Application of CsDREB1B-1 gene in regulating resistance to citrus canker

By negatively regulating the expression of the CsDREB1B-1 gene, dsRNA and recombinant vectors were used to significantly improve resistance to citrus canker, solving the problem of citrus canker control and providing a basis for resistance breeding.

CN118813678BActive Publication Date: 2025-10-31GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411060395.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-05
Publication Date
2025-10-31
Estimated Expiration
2044-08-05

AI Technical Summary

Technical Problem

In the current technology, the prevention and control of citrus canker has not been effectively solved, and the mechanism of DREB transcription factor in citrus canker resistance is unclear, which affects the development of the citrus industry.

Method used

By negatively regulating the expression of the CsDREB1B-1 gene and reducing its transcription level, the resistance of citrus to citrus canker was improved using dsRNA, recombinant vectors, and recombinant bacteria. An interference vector was constructed and introduced into citrus, which significantly improved resistance.

Benefits of technology

It significantly improves the resistance of citrus to citrus canker, reducing the lesion area and disease index to 44% and 38% of existing citrus, respectively, without affecting the phenotype of transgenic plants, and has important breeding application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813678B_ABST
    Figure CN118813678B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to the application of the CsDREB1B-1 gene in regulating citrus canker resistance. This invention provides the application of the CsDREB1B-1 gene in regulating citrus canker resistance. By interfering with the expression of the CsDREB1B-1 gene and reducing its transcription level, this invention can significantly improve citrus resistance to canker without affecting the phenotype of transgenic plants. It has significant application value in citrus canker resistance breeding and can be used as a candidate gene in canker resistance breeding along with multiple canker resistance and susceptibility genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving the application of the CsDREB1B-1 gene in regulating resistance to citrus canker. Background Technology

[0002] Citrus canker is a bacterial disease caused by Xanthomonas citri subsp. Citri (Xcc). It affects most major citrus varieties and occurs in all major citrus-producing areas of my country, with the affected area continuing to expand. Therefore, strengthening research on the prevention and control of citrus canker is an urgent need for the development of the citrus industry.

[0003] Transcription factors participate in various stress responses by regulating the expression of downstream genes in plants. Among them, the dehydration response element binding protein (DREB) transcription factor is one of the most widely studied subfamily of AP2 / ERF transcription factors. In recent years, members of the DREB transcription factor family have been discovered and studied in a variety of plants, such as Arabidopsis thaliana, wheat, tomato, potato, mangrove, and pineapple.

[0004] Existing research indicates that DREB is widely involved in signaling pathways of plant responses to abiotic stresses by recognizing DRE / CRT elements. In Arabidopsis, stress-related DREB transcription factors include DREB1A / CBF and DREB2A; DREB1A members are primarily involved in cold responses, while DREB2A members are primarily involved in drought stress responses. Rapeseed plants overexpressing Arabidopsis DREB1B, DREB1C, and DREB1A genes are more cold-hardy than wild-type plants. LlDREB1 from Saxifraga stolonifera enhances Arabidopsis tolerance to cold, drought, and salt stresses. The DREB1-type transcription factor gene ZjDREB1.4 isolated from Zoysia japonica enhances Arabidopsis resistance to cold, drought, and salt stresses. Compared to abiotic stresses, research on DREB's involvement in biotic stresses is limited, and its mechanisms remain unclear. Currently, there are no records of DREB's effects on citrus canker resistance. Summary of the Invention

[0005] The purpose of this invention is to apply the CsDREB1B-1 gene in regulating resistance to citrus canker, significantly improving the resistance of citrus to canker without affecting the citrus phenotype, and laying the foundation for breeding canker-resistant citrus.

[0006] This invention provides the application of the CsDREB1B-1 gene in regulating resistance to citrus canker, and the amino acid sequence encoded by the CsDREB1B-1 gene is shown in SEQ ID NO.1.

[0007] Preferably, the regulation includes: negatively regulating the expression of the CsDREB1B-1 gene to enhance resistance to citrus canker.

[0008] The present invention also provides the application of a product that negatively regulates the CsDREB1B-1 gene in improving resistance to citrus canker and / or in citrus resistance breeding, wherein the nucleotide sequence of the CsDREB1B-1 gene is shown in SEQ ID NO.2.

[0009] Preferably, the product includes dsRNA, a recombinant vector containing the dsRNA, or a recombinant bacterium containing the dsRNA.

