Cellulase mutants
By modifying cellulase through protein engineering and introducing specific amino acid mutations, the specific activity of cellulase was improved, solving the problem of insufficient specific activity of cellulase. This makes it suitable for the textile industry and reduces production costs.
Patent Information
- Application Number
- CN202411163990.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-26
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2042-08-26
AI Technical Summary
The insufficient specific activity of existing cellulases limits their widespread application in industrial production, especially their efficient utilization in the textile field.
By modifying cellulase through protein engineering and introducing specific amino acid mutations, such as S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G, its specific activity at 50℃ can be improved.
It significantly improves the specific activity of cellulase, reduces production costs, is suitable for the textile industry, reduces the amount of cellulase used, and saves labor and energy.
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and protein modification technology, specifically to a cellulase mutant and its applications. Background Technology
[0002] Cellulose, polymerized from glucose via β-1,4-glycosidic bonds, is the most abundant renewable biomass on Earth. However, current utilization of cellulose primarily relies on direct combustion, resulting in low utilization rates and air pollution. Therefore, the effective utilization of cellulose has become a core concern. Cellulase is a key factor in the effective utilization of cellulose. Cellulase is a collective term for a complex enzyme system capable of degrading cellulose. Currently, the main recognized functional enzymes are endo-β-1,4-glucanases (EGs, EC 3.2.1.4), exo-β-1,4-glucanases (CBHs, EC 3.2.1.91), and β-1,4-glucosidases (BGs, EC 3.2.1.21). Currently, cellulase is mainly used in the food, animal husbandry, pharmaceutical, textile, and biomass energy industries.
[0003] Nature provides a wide range of sources for cellulase, which is abundant in bacteria, fungi, and actinomycetes. Studies have shown that bacteria have a relatively weak ability to degrade cellulose because they can only secrete endoglucanases, most of which lack the ability to degrade cellulose crystals. Furthermore, bacterial cellulase cannot be secreted extracellularly, making extraction and purification difficult and costly, thus making them unsuitable for industrial production. Fungi are currently the most potent known cellulase-producing microorganisms, primarily because they can secrete extracellular cellulase. During their growth, fungal hyphae can penetrate the cuticle of plants, disrupting part of the lignocellulose structure and exposing cellulose. The secreted extracellular cellulase can directly bind to cellulose for enzymatic hydrolysis, thereby increasing degradation efficiency. Actinomycetes have a much lower ability to degrade cellulose than fungi and bacteria because their metabolism is very slow, resulting in extremely low cellulase production, fewer types of secreted cellulase, and weaker cellulase activity. Therefore, they are rarely used in industrial production.
[0004] Cellulase is essentially a protein, and its activity is affected by factors such as temperature, pH, enzyme concentration, substrate concentration, and ionic strength. Different types of cellulase have different optimal reaction conditions. Cellulase has advantages such as mild reaction conditions, high specificity, no production of other impurities, safety, and no pollution, making it a research hotspot in the industrialization of cellulose.
[0005] With the development of molecular biology technology, more and more researchers improve the enzymatic properties of enzymes by protein engineering. For example, Liu Dani uses error-prone PCR technology to modify the nucleotide sequence of multifunctional cellulase Nccle, thereby obtaining a multifunctional cellulase mutant Nccle-mut containing 13 mutation sites. Yao Bin et al. replace the N-terminal of high catalytic efficiency cellulase to the N-terminal of low catalytic efficiency cellulase, providing a high catalytic efficiency cellulase mutant. Under this modification condition, the specific activity of the mutant is 1.8-6.7 times higher than that of the wild type; the catalytic efficiency is 1-4.7 times higher than that of the wild type; the optimal temperature and pH value of the enzymatic reaction are unchanged. Wu Bin et al. use single-point mutation technology, based on homology modeling and molecular docking method, by selecting key amino acids in the enzyme activity architecture to optimize the molecular structure of endo-cellulase and improve enzyme activity, and obtain a class of sustained endo-cellulase mutants with significantly improved enzyme activity.
[0006] At present, there are a large number of studies on the modification of the enzymatic properties of cellulase to adapt to its application in different scenarios, but the specific activity is also a key indicator limiting the application of cellulase. The higher the specific activity of cellulase itself, the lower the production cost, and the lower the price of the enzyme, which will also be more conducive to promoting its widespread application. SUMMARY
[0007] The purpose of the present application is to provide a high specific activity cellulase mutant and its application. The present application obtains a mutant protein by protein engineering modification of cellulase. Compared with the wild type, the specific activity of the mutant is significantly improved, and can be widely used in the field of textile processing.
