amount of α-SMA on day 16 of test example 5;
[0093] Figure 49 Figure for investigating Col3 / Col1 on day 16 of test example 5. DETAILED DESCRIPTION
[0094] The following examples are provided to better further understand the present application and are not limited to the best mode contemplated, do not limit the scope of the application, and are not intended to be limiting in any way to the scope of the present application. Any product that is the same or similar to the present application obtained by the inspiration of the present application or by combining the present application with other prior art features falls within the scope of the present application.
[0095] The specific experimental steps or conditions not mentioned in the examples can be performed according to the conventional experimental steps described in the literature in the art or the operation or conditions. The reagents and other instruments not mentioned by the manufacturer are conventional reagent products that can be purchased on the market.
[0096] The adipose tissue apoptosis vesicles described in the examples of the present application are prepared according to the method of example 1 of the patent with publication number CN116350659 A.
[0097] Examples 1-3 disclose the preparation of soluble antibacterial microneedle patches that can deliver adipose tissue apoptosis vesicles.
[0098] Example 1
[0099] The present embodiment discloses the preparation of the soluble antibacterial microneedle patch (ApoEVs-AT@MN) of the deliverable adipose tissue apoptotic vesicle of the application; the flowchart is shown in the accompanying Figure 1 The specific steps are as follows:
[0100] S1. Extract the adipose tissue apoptotic vesicle by using the echelon centrifugation method.
[0101] S2. Prepare the bio-ink: mix the adipose tissue apoptotic vesicle with the methacrylated hyaluronic acid hydrogel solution to form the bio-ink; the content of the adipose tissue apoptotic vesicle in the bio-ink is 500 μg / ml, and the concentration of the methacrylated hyaluronic acid is 5% w / v.
[0102] S3. Prepare the mixed antibacterial hydrogel solution: take the methacrylated hyaluronic acid hydrogel and the methacrylated polylysine, mix and dissolve with water to prepare the mixed antibacterial hydrogel solution; wherein the concentration of the methacrylated hyaluronic acid hydrogel is 5% w / v, and the concentration of the methacrylated polylysine hydrogel is 4% w / v.
[0103] S4. Construct the resin microneedle positive mold by 3D printing, and prepare the polydimethylsiloxane mold by molding.
[0104] S5. Take 400 μl of the bio-ink prepared in step S2, drop it into the mold, vacuum degassing, 35°C oven heating, and concentrate for 5 hours; add 400 μl of the bio-ink again, 35°C oven heating, and concentrate for 5 hours.
[0105] S6. Add 400 μl of the mixed antibacterial hydrogel solution prepared in step S3, 35°C oven heating, and concentrate for 12 hours to prepare the antibacterial substrate.
[0106] S7. UV light curing for 15 s, demolding, and finally obtaining the soluble antibacterial microneedle patch of the deliverable adipose tissue apoptotic vesicle.
[0107] The microneedle patch prepared in the present embodiment has a microneedle base diameter of 300 μm, a needle height of 800 μm, and a needle tip distance of 700 μm.
[0108] Example 2
[0109] The present embodiment discloses the preparation of the soluble antibacterial microneedle patch of the deliverable adipose tissue apoptotic vesicle of the application; the flowchart is shown in the accompanying Figure 1 The specific steps are as follows:
[0110] S1. Extract the adipose tissue apoptotic vesicle by using the echelon centrifugation method.
[0111] S2. Preparation of bio-ink: mix the adipose tissue apoptotic vesicles with the methacrylated hyaluronic acid hydrogel solution to form a bio-ink; the content of the adipose tissue apoptotic vesicles in the bio-ink is 400 μg / ml, and the concentration of the methacrylated hyaluronic acid is 10% w / v.
[0112] S3. Preparation of mixed antibacterial hydrogel solution: take the methacrylated hyaluronic acid hydrogel and the methacrylated polylysine, mix and dissolve with water to prepare a mixed antibacterial hydrogel solution; wherein the concentration of the methacrylated hyaluronic acid hydrogel is 10% w / v, and the concentration of the methacrylated polylysine hydrogel is 3% w / v.
[0113] S4. Construct a resin microneedle positive mold by 3D printing, and prepare a polydimethylsiloxane mold by molding.
[0114] S5. Take 500 μl of the bio-ink prepared in step S2, drop it into the mold, vacuum degassing, 37℃ oven heating, and concentrate for 6 hours; add 500 μl of the bio-ink again, 37℃ oven heating, and concentrate for 6 hours.
[0115] S6. Add 300 μl of the mixed antibacterial hydrogel solution prepared in step S3, 35℃ oven heating, and concentrate for 12 hours to prepare an antibacterial substrate.