[0010] The present invention also provides a dsRNA that enhances resistance to citrus canker, the forward nucleotide sequence of which is shown in SEQ ID NO.3.

[0011] The present invention also provides a recombinant vector for improving resistance to citrus canker, the recombinant vector comprising a base vector and an interfering fragment inserted into the base vector;

[0012] The interfering fragment includes the dsRNA, intron, and reverse complementary fragment of the dsRNA described in the above-mentioned technical solution, which are connected in sequence.

[0013] Preferably, the base carrier includes pLGNe.

[0014] The present invention also provides a recombinant bacterium that enhances resistance to citrus canker, the recombinant bacterium comprising a basic bacterium and a recombinant vector described in the above-described technical solution for introducing the basic bacterium.

[0015] Preferably, the basic bacteria include Agrobacterium.

[0016] The present invention also provides a method for improving resistance to citrus canker, comprising: introducing the recombinant vector or the recombinant bacteria described in the above technical solution into citrus.

[0017] Beneficial effects:

[0018] This invention provides the application of the CsDREB1B-1 gene in regulating citrus canker resistance. By interfering with the expression of the CsDREB1B-1 gene and reducing its transcription level, this invention can significantly improve the resistance of citrus to canker without affecting the phenotype of transgenic plants. It has significant application value in citrus canker resistance breeding and can be used as a candidate gene in canker resistance breeding along with multiple canker resistance and susceptibility genes. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0020] Figure 1 Here is a structural diagram of the CsDREB1B-1 gene;

[0021] Figure 2 Electrophoresis diagram of PCR amplification of the dsRNA fragment encoding the CsDREB1B-1 gene: where M is the DNA molecular weight standard;

[0022] Figure 3 The flowchart shows the construction process of the CsDREB1B-1 interference vector; where GUS represents the β-glucosidase gene; CaMV 35S represents the plant constitutive promoter derived from cauliflower mosaic virus; and NOS represents the crown gall synthase gene terminator.

[0023] Figure 4 A flowchart of citrus genetic transformation;

[0024] Figure 5 GUS staining diagram of transgenic plants; where WT represents wild-type control; R1-R8 represent transgenic plants;

[0025] Figure 6 This is a PCR identification diagram of transgenic plants; R1-R8 represent transgenic plants.

[0026] Figure 7 The graph shows the expression level of CsDREB1B-1 in transgenic plants; R1-R8 represent transgenic plants; * indicates significant difference compared with wild type (P=0.05); ** indicates extremely significant difference compared with WT (P=0.01);

[0027] Figure 8 This is a phenotypic diagram of transgenic plants; where R1-R8 represent transgenic plants.

[0028] Figure 9 Symptoms of transgenic plants 10 days after inoculation with ulcer pathogen; where B is a magnified view of A, and R4, R6 and R7 represent transgenic plants;

[0029] Figure 10 A statistical chart showing the size of lesions on leaves of transgenic plants 10 days after inoculation with ulcer pathogen; where R4, R6, and R7 represent transgenic plants.

[0030] Figure 11 A statistical chart of disease index 10 days after inoculating leaves of transgenic plants with ulcer pathogen; where R4, R6 and R7 represent transgenic plants. Detailed Implementation

[0031] This invention provides the application of the CsDREB1B-1 gene in regulating resistance to citrus canker. The amino acid sequence encoded by the CsDREB1B-1 gene is shown in SEQ ID NO.1, specifically: MDILFGQVSDPGLTDNKPESSTQSDASSTAPPWRGAHSDEEVLLLATSRPKKRAGRRVFKETRHPIFRGVRMRNNNKWVCELREPNKQTRIWLGTYPSPEMAARAHDVAALALRGKSACLNFADSVWRLPVPASTDAKDIRKAAAEAAEAFRPRDDELEESNIHHVKLEEVQKTMQENTLLPENVLYMDEHAVFDMPGLLADMAEGLLLSPPPLHFGDDDVMKWDYHNNGESDGCVSLWSHSI*.In this invention, the preferred nucleotide sequence of the CsDREB1B-1 gene is as shown in SEQ ID NO.2, specifically: 5'-ATGGACATATTATTCGGCCAAGTTTCTGATCCTGGTTTGACTGACAATAA-3'.