[0008] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:
[0009] The present application relates to a cellulase mutant, comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and comprising a substitution of amino acids at at least one position selected from the group consisting of 44, 84, 109, 123, 178, 183, 194, 225, and 234, compared with SEQ ID NO: 1.
[0010] In some embodiments of the present application, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO: 1.
[0011] In some more particular embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID NO: 1.
[0012] In some embodiments of the application, the mutant comprises a substitution of at least one amino acid in the group: S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, S234G.
[0013] In some embodiments of the application, the mutant comprises a substitution or combination of substitutions of:
[0014] S44N;
[0015] S44N / S84D;
[0016] S44N / S109V;
[0017] S44N / S111N;
[0018] S44N / I123L;
[0019] S44N / Q147R;
[0020] S44N / A178S;
[0021] S44N / L194I;
[0022] S44N / T225P;
[0023] S44N / S84D / S111N;
[0024] S44N / S109V / S111N;
[0025] S44N / S109V / I123L;
[0026] S44N / S109V / Q147R;
[0027] S44N / S111N / I123L;
[0028] S44N / S111N / L194I;
[0029] S44N / I123L / Q147R;
[0030] S44N / I123L / A178S;
[0031] S44N / I123L / L194I;
[0032] S44N / I123L / S234G;
[0033] S44N / Q147R / A178S;
[0034] S44N / Q147R / F183V;
[0035] S44N / A178S / L194I;
[0036] S44N / Q147R / T225P;
[0037] S44N / A178S / S234G;
[0038] S44N / S111N / I123L / Q147R;
[0039] S44N / S111N / I123L / L194I;
[0040] S44N / I123L / Q147R / F183V;
[0041] S44N / I123L / Q147R / L194I;
[0042] S44N / I123L / Q147R / F183V;
[0043] S44N / I123L / Q147R / L194I;
[0044] S44N / Q147R / F183V / T225P;
[0045] S44N / Q147R / F183V / S234G;
[0046] S44N / S84D / I123L / Q147R / F183V;
[0047] S44N / S84D / I123L / Q147R / L194I;
[0048] S44N / S111N / I123L / Q147R / L194I;
[0049] S44N / I123L / Q147R / A178S / L194I;
[0050] S44N / I123L / F183V / L194I / T225P;
[0051] S44N / I123L / Q147R / F183V / L194I / S234G;
[0052] S84D;
[0053] S84D / S109V;
[0054] S84D / S111N;
[0055] S84D / I123L;
[0056] S84D / Q147R;
[0057] S84D / F183V;
[0058] S84D / S109V / S111N;
[0059] S84D / S109V / I123L;
[0060] S84D / S111N / I123L;
[0061] S84D / I123L / F183V;
[0062] S84D / I123L / T225P;
[0063] S84D / I123L / S234G;
[0064] S109V;
[0065] S109V / S111N;
[0066] S109V / Q147R;
[0067] S109V / A178S;
[0068] S109V / L194I;
[0069] S109V / I123L / L194I;
[0070] S109V / I123L / T225P;
[0071] S109V / I123L / S234G;
[0072] S111N / Q147R / L194I;
[0073] S111N / I123L / Q147R / L194I;
[0074] S111N / I123L / Q147R / L194I / S234G;
[0075] I123L;
[0076] I123L / Q147R;
[0077] I123L / A178S;
[0078] I123L / L194I;
[0079] I123L / F183V;
[0080] I123L / Q147R / A178S;
[0081] I123L / Q147R / L194I;
[0082] I123L / Q147R / T225P;
[0083] I123L / A178S / L194I;
[0084] I123L / Q147R / A178S / L194I;
[0085] Q147R / A178S;
[0086] Q147R / L194I;
[0087] Q147R / A178S / L194I;
[0088] A178S;
[0089] A178S / F183V;
[0090] A178S / L194I;
[0091] A178S / T225P;
[0092] A178S / S234G;
[0093] A178S / L194I / S234G;
[0094] Q147R;
[0095] Q147R / L194I;
[0096] A178S;
[0097] A178S / L194I;
[0098] A178S / S234G;
[0099] F183V;
[0100] F183V / T225P;
[0101] F183V / S234G;
[0102] F183V / L194I / S234G;
[0103] L194I;
[0104] S111N / L194I;
[0105] L194I / S234G;
[0106] T225P;
[0107] S234G.