[0116] S7. UV light curing for 15s, demolding, and finally obtaining a soluble antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles.
[0117] The microneedle patch prepared in this example has a microneedle base diameter of 250 μm, a needle height of 600 μm, and a needle tip distance of 600 μm.
[0118] Example 3
[0119] This example discloses the preparation of a soluble antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles of the application; the flowchart is shown in FIG. Figure 1 The specific steps are as follows:
[0120] S1. Extract the adipose tissue apoptotic vesicles by using a cascade centrifugation method;
[0121] S2. Preparation of bio-ink: mix the adipose tissue apoptotic vesicles with the methacrylated hyaluronic acid hydrogel solution to form a bio-ink; the content of the adipose tissue apoptotic vesicles in the bio-ink is 400 μg / ml, and the concentration of the methacrylated hyaluronic acid is 10% w / v.
[0122] S3. Preparation of mixed antibacterial hydrogel solution: take the methacrylated hyaluronic acid hydrogel and the methacrylated polylysine, mix and dissolve with water to prepare the mixed antibacterial hydrogel solution; wherein the concentration of the methacrylated hyaluronic acid hydrogel is 8% w / v, and the concentration of the methacrylated polylysine hydrogel is 5% w / v.
[0123] S4. Constructing a resin microneedle positive mold by 3D printing, and preparing a polydimethylsiloxane mold by molding method.
[0124] S5. Take 300 μl of the bio-ink prepared in step S2, drop it into the mold, vacuum degassing, 37°C oven heating, and concentrating for 6 hours; add 300 μl of bio-ink again, 37°C oven heating, and concentrating for 6 hours.
[0125] S6. Add 400 μl of the mixed antibacterial hydrogel solution prepared in step S3, 35°C oven heating, and concentrating for 12 hours to prepare an antibacterial substrate.
[0126] S7. UV light curing for 15 s, demolding, and finally obtaining a soluble antibacterial microneedle patch capable of delivering fat tissue apoptotic vesicles.
[0127] The microneedle patch prepared in this example has a microneedle base diameter of 280 μm, a needle height of 700 μm, and a needle tip distance of 550 μm.
[0128] Test Example 1
[0129] In this test example, the fat tissue apoptotic vesicles obtained in Example 1 were identified.
[0130] The apoptosis of fat tissue was evaluated by H&E and TUNEL staining.
[0131] Compared with natural fat tissue, the apoptotic fat tissue structure is loose and irregular, as shown in Figure 3 .
[0132] The TUNEL staining image shows that apoptosis occurs in many cells of the apoptotic fat tissue; in contrast, there are no TUNEL-labeled cell nuclei in the natural fat tissue, as shown in Figure 4 . Green represents TUNEL-stained apoptotic cells; blue represents DAPI-stained cell nuclei.
[0133] Test Example 2
[0134] In this test example, the mechanical properties and antibacterial properties of HAMA / PLMA mixed antibacterial hydrogels with different concentration ratios were evaluated.
[0135] 1. Mechanical property investigation
[0136] The mechanical properties of the HAMA / PLMA hybrid antibacterial hydrogel were evaluated to obtain information about the rheological behavior of the HAMA / PLMA hybrid antibacterial hydrogel solution.
[0137] 1.1 Preparation of hydrogels with different concentrations.
[0138] HAMA hydrogel: Take the methacrylated hyaluronic acid, add water to prepare a 5% w / v HAMA hydrogel solution.
[0139] HAMA+4% / PLMA hydrogel: Take the methacrylated hyaluronic acid, methacrylated polylysine, add water to prepare a mixed hydrogel solution with a HAMA concentration of 5% w / v and a PLMA concentration of 4% w / v, and prepare the HAMA+4% / PLMA hydrogel.
[0140] HAMA+2% / PLMA hydrogel: Compared with HAMA+4% / PLMA hydrogel, the difference is that the concentration of PLMA in the mixed hydrogel solution is 2% w / v, and the rest is the same.
[0141] HAMA+6% / PLMA hydrogel: Compared with HAMA+4% / PLMA hydrogel, the difference is that the concentration of PLMA in the mixed hydrogel solution is 6% w / v, and the rest is the same.
[0142] The appearance of hydrogels with different concentrations is shown in the attached Figure 9 .
[0143] 1.2 Rheological behavior of hydrogels.
[0144] Viscoelastic analysis was performed using a HAAKE viscosity tester iQ Air, using a C35 1° / Ti cone-shaped rotator with a gap distance of 1 mm. At 25℃, the shear rate was scanned from 0.1 to 100 s -1 , to determine the shear viscosity of each group of HAMA / PLMA hybrid antibacterial hydrogel solution. The dynamic modulus of the bio-ink was characterized by frequency sweep: at 25℃, in the frequency range of 0.1-10 Hz, the strain constant was 0.01.