[0032] The CsDREB1B-1 described in this invention is located on chromosome 5 of citrus, with a total length of 1043 bp, one exon, and a coding sequence of 732 bp encoding 244 amino acids. The functional domain AP2 is located between amino acids 65 and 116. Its secondary structure consists of: an α-helix (containing 65 amino acids) accounting for 26.75% of the total amino acids, an extended chain (containing 36 amino acids) accounting for 13.99%, a β-turn (containing 6 amino acids) accounting for 2.47%, and a random coil (containing 138 amino acids) accounting for 56.79%. Figure 1).

[0033] In this invention, the regulation preferably includes: negatively regulating the expression of the CsDREB1B-1 gene to enhance resistance to citrus canker. This invention, by interfering with the expression of the CsDREB1B-1 gene and reducing its transcription level, can significantly improve the resistance of citrus to canker without affecting the phenotype of transgenic plants. It has significant application value in citrus canker resistance breeding and can be used as a candidate gene in canker resistance breeding along with multiple canker resistance and susceptibility genes.

[0034] In view of the application of the CsDREB1B-1 gene provided by this invention in regulating resistance to citrus canker, this invention also provides the application of a product that negatively regulates the CsDREB1B-1 gene in improving resistance to citrus canker. In this invention, the product preferably comprises dsRNA, a recombinant vector containing said dsRNA, or a recombinant bacterium containing said dsRNA.

[0035] This invention also provides a dsRNA that enhances resistance to citrus canker. The forward nucleotide sequence of the dsRNA is shown in SEQ ID NO.3, specifically: 5'-GTTTCTGATCCTGGTTTGACTG ACAATAAGCCGGAGTCATCAACACAGTCAGATGCCAGCAGCACGGCGCCGCCATGGCGAGGTGCCCACTCAGACGAGGAAGTACTACTGCTCGCAACGAGCAGGCCGAAGAAGCGGGCGGGAGGAGAGTGTTTAAGGAGACACGTCATCCGATTTTCAGAGGAGTCAGAATGAGAAACAATAATAAATGGGTATGTGAGCTACGTGAACCCAACAAGCAAACACGCA-3'. The sequence shown in SEQ ID NO.3 of this invention is the deoxynucleotide sequence corresponding to the forward strand of the dsRNA, that is, the forward strand of the cDNA sequence used to construct the vector.

[0036] This invention also provides a recombinant vector to enhance resistance to citrus canker, the recombinant vector comprising a base vector and an interfering fragment inserted into the base vector; the interfering fragment comprises, in sequence, the dsRNA, an intron, and the reverse complementary fragment of the dsRNA described in the above-mentioned technical solutions. In this invention, the intron is preferably the intron with NCBI accession number AY310901.1. The nucleotide sequence of the interfering fragment of this invention is preferably as shown in SEQ ID NO. 10: 5'- gtttctgatcctggtttga ctgacaataagccggagtcatcaacacagtcagatgccagcag cacggcgccgccatggcgaggtgcccactcagacgaggaagtactactgctcgcaacgagcaggccgaagaagcgg gcggggaggagagtgtttaaggagacacgtcatccgattttcagaggagtcagaatgagaaacaataataaatggg tatgtgagctacgtgaacccaacaagcaaacacgca

[0037] In this invention, the preparation method of the recombinant vector preferably includes the following steps: forward ligation of the dsRNA described in the above-described technical solution into a first basic vector to obtain a first recombinant basic vector; reverse ligation of the dsRNA described in the above-described technical solution into the 3' end of the first intron tightly connected to the dsRNA in the first recombinant basic vector to obtain the recombinant vector. The first basic vector of this invention preferably includes a pUC-RNAi vector, and more preferably, the dsRNA described in the above-described technical solution is forward ligated between the SwaI and AscI restriction sites of the first basic vector, and the dsRNA is reverse ligated between the BamHI and SalI restriction sites of the first recombinant basic vector. This invention does not have strict requirements on the ligation method; conventional methods in the art can be used, such as enzyme digestion and ligation.

[0038] This invention also provides a recombinant bacterium that enhances resistance to citrus canker, the recombinant bacterium comprising a basic bacterium and a recombinant vector described in the above-described technical solution for introducing the basic bacterium. In this invention, the basic bacterium preferably comprises Agrobacterium tumefaciens, and more preferably Agrobacterium rhizogenes.

[0039] The present invention also provides a method for improving resistance to citrus canker, comprising: introducing the recombinant vector or the recombinant bacteria described in the above technical solution into citrus.

