A kind of alginate lyase Aly6 and recombinant expression vector, engineering bacteria and method

Abstract

The present invention relates to an alginate lyase Aly6 and a recombinant expression vector, an engineering bacterium and a method, and belongs to the field of marine biological genetic engineering. The amino acid sequence of the alginate lyase is shown in SEQ ID NO: 2. The alginate lyase of the present invention has a substrate preference for sodium alginate, can degrade sodium alginate well, has a high enzyme activity in the range of 25°C to 55°C, has a wide action temperature, has good tolerance to a variety of metal ions, and has advantages in the development of brown algae resources in combination with alginate lyases with different substrate preferences, and in the preparation of brown algae oligosaccharides with specific functions by degrading sodium alginate.

Description

Technical Field

[0001] The invention relates to the field of marine biological genetic engineering, in particular to an alginate lyase Aly6 and a recombinant expression vector, an engineering bacterium and a method. Background Art

[0002] Alginate is the main component of the cell wall of brown algae. The content of alginate in the cell wall of brown algae varies with different algae species, different growth times and different parts, and can reach up to 40% of the dry weight. Alginate is a linear polysaccharide composed of β-D-mannuronic acid (β-D-mannuronopyranosyl, M) monomers and its C5 diastereomer α-L-guluronopyranosyl (α-L-guluronopyranosyl, G) monomers. As a natural polysaccharide derived from the ocean, the composition, monomer sequence and source of alginate have an important influence on its properties. Among them, alginate with a high content of G exhibits stronger gelling properties, while alginate with a high content of M is more viscous. The gel properties of alginate are widely used in sewage treatment, soil conditioners and drug carriers. Sodium alginate is the sodium salt form of alginate, usually as a derivative of alginate. Sodium alginate is generally considered to be non-toxic and biocompatible, so it is widely used in the pharmaceutical and food industries. However, due to the large molecular weight of alginate, its solubility and bioavailability are poor, which limits its large-scale application. Therefore, researchers have been committed to converting large molecular polysaccharides into small molecular polysaccharides or oligosaccharides to improve their bioavailability and maximize the efficacy of polysaccharides.

[0003] Enzyme degradation has the advantages of mild reaction conditions, simple production steps, high production efficiency and low energy consumption. Based on the above reasons, the preparation of brown algae oligosaccharides by enzyme degradation has received widespread attention. The source of alginate lyase is extremely wide, mainly from marine algae, bacteria, fungi, molluscs and soil microorganisms, and even the presence of alginate lyase has been found in individual viruses. At present, the alginate lyase derived from marine bacteria is the most discovered and the most widely sourced, such as bacteria such as Vibrio, Pseudomonas, Microvesicles, and Paenibacillus. Therefore, screening out high activity, wide substrate applicability and improving the activity and stability of existing alginate lyases have become the characteristics of current research. The alginate lyases currently found are mostly isolated from different organisms, and there are problems such as unstable activity and poor metal ion tolerance. Therefore, the development of alginate lyases with excellent characteristics is of great significance for improving the yield and quality of brown algae oligosaccharides with specific functions. Summary of the invention

[0004] The purpose of the present application is to provide an alginate lyase Aly6 and a recombinant expression vector, an engineering bacterium and a method, aiming to solve the problems existing in the prior art.

[0005] An embodiment of the present application provides an alginate lyase Aly6, whose amino acid sequence is shown in SEQ ID NO:2.

[0006] The upstream primer sequence used to amplify the alginate lyase Aly6 nucleotide sequence is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:4.

[0007] A recombinant expression vector, wherein a nucleic acid fragment encoding the amino acid sequence of the alginate lyase Aly6 is inserted into the genetic sequence of the recombinant expression vector.

[0008] An engineered bacterium, wherein the recombinant expression vector is transformed into the engineered bacterium.

[0009] A method for applying alginate lyase Aly6, and application of the alginate lyase Aly6 in the development and utilization of brown algae resources and in the preparation of brown algae oligosaccharides by degrading sodium alginate.

[0010] A method for preparing alginate lyase Aly6 comprises the following steps:

[0011] S1. Based on the nucleotide sequence of alginate lyase Aly6, primers that can specifically bind to the Aly6 nucleotide sequence are designed and synthesized, the upstream primer Aly6F sequence is shown in SEQ ID NO: 3, and the downstream primer Aly6R sequence is shown in SEQ ID NO: 4;

[0012] S2. PCR amplification was performed using the genomic DNA of the Mesonia sp. strain as a template; the PCR product was digested with restriction endonucleases HindIII and XhoI, and then ligated to a vector with the same restriction sites using a ligase, and then transferred into competent E. coli DH5α and coated on LB medium containing 50 μg / mL kanamycin sulfate for screening, thereby obtaining a recombinant expression vector containing the alginate lyase gene Aly6F;

[0013] S3. The recombinant expression vector was extracted from E. coli DH5α and transformed into E. coli BL21 (DE3) to obtain a recombinant strain containing alginate lyase Aly6. The recombinant strain was inoculated into 20 mL of LB medium containing 50 μg / mL kanamycin sulfate for stable subculture, and IPTG with a final concentration of 0.1 mM was added to induce expression. The cells were collected by centrifugation, resuspended in lysis buffer, and lysozyme with a final concentration of 1 mg / mL was added, and ultrasonically disrupted. The centrifuged supernatant was collected to obtain a crude enzyme solution;

[0014] S4. Add the prepared crude enzyme solution to the pre-equilibrated His tag, wash 3 times with 10 mL of washing buffer, elute 4 times with elution buffer after washing, the elution volume is 5 mL, collect the eluate in batches, and perform SDS-PAGE electrophoresis on the eluate to detect the protein purity, and obtain the purified alginate lyase Aly6.