[0145] The results show that within the concentration range set, when the PLMA concentration is 4% w / v, the viscosity and dynamic modulus of the mixed antibacterial hydrogel are the highest, as shown in Figure 10 , 11 Rheology is an effective means to determine whether the HAMA / PLMA hybrid antibacterial hydrogel solution can be used as a microneedle substrate and skin wound dressing. The results show that the HAMA / PLMA bio-ink can resist deformation and exhibit robust elasticity of the hydrogel network.
[0146] 2. Investigation of antibacterial properties
[0147] To further evaluate the antibacterial performance of the HAMA / PLMA mixed antibacterial hydrogel solution, high concentration of S. aureus bacterial suspension (about 10 6 CFU / ml) was incubated with HAMA / PLMA photocured mixed antibacterial hydrogel containing different concentrations of PLMA at 37°C for 24 hours, 400 μl of photocured hydrogel was incubated with 1 ml of S. aureus bacterial suspension. After incubation, the bacterial suspension was counted by OD value; and the bacterial suspension was diluted 1:10000 and inoculated on the surface of agar medium, and after 24 hours of culture at 37°C, the culture dish was taken out and photographed for counting.
[0148] The preparation method of each photocured mixed antibacterial hydrogel is as follows: each hydrogel is prepared according to the method of "preparation of hydrogels with different concentrations" in item 1.1 of this embodiment, and then UV photocured for 15 s, and the photocured mixed antibacterial hydrogel is obtained.
[0149] The results show that the addition of PLMA can effectively inhibit the growth and proliferation of high concentration of S. aureus, as shown in Figures 12-14 .
[0150] Test Example 3
[0151] This test example investigates the material properties of the soluble microneedle.
[0152] 1. Investigation of the integrity of the microneedle body and the tip
[0153] The soluble antibacterial microneedle patch prepared in Example 1 for delivering fat tissue apoptotic vesicles was taken, and the overall and tip integrity of ApoEVs-AT@MN was shown by general digital photograph, as shown in Figure 15 .
[0154] 2. Investigation of the angle of the microneedle tip
[0155] The angle of the tip was observed under a microscope and counted, and the results showed that the angle of the tip of the microneedle matrix was between 30-38°, which facilitated insertion into the skin, as shown in Figure 16 .
[0156] 3. Fluorescence investigation of the integrity of the microneedle tip
[0157] Fluorescently labeled methacrylated hyaluronic acid hydrogel was prepared according to the method of Example 1 to prepare fluorescently labeled ApoEVs-AT@MN, and three-dimensional reconstruction was performed under fluorescence confocal microscope, which further proved the integrity of the tip, as shown in Figure 17 .
[0158] 4. Scanning electron microscope observation
[0159] Scanning electron microscopy showed that the ApoEVs-AT@MN surface had pores available for the release of adipose tissue apoptotic vesicles (ApoEVs-AT), as shown in Figure 18 .
[0160] 5. Axial compression experiment
[0161] Different gram weight scales were placed on ApoEVs-AT@MN, and the degree of deformation of the needle tip was observed after removal and photographed. In addition, ApoEVs-AT@MN was placed on an electronic universal testing machine, and an axial compression experiment was performed. The force was increased from 0 g to the needle tip deformation, and the stress-strain curve of the microneedle was measured with reference to 2.5*10 -3 MPa, depending on the needle tip deformation. The axial compression experiment showed that the ApoEVs-AT@MN was relatively stable in the 0-1000 g weight range, as shown in Figure 19 , and the maximum mechanical strength that each needle tip could withstand was greater than the insertion force required for the needle to penetrate the skin barrier, about 0.125 N / needle, as shown in Figure 20 .
[0162] 6. DiO-labeled ApoEVs-AT@MN three-dimensional reconstruction
[0163] Take 100 μg ApoEVs-AT, add 1 ml of α-MEM medium, and add 1 μl of cell membrane green fluorescent probe (DiO dye). After mixing, place in a 37°C, 5% CO2 incubator for 20 min. 10,000 g, 4°C centrifugation for 1 hour to obtain DiO-labeled ApoEVs-AT. Then use DiO-labeled ApoEVs-AT to prepare ApoEVs-AT@MN according to Example 1.S2-7 to obtain DiO-labeled ApoEVs-AT@MN. After that, place the DiO-labeled ApoEVs-AT@MN under a fluorescence confocal microscope for scanning and three-dimensional reconstruction. The results showed that the microneedle matrix drug loading capacity of the ApoEVs-AT@MN was large, as shown in Figure 21 .