[0040] This invention preferably introduces the recombinant vector or recombinant bacteria described in the above-mentioned technical solutions into citrus to obtain transgenic citrus. This invention does not have strict requirements on the introduction method; conventional methods in the art can be used. This invention preferably introduces the recombinant vector or recombinant bacteria into citrus explants; the citrus explants are preferably citrus hypocotyl stem segments; the length of the citrus hypocotyl stem segment is preferably 1 cm. This invention preferably utilizes the recombinant bacteria described in the above-mentioned technical solutions to infect citrus hypocotyl stem segments; the length of the citrus hypocotyl stem segment is preferably 1 cm; the OD value of the recombinant bacteria is preferably 0.1–0.5, more preferably 0.5.

[0041] After obtaining the transgenic citrus, the present invention preferably co-cultures the transgenic citrus, and then transfers the co-cultured epicotyl to a selection medium for selection culture. In the present invention, the co-culture medium is preferably MS-based, comprising 2 mg / L BA, 0.5 mg / L IIAA, 1 mg / L 2,4-D, 100 μmol AS, 30 g / L sucrose, and 2.5 g / L Gelrite; the pH of the co-culture medium is preferably 5.8; and the co-culture conditions are preferably 26°C dark incubation for 2 days.

[0042] In this invention, the screening medium is preferably MS-based, comprising 2 mg / L BA, 0.5 mg / L IIAA, 500 mg / L Cef, 50 mg / L Kan, 30 g / L sucrose, and 2.5 g / L Gelrite; the pH of the screening medium is preferably 5.8. The preferred screening culture conditions are 28°C in the dark for 7 days, followed by culture at 28°C under 16 h light / 8 h dark conditions, with subculture every two weeks.

[0043] In this invention, transgenic citrus seedlings over 1 cm in height obtained through screening and cultivation are grafted onto Late Jin Orange seedlings for seedling cultivation. When the grafted Late Jin Orange seedlings reach 5 cm in height, they are grafted onto trifoliate orange seedlings and cultured at 28°C. In this invention, the seedling culture medium is preferably MS-based, containing 30 g / L sucrose; the pH of the seedling culture medium is preferably 5.8. This invention uses Late Jin Orange as an example in the embodiments. In practical applications, this method can also be used to improve the resistance of other citrus varieties to citrus canker; therefore, Late Jin Orange should not be considered the sole focus of this invention.

[0044] This invention clones the dsRNA fragment of the CsDREB1B-1 encoding gene in citrus, constructs an interference vector, and then transforms it into citrus. The resulting transgenic plants show a reduction in citrus canker lesion area to up to 44% of that in existing citrus plants, and a disease index to up to 38%, significantly alleviating the severity of canker without affecting the citrus phenotype. Compared to gene editing techniques for silencing citrus genes, the method provided in this invention is more stable, has a higher probability of yielding gene-silenced plants, and is suitable for highly heterozygous species like citrus, making it of great value for molecular breeding of citrus plants resistant to canker.

[0045] To further illustrate the present invention, the application of the CsDREB1B-1 gene provided by the present invention in regulating resistance to citrus canker is described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] RNAi fragment cloning of the CsDREB1B-1 gene

[0048] 1. RNA extraction and cDNA synthesis

[0049] Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) and stored at -20℃ for later use.

[0050] 2. Cloning and recovery of RNAi fragments encoding the CsDREB1B-1 sequence

[0051] Using the cDNA obtained in step 1 as a template, PCR amplification was performed on the cDNA using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), the upstream primer CsDREB1B-1-RNAi-F (5'-gtcgacggcgcgcccGTTTCTGATCCTGGTTTGAC-3', SEQ ID NO.4, where lowercase letters represent SalⅠ and AscⅠ restriction sites) and the downstream primer CSDREB1B-1-RNAi-R (5'-ggatccatttaaatTG CGTGTTTGCTTGTTGGGT-3', SEQ ID NO.5, where lowercase letters represent Bam HⅠ and SwaⅠ restriction sites). The PCR amplification products were then subjected to agarose gel electrophoresis. Figure 2 Under UV light, agarose gel blocks containing the target fragment were cut off with a clean blade, and the DNA fragments were recovered using a kit (BioFlux, CAT: BSC02M1); among which,

[0052] The PCR amplification system was: 10 μmol·L⁻¹ -1 Upstream primer 2 μL, 10 μmol·L -1 2 μL of downstream primer, 15 μL of PrimeSTAR Max Premix, 3 μL of cDNA, and 8 μL of ddH2O;

[0053] The PCR amplification program was as follows: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min.