[0108] The present application also relates to a DNA molecule encoding the above cellulase mutant.
[0109] The present application also relates to a recombinant expression vector comprising the above DNA molecule.
[0110] The present application also relates to a host cell comprising the above recombinant expression vector.
[0111] In some embodiments of the present application, the host cell is Trichoderma reesei.
[0112] The above recombinant expression vector is transformed into the Trichoderma reesei host cell for recombinant expression, and the cellulase mutant obtained has higher specific activity.
[0113] The present application also relates to the application of the above cellulase mutant in the textile field.
[0114] The cellulase mutant provided by the present application has higher specific activity under the condition of 50 DEG C. Compared with the wild type, the specific activity of the cellulase mutant containing S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, S234G single-point mutation respectively is generally increased by 7.1%-38% under the condition of 50 DEG C. Among them, the specific activity of the S44N single-point mutant, the I123L single-point mutant and the L194I single-point mutant is increased by 26.8%, 25.7% and 38% respectively, and unexpected technical effects are achieved.
[0115] In addition, the application provides S44N / S111N, S111N / L194I, I123L / F183V, I123L / Q147R, F183V / S234G, L194I / S234G two-point mutants; S44N / S111N / I123L, S44N / S111N / L194I, S44N / I123L / L194I, S111N / Q147R / L194I, I123L / Q147R / T225P three-point mutants; S44N / S111N / I123L / L194I, S44N / I123L / Q147R / L194I, S44N / Q147R / F183V / T225P four-point mutants; S44N / S111N / I123L / Q147R / L194I, S111N / I123L / Q147R / D179S / L194I, S44N / I123L / F183V / L194I / T225P five-point mutants, and S44N / I123L / Q147R / F183V / L194I / S234G six-point mutants, the specific activity of which is generally increased by 10%-59% at 50°C compared with wild-type cellulase NT45, and an unexpected technical effect is achieved.
[0116] In summary, the cellulase mutants of the application are more suitable for application in the field of textile industry than wild-type cellulase, can greatly reduce the amount of cellulase, save time and energy, and reduce production cost. DETAILED DESCRIPTION
[0117] The application uses conventional techniques and methods used in the field of genetic engineering and molecular biology, such as the methods described in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, the application is not limited to any specific method, experimental protocol and reagent described.
[0118] The application will be described in detail below with reference to the specific embodiments.
[0119] Example 1 Screening of cellulase mutants
[0120] In order to improve the specific activity of wild-type cellulase NT45 (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2), the applicant screened a large number of mutations of amino acids near the active site of the enzyme by directed evolution technology.
[0121] PCR primers NtE-F1, NtE-R1 are designed as follows:
[0122] NtE-F1: GGC GAATTC ATGCGCTCCT CCACCATTC (underlined is the restriction endonuclease EcoRI recognition site);
[0123] NtE-R1: ATA GCGGCCGC TTAGGCGCACTGGTGGTAGTAGTC (underlined is the restriction endonuclease NotI recognition site).
[0124] The wild-type cellulase NT45 gene (SEQ ID NO: 2) is used as a template, and the above-mentioned primers are used for PCR amplification by using a GeneMorph II random mutation PCR kit (Stratagene). The PCR product is recovered by gel, and is subjected to enzyme treatment by EcoRI and NotI, and then is connected with a pET21a vector subjected to the same enzyme treatment. The connection product is transformed into Escherichia coli BL21 (DE3), and is coated on an LB+Amp plate. The plate is subjected to inverted culture at 37℃. When the transformants appear, they are picked one by one by using a toothpick, and are added into 150 μL of LB+Amp medium containing 0.1 mM IPTG in each hole of a 96-hole plate. The plate is cultured at 37℃ and 220 rpm for about 6 hours. The supernatant is discarded by centrifugation, and the bacterial body is resuspended by using a buffer. The bacterial body is repeatedly frozen and thawed to break the wall, and a cellulase-containing Escherichia coli cell lysate is obtained.
[0125] 50 μL of the lysate is taken out to two new 96-hole plates, and the cellulase enzyme activity and the protein content are respectively measured at 50℃. The specific activity of different mutants is calculated.