[0164] 7. BCA detection
[0165] The BCA detection steps are as follows:
[0166] (1) Place ApoEVs-AT@MN in 4 ml of PBS, and on days 0, 1, 2, 3, 4, 5, 6, 7, and 8, respectively, take 20 μl into an EP tube as the sample to be tested;
[0167] (2) Set up standard wells in a 96-well plate and add the reagents in the table below:
[0168] (3) Set sample holes, take 10 μl of the sample to be tested and dilute to 100 μl, add 20 μl of the diluted sample to be tested to each hole;
[0169] (4) Prepare the color developing solution according to the proportion of A liquid: B liquid = 50:1, and shake to mix;
[0170] (5) Add 200 μl of the color developing solution to each hole;
[0171] (6) Shake the 96-hole plate to mix in the enzyme marker, and incubate at 37°C for 30 min;
[0172] (7) Measure the absorbance (OD) value of each hole under excitation light at 562 nm;
[0173] (8) Draw a standard curve according to the OD value of each hole.
[0174] The BCA detection results are shown in Figure 22 ; the results show that ApoEVs-AT@MN can gradually release the internal ApoEV-AT in PBS to the 8th day.
[0175] Test Example 4 Cell Biology Experiment
[0176] In order to explore the effect of ApoEVs-AT@MN on important cells in the skin regeneration process, this test example selected two important cells in the skin regeneration process: fibroblasts and endothelial cells, and carried out a co-culture in vitro experiment. The DiO-labeled ApoEVs-AT@MN in this test example was prepared according to the method of Test Example 3.
[0177] I. Investigation of the effect on fibroblasts
[0178] 1. DiO-labeled ApoEVs-AT@MN and fibroblast co-culture experiment
[0179] Place the DiO-labeled ApoEVs-AT@MN in the fibroblast-adhered confocal dish, add α-MEM with 10% fetal bovine serum to cover the cells and ApoEVs-AT@MN, and co-culture. After 24 hours, remove the ApoEVs-AT@MN, and perform fluorescent protein staining of the cytoskeleton of the fibroblasts. The DiO-labeled ApoEVs-AT can be effectively detected in the fibroblasts, as shown in Figure 23 , which shows that the fibroblasts can uptake the ApoEVs-AT released by the ApoEVs-AT@MN. Among them, red represents the fibroblasts stained by phalloidin, green represents the DiO-labeled ApoEVs-AT, and blue represents the cell nucleus stained by DAPI.
[0180] The operation steps of the cytoskeleton (phalloidin) fluorescent protein staining experiment are as follows:
[0181] (1) Take the glass bottom dish out of the incubator, aspirate the culture medium, and wash with PBS for 3 times, 5 min each time;
[0182] (2) Fix with 4% paraformaldehyde at room temperature for 20 min, and wash with PBS for 3 times, 5 min each time;
[0183] (3) Add 0.1% Triton X-100 and treat for 5 min, and wash with PBS for 3 times, 5 min each time;
[0184] (4) Block with 1% BSA at room temperature for 20 min to prevent non-specific staining, and wash with PBS for 3 times, 5 min each time;
[0185] (5) Add 5 μg / mL FITC-Phalloidin and stain 200 μL for 1 h in a 37°C incubator, avoid light, and wash with PBS for 3 times, 5 min each time;
[0186] (6) Stain with DAPI for 5 min, wash with PBS for 3 times, 5 min each time, and operate in the dark;
[0187] (7) Observe and photograph under a laser confocal microscope.
[0188] 2. Fibroblast proliferation experiment
[0189] Place ApoEVs-AT@MN in a 15 ml centrifuge tube, add 10 ml of α-MEM containing 10% fetal bovine serum, and place in a 37°C cell incubator for 48 hours to obtain the conditioned medium.