[0054] Example 2

[0055] Construction of CsDREB1B-1 gene interference vector

[0056] (1) The DNA fragments recovered in Example 1 were randomly divided into two groups. The first group was digested with SwaⅠ and AscⅠ, and the second group was digested with Bam HI and Sal I. The two groups of fragments recovered by enzyme digestion were ligated into the same pUC-RNAi (GenBank Accession No. AY310901) vector using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using the plasmid extraction kit (Omega, CAT: D6942), which yielded the intermediate vector pUC-RNAi-CsDREB1B-1 of the CsDREB1B-1 interference fragment.

[0057] (2) The intermediate vectors pUC-RNAi-CsDREB1B-1 and pLGNe were double-digested with SalI and AscI, respectively. The digestion products containing the RNAi fragment (i.e., dsRNA) were ligated into the pLGNe vector to construct the final interference vector pLGNe-CsDREB1B-1-RNAi. Figure 3 ).

[0058] Example 3

[0059] CsDREB1B-1 interference vector genetically transformed citrus

[0060] according to Figure 4 The procedure shown is for citrus genetic transformation. The specific steps are as follows:

[0061] 1. CsDREB1B-1 interference vector transformed Agrobacterium tumefaciens

[0062] The interference vector pLGNe-CsDREB1B-1-RNAi constructed in Example 2 was introduced into Agrobacterium tumefaciens EHA105 using an electroporation method. The method is as follows: Thaw 50 μL of frozen Agrobacterium competent cells EHA105 on ice; add 2 μL of the constructed interference vector plasmid to the competent cells, mix by pipetting, and place on ice for 5 min; transfer the mixture to the bottom of a pre-dried electroporation cuvette, place the cuvette into the slot and adjust to the correct position, set the electroporation device to the "Agr" setting, press the electroporation button, and check the electroporation data to ensure successful electroporation; add 1 mL of LB liquid medium to the electroporation cuvette, mix by pipetting, transfer to a sterile centrifuge tube, and incubate at 260 rpm and 28°C with shaking for 60 min; centrifuge the bacterial culture at 10000 rpm for 1 min, discard the supernatant (leaving approximately 100 μL for resuspending the bacterial cells), resuspend, spread, and incubate in the dark at 28°C for 2 days; after plaque growth, use primer CsDREB1B-1-RNAi-F (SEQ ID NO: 10 ... Single colonies were validated by PCR using pLGNe-CsDREB1B-1-RNAi-R (SEQ ID No. 4) and CsDREB1B-1-RNAi-R (SEQ ID No. 5), and positive colonies containing the pLGNe-CsDREB1B-1-RNAi vector were collected; among them,

[0063] The PCR amplification system was: 10 μmol·L⁻¹ -1 1 μL of upstream primer, 10 μmol·L -1 1 μL of downstream primer, 7.5 μL of 2×TaqMix, 1.5 μL of bacterial culture, and 4 μL of ddH2O;

[0064] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0065] 2. Obtaining the hypocotyl from citrus seedlings

[0066] Fresh citrus fruits were washed, surface-sterilized with 70% v / v alcohol, and seeds were extracted under aseptic conditions. The seed coats were removed, and seeds were germinated on seed germination medium (MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8). The seeds were cultured in the dark at 28°C for 2 weeks, followed by 1 week of 16 h light / 8 h dark conditions. Under aseptic conditions, the epicotyls of the germinated seedlings were cut into 1 cm stem segments for Agrobacterium-mediated genetic transformation.

[0067] 3. Preparation of Agrobacterium tumefaciens bacterial suspension

[0068] Before transfection, *Agrobacterium* strains (containing the pLGNe-CsDREB1B-1-RNAi vector) for transfection were streaked onto LB solid medium containing 50 mg / L kanamycin; single colonies were picked and inoculated into 25 mL of LB liquid medium containing the same antibiotic, and cultured overnight at 28°C with shaking; the bacterial culture was then diluted to OD0.05. 600 After reaching 0.1, continue culturing until OD... 600 Centrifuge at 0.5, 5000 rpm for 10 min, discard the supernatant, and resuspend in MS liquid medium at pH 5.4 to OD. 600 =0.5, used for transfection.