[0126] The experimental results show that some mutations have no influence on the specific activity of the cellulase at 50℃, some mutations even make the specific activity of the cellulase become worse, and some mutations can improve the specific activity of the cellulase, but the enzymatic properties of the cellulase are changed significantly after the mutations. These do not meet the requirements. Finally, the applicant obtains the mutation sites with the specific activity of the cellulase at 50℃ significantly improved, which are S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P and S234G.
[0127] On the basis of the cellulase NT45, the application provides cellulase mutants containing S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P and S234G single mutation sites, respectively.
[0128] The present invention also provides cellulase mutants containing at least 2, at least 3, at least 4, at least 5, or at least 6 mutation sites selected from S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G. Examples include: two-point mutants such as S44N / S111N, S111N / L194I, I123L / F183V, I123L / Q147R, F183V / S234G, and L194I / S234G; three-point mutants such as S44N / S111N / I123L, S44N / S111N / L194I, S44N / I123L / L194I, S111N / Q147R / L194I, and I123L / Q147R / T225P; and S44N / S111N / I123L / L194V / Q147R / T225P. Four-point mutants such as 4I, S44N / I123L / Q147R / L194I, and S44N / Q147R / F183V / T225P; five-point mutants such as S44N / S111N / I123L / Q147R / L194I, S111N / I123L / Q147R / D179S / L194I, and S44N / I123L / F183V / L194I / T225P; and six-point mutants such as S44N / I123L / Q147R / F183V / L194I / S234G.
[0129] Example 2: Expression of cellulase mutant in Trichoderma reesei
[0130] Based on the codon preference of Trichoderma, the gene sequence of cellulase NT45 (SEQ ID NO:2) and the gene sequence of the mutant were optimized and synthesized, and two restriction sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequence, respectively.
[0131] 2.1 Construction of expression vector
[0132] The synthesized plasmid was digested with restriction endonucleases KpnI (Fermentas) and XbaI, respectively; simultaneously, plasmid pTGII was digested with restriction endonucleases KpnI (Fermentas) and XbaI. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After successful sequencing, the recombinant plasmid containing the cellulase gene was obtained.
[0133] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).
[0134] 2.2 Preparation of protoplasts
[0135] Trichoderma reesei U4 spore suspension was taken from the cellulase gene-deficient host strain, inoculated on PDA plates, and cultured at 30°C for 6 days. After the spores were abundant, a colony of about 1 cm x 1 cm was cut and placed in a liquid medium containing 120 mL YEG+U (0.5% yeast extract, 1% glucose, 0.1% uridine), and cultured at 30°C with 220 rpm shaking for 14-16 h. The mycelium was collected by filtering with sterile gauze and washed once with sterile water. The mycelium was placed in a flask containing 20 mL of 10 mg / mL lysozyme solution (Sigma L1412), and incubated at 30°C with 90 rpm for 1-2 h. The progress of protoplast transformation was observed and detected under a microscope.
[0136] Pre-cooled 20 mL of 1.2M sorbitol (1.2M sorbitol, 50mM Tris-Cl, 50mM CaCl2) was added to the flask, shaken gently, and the filtrate was collected by filtering with sterile Miracloth. The filtrate was centrifuged at 3000 rpm and 4°C for 10 min. The supernatant was discarded, and 5 mL of pre-cooled 1.2M sorbitol solution was added to suspend the mycelium. The mixture was centrifuged at 3000 rpm and 4°C for 10 min. The supernatant was discarded, and an appropriate amount of pre-cooled 1.2M sorbitol was added to suspend the mycelium (200 μL / tube, protoplast concentration 10 8
[0137] 2.3 Transformation of expression vector and strain verification
[0138] All operations were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution, followed by the addition of 50 μL of 25% PEG (25% PEG, 50mM Tris-Cl, 50mM CaCl2). The tube was shaken gently and mixed, and then placed on ice for 20 min. 2 mL of 25% PEG was added, mixed, and then placed at room temperature for 5 min. 4 mL of 1.2M sorbitol was added, mixed gently, and then poured into the upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agar) which was melted and kept at 55°C. After gentle mixing, it was spread on the prepared lower medium plate (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar), and cultured at 30°C for 5-7 days until the transformants grew. The transformants were picked to the lower medium plate for re-screening, and cultured at 30°C for 2 days. The strains with smooth colony edges were positive transformants.