[0190] Inoculate fibroblasts at 2×10 3 cells per well in a 96-well plate, and incubate in a 37°C, 5% CO2 incubator overnight. After the cells adhere, aspirate the original culture medium. Add 200 μl of conditioned medium per well in the experimental group, and add full culture medium per well in the blank group. Change the medium every 2 days according to the required medium. After 1, 2, 3, 4, 5, 6, and 7 days of culture, aspirate the original culture medium, and add 110 μl of CCK-8 working solution (10 μl of CCK-8 detection solution per 100 μl of α-MEM) per well. Incubate at 37°C for 1 hour, measure the OD value with a microplate reader, and perform CCK-8 detection. The results show that, compared with the blank group, the conditioned medium can significantly increase the proliferation of fibroblasts, as shown in the following table. Figure 24
[0191] 3. Transwell experiment
[0192] Inoculate fibroblasts at 1.5×10 4 / The density of the holes was seeded in 24-well Transwell upper chamber; the experimental group (conditioned medium) and the blank group (α-MEM) medium were added to the lower layer of the Transwell chemotaxis chamber, respectively; 37°C, 5% CO2 incubator incubation for 12 hours; remove the Transwell chamber, 4% paraformaldehyde room temperature fixation for 2 hours; use a cotton swab carefully wipe the cells on the membrane, PBS wash 3 times; Giemsa staining, light microscope observation and photography; 5 fields of view were taken for each sample, and the number of cells migrated through the membrane was counted and analyzed. The results of the Transwell test showed that the conditioned medium could significantly promote the migration of fibroblasts after co-culturing for 12 hours, as shown in Figure 25 and 26 .
[0193] 4. Promote adipogenic related gene expression test
[0194] After treating fibroblasts with conditioned medium for 20 days, total RNA was extracted according to the conventional operation, reverse transcription, and then the following primer table was added, and the expression of adipogenic related genes PPARγ, C / EBPα, Adiponectin and FABP4 was evaluated by qRT-PCR, and the results showed that ApoEVs-AT could promote the expression of adipogenic related genes, as shown in Figure 27 .
[0195] Table 1 primer sequence table
[0196] SEQ ID NO Sequence PPARγ2-F 1 GACCACTCCCACTCCTTTGA PPARγ2-R 2 CAGGCTCCACTTTGATTGC C / EBPα-F 3 AGGTTTCCTGCCTCCTTCC C / EBPα-R 4 CCCAAGTCCCTATGTTTCCA Adiponectin-F 5 CCCATTCGCTTTACCAAGAT Adiponectin-R 6 GGCTGACCTTCACATCCTTC FABP4-F 7 CAGGAAAGTCAAGAGCACCA FABP4-R 8 TCCACCACCAGTTTATCATCC
[0197] II. Effect on endothelial cells
[0198] 1. DiO-labeled ApoEVs-AT@MN and endothelial cell co-culture experiment
[0199] DiO-labeled ApoEVs-AT@MN was placed in a confocal dish with endothelial cells adhering to the bottom, and α-MEM with 10% fetal bovine serum was added to cover the cells and ApoEVs-AT@MN for co-culture. After 24 hours, the ApoEVs-AT@MN was removed, and the endothelial cells were subjected to fluorescent protein staining of the cytoskeleton, and DiO-labeled ApoEVs-AT could be effectively detected in the endothelial cells, as shown in Figure 28 , indicating that endothelial cells can uptake ApoEVs-AT released by ApoEVs-AT@MN. Among them, red represents endothelial cells stained with phalloidin, green represents DiO-labeled ApoEVs-AT, and blue represents DAPI-stained nuclei.
[0200] 2. Endothelial cell proliferation test
[0201] ApoEVs-AT@MN was placed in a 15 ml centrifuge tube, 10 ml of a-MEM with 10% fetal bovine serum was added, and it was placed in a 37°C cell incubator for 48 hours to obtain the conditioned medium.
[0202] Endothelial cells were seeded in a 96-well plate at a density of 2 x 10 3 cells per well, and incubated at 37°C in a 5% CO2 incubator overnight. After the cells adhered, the original culture medium was removed. The experimental group was added with 200 μl of conditioned medium per well, and the blank group was added with full culture medium per well. The medium was changed every 2 days according to the required medium. After 1, 2, 3, 4, and 5 days of culture, the original culture medium was removed, and 110 μl of CCK-8 working solution (10 μl of CCK-8 detection solution was added to 100 μl of a-MEM) was added to each well. After incubation at 37°C for 1 hour, the OD value was measured by an enzyme-labeled instrument for CCK-8 detection. The results showed that, compared with the blank group, the conditioned medium could significantly increase the proliferation of endothelial cells, as shown in Figure 29
[0203] 3. Scratch test and Transwell test
[0204] Endothelial cells were seeded in a 12-well plate at a density of 1 x 10 5 cells per well, and incubated at 37°C in a 5% CO2 incubator until the cells grew to more than 90% of the density. A horizontal line was drawn using a gun head with the aid of a ruler. The cells scraped off were gently washed away with PBS. The experimental group (conditioned medium) and the blank group (a-MEM) were added. After incubation at 37°C in a 5% CO2 incubator for 24 hours, the cells were photographed, counted, and analyzed. The results of the scratch test showed that the conditioned medium could significantly promote the migration of endothelial cells after 24 hours, as shown in Figure 30 and 31 .