[0069] 4. Citrus epicotyl transformation

[0070] Citrus epicotyl stem segments were soaked in Agrobacterium tumefaciens solution for 13 min and then dried. The segments were then transferred to a co-culture medium (MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8) and incubated in the dark at 26°C for 2 days. After co-culture, the epicotyls were transferred to a selection medium (MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8) and incubated in the dark at 28°C for 7 days. The epicotyls were then cultured at 28°C under 16 h light / 8 h dark conditions, subcultured every two weeks. GUS staining was used to identify positive plants, and GUS-negative plants served as controls.

[0071] 5. Seedling culture of transformants

[0072] When the positive and negative control seedlings grow to more than 1 cm, they are cut off and grafted onto the Late Orange seedlings in sterile test tubes and cultured in seedling culture medium (MS + 30 g / L sucrose, pH 5.8); when the seedlings grow to about 5 cm, they are grafted onto Trifoliate orange seedlings and cultured in a greenhouse at 28℃.

[0073] Example 4

[0074] Verification of transgenic plants

[0075] 1. GUS staining identification of transgenic plants

[0076] Example 3: After grafting onto *Citrus trifoliata* seedlings and cultivating them in a greenhouse at 28℃ for 3 months, leaves from control (WT) and transgenic plants (R) were taken, cut into leaf discs, and subjected to GUS histochemical staining. 24 hours after staining, the leaf discs of positive plants (R1-8) showed blue edges, while the leaf discs of WT plants did not show color. Figure 5 This indicates that the target vector was successfully transferred into the transgenic plant.

[0077] 2. PCR identification of transgenic plants

[0078] 100 mg of leaves from wild-type (WT) and transgenic (R) plants were collected, and genomic DNA was extracted using a DNA extraction kit (Adley, CAT: DN15). PCR amplification was performed using the upstream primer ID-CsDREB1B-1-F (5'-ACAATGAATTATGAGCAAGTTCCTTAAG-3', SEQ ID NO.6) and the downstream primer ID-CsDREB1B-1-R (5'-GTTTCTGATCCTGGTTTGACTGAC-3', SEQ ID NO.7) to detect the integration of RNAi fragments into the citrus genome; among which,

[0079] The PCR amplification system was: 10 μmol·L⁻¹ -1 1 μL of upstream primer, 10 μmol·L -1 1 μL of downstream primer, 7.5 μL of 2×TaqMix, 1.5 μL of DNA, and 4 μL of ddH2O;

[0080] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0081] PCR results showed that positive plants (transgenic plants R1-8) yielded a 740bp amplified fragment, while WT plants showed no amplification. Figure 6 This indicates that the target gene was successfully integrated into the genome of the transgenic plant.

[0082] 3. qRT-PCR analysis of transgenic plants

[0083] Total RNA (Adelai, CAT No: RN09) was collected from leaves of wild-type trifoliate orange seedlings (WT) and transgenic plants (R). cDNA was synthesized using the PrimeScript RTMasterMix reverse transcription kit (TaKaRa, CAT: RR036A) and detected by qRT-PCR. Two PCR samples were used. -△△Ct The relative expression level of the CsDREB1B-1 gene in plants was calculated using the following method: The water-treated sample was defined as the reference factor, with its CsDREB1B-1 expression level set at 1. Then, the fold increase in gene expression relative to the reference factor in transgenic citrus was calculated as 2. -△△Ct , which is its relative expression level.

[0084] The detection primers were RT-CsDREB1B-1-F (5'-CACGCGGTGTTTGATATGCC-3', SEQ ID No. 8) and RT-CsDREB1B-1-R (5'-ACGACACACAGCCATCACTT-3', SEQ ID No. 9);

[0085] The PCR amplification system was as follows: 6 μL of SYBR qPCR Master Mix (Vazyme) and 10 μmol·L⁻¹. -1 Upstream primer 0.3 μL, 10 μmol·L -1 0.3 μL of downstream primer, 1 μL of cDNA, and 4.4 μL of ddH2O;

[0086] PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0087] The test results showed that the CsDREB1B-1 gene was significantly suppressed in transgenic plants compared to wild-type plants, with the lowest suppression being 49% in the wild-type. Figure 7 This indicates that CsDREB1B-1 transcription was successfully suppressed in the transgenic plants.

[0088] 4. Phenotypic observation of transgenic plants

[0089] Observation of the phenotype of 8 transgenic plants revealed no significant abnormalities in appearance or growth compared to wild-type Late Jin Orange seedlings. Figure 8 This indicates that CsDREB1B-1 interference did not have a significant impact on the plant's phenotype and development.