[0139] Take the appropriate amount of mycelium in 2 mL centrifuge tube, add 100 mg sterile quartz sand and 400 μL extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS); use the bead to shake 2 min; after 20 min in 65 ℃ water bath, add 200 μL 10 M NH4AC, ice bath 10 min; 13000 rpm centrifugal 10 min; take the supernatant, add 2 times the volume of absolute ethanol, -20 ℃ for 30 min; 13000 rpm centrifugal 10 min, discard the supernatant; wash with 70% ethanol twice; dry, add water to dissolve, store at -20 ℃.
[0140] The above extracted transformant genomic DNA is used as a template, and the primer M6-F and M6-R are used for PCR amplification of the target gene to verify.
[0141] M6-F: ATGCGCTCCT CCACCATTC;
[0142] M6-R: TTAGGCGCACTGGTGGTAGTAGTC.
[0143] The PCR amplification conditions are 94 ℃ for 4 min; 94 ℃ for 40 s; 58 ℃ for 40 s, 72 ℃ for 1 min, 30 cycles; 72 ℃ for 7 min, 16 ℃; the PCR amplification product is recovered by using a gel recovery kit and sequenced.
[0144] According to the above method, the applicant respectively constructs the recombinant expression cellulase NT45 and the Trichoderma reesei engineering strain of the above mutant.
[0145] Example 3 Fermentation verification
[0146] The above constructed Trichoderma reesei engineering strain is inoculated into a PDA solid plate, and cultured at 30 ℃ for 6 d; when the spores are abundant, two pieces of mycelium with a diameter of 1 cm are inoculated into a 250 mL flask containing 50 mL fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn syrup, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements), and cultured at 30 ℃ for 48 h, and then at 25 ℃ for 48 h. The fermentation broth is centrifuged to obtain the fermentation supernatant containing cellulase NT45 and the above mutant, respectively.
[0147] 3.1 Enzyme activity determination
[0148] (1) Definition of cellulase enzyme activity
[0149] The enzyme amount required for releasing 1 μmol of reducing sugar from a 5 mg / ml sodium hydroxymethyl cellulose solution at 50°C and pH 6.0 is one enzyme activity unit U, and the reducing sugar is equivalent to glucose.
[0150] (2) Cellulase enzyme assay method
[0151] Three test tubes are taken, each of which is added with 0.5 ml of CMC substrate, and preheated together with the enzyme solution to be tested in a 50°C water bath for 5 minutes. In the first and second test tubes, 0.5 ml of the solution to be tested is added, and the time is counted, and the reaction is carried out in a 50°C water bath for 15 minutes. After the reaction is completed, 1.5 ml of DNS reagent is added to each of the three test tubes, and 0.5 ml of the enzyme solution to be tested is added to the third test tube. After taking out and shaking the three test tubes, the reaction is carried out in a boiling water bath for 5 minutes. Rapidly cool to room temperature, and dilute with water to 5.0 ml. The absorbance of the first and second test tubes is measured at a wavelength of 540 nm with the third test tube as a control. The absorbance is preferably between 0.25 and 0.35. The absolute value of the difference between the absorbance of the enzyme solution to be tested and the absorbance of the control enzyme solution is not more than 0.015.
[0152] Enzyme activity X = (glucose equivalent value / 180 / 15 / 0.5) x n.
[0153] Wherein: X - enzyme activity unit, IU / g (mL);
[0154] 180 - glucose converted from micrograms to micromoles;
[0155] 15 - reaction time of the solution to be tested with the substrate;
[0156] 0.5 - the amount of enzyme solution to be tested added to the reaction;
[0157] n - dilution factor.
[0158] (3) Determination results
[0159] According to the above method, the enzyme activity detection results show that the enzyme activity of the fermentation supernatant of the recombinant Trichoderma reesei engineering bacteria of the wild-type cellulase NT45 and its mutants constructed above is 80-150 U / mL at 50°C.
[0160] 3.2 Protein content determination
[0161] (1) Determination method:
[0162] The determination of protein content by Coomassie brilliant blue (Bradford) binding method is a composite method combining colorimetric method and color method. Coomassie brilliant blue G-250 is brown red in an acid solution, and becomes blue after being combined with protein, and in a certain concentration range of protein, complies with Beer's law, and can be colorimetrically determined at 595 nm. A large amount of absorption is formed in 3-5 minutes, and is stable for at least 1 hour. In the range of 10-1000 μg / mL, the absorbance value is proportional to the protein concentration.
[0163] The enzyme solution and the Coomassie brilliant blue solution are mixed according to the volume ratio of 1:5, and are placed for 10 min, and the protein content is determined by the Coomassie brilliant blue (Bradford) binding method.