[0205] Endothelial cells were seeded in a 24-well Transwell upper chamber at a density of 1.5 x 10 4 cells per well. The experimental group (conditioned medium) and the blank group (a-MEM) were added to the lower layer of the Transwell chemotaxis chamber. After incubation at 37°C in a 5% CO2 incubator for 12 hours, the Transwell chamber was removed, and the cells were fixed with 4% paraformaldehyde at room temperature for 2 hours. The cells on the upper layer of the membrane were carefully wiped off with a cotton swab, and washed with PBS for 3 times. Giemsa staining was performed, and the cells were observed and photographed under a light microscope. Five fields of view were taken for each sample, and the number of cells that migrated through the membrane was counted and analyzed. The results of the Transwell test showed that the conditioned medium could significantly promote the migration of endothelial cells after 12 hours, as shown in Figure 32 and 33 .
[0206] 4. Tube formation test
[0207] Endothelial cells were seeded in 96-well plates coated with Matrigel gel at a cell density of 2 x 10 4 The endothelial cells were seeded in 96-well plates coated with Matrigel gel at a cell density of 2 x 10 Figure 34 、 35
[0208] From the results of this test example, it can be seen that ApoEVs-AT@MN can act on fibroblasts and endothelial cells by releasing ApoEVs-AT and regulate the cytological behavior of both.
[0209] Test Example 5 Rat Infected Wound Model Experiment
[0210] In this test example, in order to evaluate the effect of ApoEVs-AT@MN in full-thickness skin wound healing, two full-thickness skin wounds (2 cm in diameter) were established on the back of each SD rat and coated with a high concentration of S. aureus suspension, recorded as day -2. 48 hours later, the skin wound was observed for suppuration, recorded as day 0.
[0211] The experiment was divided into an ApoEVs-AT@MN group and a blank group. In the ApoEVs-AT@MN group, ApoEVs-AT@MN was implanted once on day 0 and day 8. In the blank group, 100 μl of PBS was used as a control.
[0212] A schematic diagram of the effect of ApoEVs-AT@MN on the wound is shown in Figure 2 , and the time axis of the animal experiment operation is shown in Figure 36 .
[0213] 1. Wound healing observation
[0214] Digital gross photographs were taken on day 0, day 4, day 8, day 12, and day 16 to measure the healing rate, as shown in Figure 37 . A pattern diagram was drawn to more clearly indicate the speed of wound healing, as shown in Figure 38 , where the dotted circle represents the range of the initial wound area on day 0, and the colored part represents the area of the unhealed wound at different time points.
[0215] In the embodiments of the present application, the wound area (%) is defined as: unhealed wound area on day X / initial wound area x 100%.
[0216] The statistical analysis of the wound area of the rats in the blank group and the ApoEVs-AT@MN group found that ApoEVs-AT@MN showed the ability to accelerate wound healing on the 0th day after implantation, and ApoEVs-AT@MN reduced the average wound area on the 8th day from 16.04% in the blank group to 4.07% in the ApoEVs-AT group, as shown in Figure 39 Similarly, after the 2nd ApoEVs-AT@MN treatment, ApoEVs-AT@MN reduced the average wound area on the 12th day from 6.74% in the blank group to 0.45%, as shown in Figure 39 In addition, according to the digital gross photograph, on the 16th day, the ApoEVs-AT@MN group was fully healed with only linear scar, while the blank group was not fully healed with an average wound area of 1.55%, and the presence of scab, and the scar area of each group was significantly larger than that of the ApoEVs-AT@MN group, as shown in Figure 37
[0217] 2. Evaluate the quality of granulation tissue on the 8th day and the quality of new skin tissue on the 16th day in the infected wound area.
[0218] 2.1 Collect the tissue in the wound area on the 8th day and make sections for subsequent staining. By H&E staining of longitudinal sections, it was found that the ApoEVs-AT@MN group had a clear new epidermal layer, and the dermal layer had a rich and regular arrangement of new skin appendages, including new hair follicles, sweat glands, sebaceous glands, etc., and the central non-healing part of the wound was connected by granulation tissue, which was covered by scab, as shown in Figure 40 While the blank group only had a small amount of irregular skin-like appendage tissue at the edge of the wound, and the majority of the wound area was connected by granulation tissue, and the surface was covered by a large amount of scab, as shown in Figure 40 which is consistent with the results of the gross photograph. It shows that ApoEVs-AT@MN accelerates the speed of re-epithelialization and skin appendage regeneration. Among them, the black inverted triangle indicates the edge of the wound area / edge of re-epithelialization, and the black solid frame indicates the enlarged area, and in the enlarged area on the right, the black dotted line indicates the area of regenerated epidermis.