[0090] Example 5

[0091] Resistance evaluation of transgenic plants

[0092] Example 3: Mature leaves of wild-type trifoliate orange seedlings (WT) and transgenic plants (R) were washed, disinfected with 75% v / v alcohol, and rinsed with sterile water. They were then placed in a clean bench. Needle punctures were performed centered on the leaf veins, and 1 μL (1 × 10⁻⁶) of ulcer bacteria solution was pipetted into each puncture site. 5 CFU / mL); cultured in a 28℃ constant temperature and light incubator (16h light / 8h dark); photographed leaves 10 days after inoculation, the lesion area was counted using Image JV1.47 software, and the disease index was calculated according to the following formula.

[0093] The disease is classified into grades 0-7 based on the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R≤0.25mm). 2 ), Level 1 (0.25mm) 2<R≤0.5mm 2 ), Level 2 (0.5mm) 2 <R≤0.75mm 2 ), Level 3 (0.75mm) 2 <R≤1mm 2 ), Level 4 (1.0mm) 2 <R≤1.25mm 2 ), Level 5 (1.25mm) 2 <R≤1.5mm 2 ), Level 6 (1.5mm) 2 <R≤1.75mm 2 ), Level 7 (R > 1.75mm) 2 );

[0094] Disease Index (DI) = 100 × Σ[number of lesions at each level × corresponding level value] / (total number of lesions × maximum level).

[0095] The results showed that 10 days after inoculation with the causal agent of bacterial canker, both the CsDREB1B-1 interference plants and the WT plants grafted at the same time developed the disease to varying degrees, with some differences in the size of the lesions. Figure 9 According to statistics, the area of ​​lesions on the leaves of transgenic plants ( Figure 10 ) and disease index ( Figure 11 The lesions were significantly smaller than those in the wild-type control, with the maximum lesion count reduced to 44% of that in wild-type citrus leaves, and the disease index to 38% of that in wild-type citrus. Therefore, CsDREB1B-1 interference can greatly improve the resistance of citrus to citrus canker.

[0096] As can be seen from the above, interfering with the expression of the CsDREB1B-1 gene and reducing its transcription level can significantly improve the resistance of citrus to citrus canker without affecting the phenotype of transgenic plants. This has significant application value in citrus canker resistance breeding and can be used as a candidate gene to conduct canker resistance breeding with multiple canker resistance and susceptibility genes.

[0097] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of negative regulation of CsDREB1B-1 gene expression in improving citrus resistance to citrus canker, characterized in that, The amino acid sequence encoded by the CsDREB1B-1 gene is shown in SEQ ID NO.

1.

2. The application of products that negatively regulate CsDREB1B-1 gene expression in improving citrus resistance to and / or breeding citrus varieties resistant to citrus canker, characterized by: The nucleotide sequence of the CsDREB1B-1 gene is shown in SEQ ID NO.

2.

3. The application according to claim 2, characterized in that, The product includes dsRNA, a recombinant vector containing the dsRNA, or a recombinant bacterium containing the dsRNA.

4. A dsRNA that enhances the resistance of citrus to citrus canker, characterized in that, The forward nucleotide sequence of the dsRNA is shown in SEQ ID NO.

3.

5. A recombinant vector for enhancing resistance to citrus canker, characterized in that, The recombinant vector includes a base vector and an interfering fragment inserted into the base vector; The interfering fragment comprises the dsRNA, intron, and reverse complementary fragment of the dsRNA of claim 4, connected in sequence.

6. The recombinant vector according to claim 5, characterized in that, The underlying carrier includes pLGNe.

7. A recombinant bacterium that enhances the resistance of citrus to citrus canker, characterized in that, The recombinant bacteria include the basic bacteria introduced into the recombinant vector of claim 5 or 6.

8. The recombinant bacteria according to claim 7, characterized in that, The basic bacteria include Agrobacterium.

9. A method for improving the resistance of citrus to citrus canker, characterized in that, include: The recombinant vector of claim 5 or 6 or the recombinant bacteria of claim 7 or 8 are introduced into citrus.

Citation Information

Patent Citations

  • Casuarina equisetifolia gene CeDREB1 and application thereof

    CN111500595A

  • GHAP2-DREB gene and application thereof in improving verticillium wilt resistance of upland cotton

    CN118147168A