[0164] (2) Protein content determination results
[0165] The cellulase protein content in the fermentation supernatant of the Trichoderma reesei engineering bacteria expressing the wild-type cellulase NT45 and the mutants thereof is determined by the above method. The results show that the protein content of the fermentation supernatant of the Trichoderma reesei engineering bacteria expressing the wild-type cellulase NT45 and the mutants thereof is 0.04-0.1 mg / mL under the condition of 50℃.
[0166] 3.3 Calculation of specific activity
[0167] The "specific activity" refers to the number of enzyme activity units in unit weight of protein, which is generally expressed by U / mg protein. Generally, the higher the specific activity of an enzyme, the purer the enzyme.
[0168] The specific activity calculation formula is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).
[0169] The specific activity of the fermentation supernatant of the Trichoderma reesei engineering bacteria expressing the wild-type cellulase NT45 and the mutants thereof constructed in Example 3 under the condition of 50℃ is shown in Table 1.
[0170] Table 1 Specific activity of cellulase NT45 and mutants thereof under the condition of 50℃
[0171] Cellulase 50°C specific activity (U / mg) Cellulase NT45 280 S44N single point mutant 355 S84D single point mutant 314 S109V single point mutant 300 I123L single point mutant 387 A178S single point mutant 333 F183V single point mutant 304 L194I single point mutant 352 T225P single point mutant 320 S234G single point mutant 330
[0172] As can be seen from the data in Table 1, compared with the wild-type cellulase NT45, the specific activity of the single-point mutants provided by the application under the condition of 50℃ is generally increased by 7.1%-38%, thereby indicating that the specific activity of the single-point mutants provided by the application under the low-temperature condition of 50℃ is significantly improved. The specific activity of the S44N single-point mutant, the I123L single-point mutant and the L194I single-point mutant is increased by 26.8%, 25.7% and 38% respectively, and an unexpected technical effect is achieved.
[0173] In addition, the S44N / S111N, S111N / L194I, I123L / F183V, I123L / Q147R, F183V / S234G, L194I / S234G two-point mutant, S44N / S111N / I123L, S44N / S111N / L194I, S44N / I123L / L194I, S111N / Q147R / L194I, I123L / Q147R / T225P three-point mutant, S44N / S111N / I123L / L194I, S44N / I123L / Q147R / L194I, S44N / Q147R / F183V / T225P four-point mutant, S44N / S111N / I123L / Q147R / L194I, S111N / I123L / Q147R / D179S / L194I, S44N / I123L / F183V / L194I / T225P five-point mutant, and S44N / I123L / Q147R / F183V / L194I / S234G six-point mutant provided by the application have a specific activity at 50℃ that is 10%-59% higher than that of wild-type cellulase NT45, and an unexpected technical effect is achieved.
[0174] Example 4 Application of the cellulase mutant in the dyeing and unhairing one-bath process of knitted and woven fabrics
[0175] The application temperature is 35-55℃;
[0176] The treatment time is 30-150min;
[0177] The pH range is 4.0-8.5;
[0178] The above process conditions are particularly suitable for dyeing in the same bath; the applicable bath ratio range is 1:5-1:30, the type of equipment used is overflow dyeing machine, jigger dyeing machine, washing machine, etc., and the dosage of the cellulase mutant is 240-800U / L.
[0179] The cellulase mutant provided by the application can achieve clean unhairing, small fabric strength loss, and one-bath integration of dyeing and unhairing processes.
[0180] Compared with the wild-type cellulase NT45, the dosage of the cellulase mutant required to achieve the same treatment effect is reduced by 31-77%, thereby significantly reducing the enzyme cost in the processing process and being conducive to further reducing the production cost.
Claims
1. A cellulase mutant, characterized in that, The mutant is a cellulase with the amino acid sequence SEQ ID NO:1, in which the amino acid at position 123 is mutated from Ile to Leu.
2. A DNA molecule encoding the cellulase mutant of claim 1.
3. A recombinant expression vector, characterized in that, The recombinant expression vector carries the DNA molecule described in claim 2.
4. A host cell, characterized in that, The host cell carries the recombinant expression vector as described in claim 3.
5. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).
Citation Information
Patent Citations
Low temperature resistant cellulase mutant
CN112795554A
High-specific-activity cellulase mutant and application thereof
CN112795555A