[0219] 2.2 The experiment collected the healed skin at the wound site on the 16th day and made sections for subsequent staining. The H&E staining image shows that the wound in the ApoEVs-AT@MN group is fully healed on the 16th day, the scar area is very narrow, there are a large number of regularly arranged new hair follicles, hair, sebaceous glands, etc. in the non-scar area, similar to natural skin, and a large number of large-diameter and extensive new blood vessels are infiltrated, as shown in Figure 40 The blank group was not completely healed at day 16, with a small amount of scab on the wound surface, a significantly wider scar area than the ApoEVs-AT@MN group, a large area of the wound surface occupied by fibrous tissue, and only a small amount of irregular skin appendages at the edge of the wound surface. No obvious neovascular infiltration was observed on the surface of the new skin, and a small amount of neovascular infiltration was observed in the skin basement layer, as shown in FIG. 9. Figure 40 The above results are consistent with the digital photographs.
[0220] 2.3 Immunofluorescence staining analysis was performed on the skin tissue collected from each group at day 16 to evaluate the expression of different proteins in the new tissue. It was found that, in the non-scar area, compared with the blank group, the ApoEVs-AT@MN group could promote the expression of fibroblast-related proteins collagen type I (Col 1) and collagen type III (Col 3), adipocyte-related protein perilipin A, and angiogenic-related protein platelet-endothelial cell adhesion molecule (CD31), as shown in FIGS. 10, 11, and 12. Figure 41 and Figure 46 The positive signal of Col 3 in the ApoEVs-AT@MN group was more than that in the blank group. After statistical analysis, the relative fluorescence density of Col 3 / Col 1 in each field was increased from 0.099 (blank group) to 0.43 (ApoEVs-AT@MN group) by ApoEVs-AT@MN, as shown in FIGS. 13 and 14. Figure 46 and 49 It is reported that an increase in the ratio of Col 3 / Col 1 is closely related to the reduction of scar and the increase of skin softness. In addition, alpha-smooth muscle actin (a-SMA), which can be expressed in mature fibroblasts, perivascular, and hair follicle sheath, was also highly expressed in the new skin of the ApoEVs-AT@MN group, as shown in FIG. 15. Figures 46-48
[0221] The steps of section immunofluorescence staining are as follows:
[0222] (1) Paraffin sections were placed in a 60°C oven overnight;
[0223] (2) Xylene I and Xylene II were used for dewaxing, each for 10 min;
[0224] (3) 100% I, 100% II, 95% I, 95% II, 85%, and 75% gradient alcohol were used for hydration, each for 5 min, and then washed with running water;
[0225] (4) Peroxidase inhibitor was incubated at room temperature for 20 min, and then washed with PBS for 3 times (5 min / time);
[0226] (5) Citrate salt solution was boiled by microwave oven, and then the empty slide rack was placed first to remove bubbles, and then the sections were gently placed on the slide rack, and then incubated at 37°C for 20 min;
[0227] Put the slices into the slices to avoid the slices, adjust the microwave oven to the lowest fire, keep the solution temperature but not boiling, 15min thick
[0228] Remove, cool the glass at room temperature, wash with PBS 3 times (5min / time);
[0229] (6) Goat serum was blocked at room temperature for 30 min, and the goat serum was aspirated (without washing);
[0230] (7) Add the first antibody (Col 1, α-SMA, Col 3, Perilipin A, CD31), incubate overnight at 4°C, wash with PBS 3 times (5min / time);
[0231] (8) Add the second antibody dropwise, incubate at 37°C for 60min, and wash with PBS 3 times (5min / time);
[0232] (9) DAPI staining for 5min, PBS washing 3 times (5min / time);
[0233] (10) Observe under confocal microscope.
[0234] The above results show that ApoEVs-AT@MN shows the ability to promote high-quality full-thickness skin wound healing, while reducing scar formation and promoting hair follicle regeneration.
[0235] Finally, it should be noted that: the above examples are merely the preferred embodiments of the present application to illustrate the technical solutions of the present application, rather than limit it, of course, nor limit the patent scope of the present application. Any substantive changes or embellishments made in the main design idea and spirit of the present application, the technical problems solved are still consistent with the present application, should be included in the scope of protection of the present application; in addition, the technical solutions of the present application are directly or indirectly applied to other related technical fields, are also included in the patent protection scope of the present application.
Claims
1. A soluble antimicrobial microneedle patch that can deliver adipose tissue apoptotic vesicles, characterized in that, The micro-needle matrix and the antibacterial substrate; the micro-needle matrix comprises fat tissue apoptosis vesicles and methacrylated hyaluronic acid hydrogel; the substrate comprises methacrylated hyaluronic acid hydrogel and methacrylated polylysine hydrogel; The preparation method of the soluble antibacterial micro-needle patch comprises the following steps: Step 1. Preparation of bio-ink: mixing fat tissue apoptosis vesicles with methacrylated hyaluronic acid hydrogel solution to form bio-ink; the content of fat tissue apoptosis vesicles in the bio-ink is 400-600 μg / ml; and the concentration of methacrylated hyaluronic acid is 3-10% w / v; Step 2. Preparation of mixed antibacterial hydrogel solution of methacrylated hyaluronic acid and methacrylated polylysine water; the concentration of methacrylated hyaluronic acid hydrogel in the mixed antibacterial hydrogel solution is 3-10% w / v; the concentration of methacrylated polylysine hydrogel is 3-5% w / v; Step 3. Dropping the bio-ink into the mold, removing bubbles, heating and concentrating; Step 4. Adding the mixed antibacterial hydrogel solution into the mold again, heating and concentrating to prepare the antibacterial substrate; Step 5. UV light curing, demolding, to obtain a soluble antibacterial micro-needle patch capable of delivering fat tissue apoptosis vesicles.
2. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, The mass ratio of methacrylated hyaluronic acid hydrogel and methacrylated polylysine hydrogel in the substrate is 5:
4.
3. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles according to claim 1 or 2, characterized in that, The content of fat tissue apoptosis vesicles in each micro-needle patch is 320-480 μg / piece.
4. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 3, wherein, The content of fat tissue apoptosis vesicles in each micro-needle patch is 400 μg / piece.
5. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 3, wherein, The diameter of the needle base of the micro-needle is 250-300 μm, the needle height is 600-800 μm, and the needle tip distance is 550-700 μm.
6. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 3, wherein, The size of the patch is adapted to the number of micro-needles and the size of the wound.
7. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, In step 3, after concentrating, the bio-ink is added again, heated and concentrated.
8. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, In the bio-ink, the content of fat tissue apoptosis vesicles is 500 μg / ml; Or / and the concentration of methacrylated hyaluronic acid is 5-10% w / v.
9. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 8, wherein, In the bio-ink, the concentration of methacrylated hyaluronic acid is 5% w / v.
10. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, In the mixed antibacterial hydrogel solution, the concentration of methacrylated hyaluronic acid hydrogel is 5-10% w / v; Or / and the concentration of methacrylated polylysine hydrogel is 4% w / v.
11. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 10, wherein, In the mixed antibacterial hydrogel solution, the concentration of methacrylated hyaluronic acid hydrogel is 5% w / v.
12. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, In step 3, after vacuum deaeration, the bio-ink is heated and concentrated in an oven at 35-37°C for 5-6 hours.
13. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, In step 3, after adding the bio-ink again, the bio-ink is heated and concentrated in an oven at 35-37°C for 5-6 hours.
14. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 13, wherein, In step 3, 300-600 μl of bio-ink is added each time.
15. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 14, wherein, 400 μl of bio-ink is added each time.
16. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 1, wherein, In step 4, 300-400 μl of mixed antibacterial hydrogel solution is added.
17. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 16, wherein, In step 4, after adding the mixed antibacterial hydrogel solution, the mixed antibacterial hydrogel solution is heated and concentrated in an oven at 35-37°C for 10-18 hours to prepare the antibacterial substrate.
18. The dissolvable antimicrobial microneedle patch of deliverable adipose tissue apoptotic vesicles of claim 16, wherein, In step 4, the mixed antibacterial hydrogel solution is added dropwise and heated and concentrated in an oven at 35-37 °C for 12 hours.
19. Use of the dissolvable antibacterial microneedle patch capable of delivering adipose tissue apoptotic vesicles according to any one of claims 1-18 in the preparation of an external preparation for wound treatment.
20. The use of a dissolvable antimicrobial microneedle patch that delivers adipose tissue apoptotic vesicles according to claim 19, wherein, The wound is an acute or / and chronic infected suppurative wound.
21. The use of a dissolvable antimicrobial microneedle patch that delivers adipose tissue apoptotic vesicles according to claim 19, wherein, The wound is a refractory infected wound accompanied by various underlying diseases. The wound is a refractory infected wound accompanied by various underlying diseases.
Citation Information
Patent Citations
Microneedle patch for preventing or treating skin infection and preparation method thereof
CN115381767A
Soluble double-layer drug-loaded microneedle patch for chronic wound repair and preparation method of soluble double-layer drug-loaded microneedle patch
CN114159551A
Application of adipose tissue apoptosis vesicle, preparation and preparation method of adipose tissue apoptosis vesicle
CN116350659A