[0015] The lysis buffer is: 20 mM Tris-HCl buffer, pH 7.4; the washing buffer is: 20 mM Tris-HCl buffer, 500 mM NaCl, 2 mM imidazole, pH 7.4; the elution buffer is 20 mM Tris-HCl buffer, 500 mM NaCl, 50 mM imidazole, pH 7.4.

[0016] The beneficial effects of the present invention are as follows: the alginate lyase of the present invention has a substrate preference for sodium alginate, can degrade sodium alginate well, has high enzyme activity in the range of 25°C to 55°C, has a wide action temperature range, has good tolerance to a variety of metal ions, and has advantages in developing brown algae resources in combination with alginate lyases with different substrate preferences, and in degrading sodium alginate to prepare brown algae oligosaccharides with specific functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the SDS-PAGE electrophoresis diagram of the purified Aly6 enzyme protein.

[0018] Figure 2 This is a graph showing the effect of different temperatures on Aly6 enzyme activity.

[0019] Figure 3 This is a diagram showing the stability of Aly6 enzyme at different temperatures.

[0020] Figure 4 This is a graph showing the effect of different pH on Aly6 enzyme activity.

[0021] Figure 5 This is a graph showing the effects of different chemical reagents on Aly6 enzyme activity.

[0022] Figure 6 This is a diagram showing the effect of Aly6 enzyme on the hydrolysis of different substrates.

[0023] Figure 7 This is the analysis diagram of the degradation products of Aly6 enzyme. DETAILED DESCRIPTION

[0024] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Example 1. Preparation of alginate lyase Aly6

[0026] 1. Homology analysis of alginate lyase Aly6

[0027] The present invention identifies a protein sequence of a potential alginate lyase Aly6 gene from the genome of a strain Mesonia sp. screened from seawater. It is verified that Aly6 is a mature protein gene of alginate lyase, and its nucleotide sequence is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2.

[0028] Analysis using the NCBI online Blast tool found that the highest homology between the mature protein sequence of the alginate lyase Aly6 and its homologous proteins did not exceed 85%, and the amino acid sequence identity with the polysaccharide lyase family 6 (PL6) from Salegentibacter echinorum was 71.60%, indicating that the enzyme screened in the present invention is a new alginate lyase belonging to the PL6 family.

[0029] 2. Preparation of alginate lyase Aly6

[0030] The method for preparing alginate lyase Aly6 comprises the following steps:

[0031] S1. Based on the nucleotide sequence of alginate lyase gene Aly6, a primer that can specifically bind to the Aly6 nucleotide sequence is designed and synthesized.

[0032] Upstream primer sequence Aly6F: (SEQ ID NO: 3)

[0033] 5'- GGATCTTCCAGAGATTCTAGAATGCAAAAAACAACTGGTGGAGAA -3'

[0034] Downstream primer sequence Aly6R: (SEQ ID NO: 4)

[0035] 5'-CTGCCGTTCGACGATAAGCTTTTAATAACTTAATAGTCCTATGGTTTCTATACC -3'

[0036] S2, PCR amplification and construction of recombinant plasmid;

[0037] The genomic DNA of Mesonia sp. strain was extracted using a bacterial genomic DNA rapid extraction kit (Shanghai Bioengineering Co., Ltd.), and the extracted genomic DNA of Mesonia sp. strain was used as a template and amplified using Aly6F and Aly6R primers. The amplification system (50 μL) is shown in Table 1:

[0038] Table 1 PCR amplification system

[0039] Taq enzyme (5U / μL, TaKaRa) 0.25μL <![CDATA[10X PCR Buffer(Mg 2+ plus)]]> 5μL dNTP Mixture (2.5 mM each) 4μL Mesonia sp. genomic DNA 2μL Aly6F (10 μM) 1μL Aly6R (10 μM) 1μL <![CDATA[ddH2O]]> 36.25μL

[0040] The amplification conditions were as follows: 95℃ pre-denaturation for 3min; 95℃ 20s, 55℃ 20s, 72℃ 60s, 30 cycles. The PCR product was recovered by gel, digested with restriction endonucleases HindIII and XhoI (Shanghai Biyuntian Company), and ligated to the pET-28a vector digested with the same restriction endonucleases using T4 ligase (TaKaRa Company); the ligation product was mixed with E. coli DH5α competent cells, placed on ice for 30min, heat-shocked at 42℃ for 45s, and then 1000μL LB liquid medium was added, revived at 37℃ and 150rpm for 2h, centrifuged and coated on LB solid medium containing 50μg / mL kanamycin sulfate (Shanghai Shenggong Company), cultured at 37℃ overnight, screened the recombinant plasmid, and double-digested and sequenced the recombinant plasmid to obtain the recombinant plasmid containing the alginate lyase gene Aly6F.

[0041] LB medium: each liter contains 10 g of peptone, 5 g of yeast extract, and 10 g of NaCl; pH 7.0.

[0042] S3, gene expression induction and preparation of crude enzyme solution;

[0043] The recombinant plasmid was extracted from E. coli DH5α using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Shenggong Company) and then transformed into E. coli BL21 (DE3) to obtain a recombinant strain containing the alginate lyase gene. The recombinant strain was inoculated into 20 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate for overnight culture, and then inoculated into 500 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate at a 2% inoculum, and cultured at 37°C and 150 rpm until the OD600 was about 0.6. IPTG (isopropyl-β-D-thiogalactopyranoside) was added to make the final concentration 0.1 mM, and expression was induced overnight at 16°C and 150 rpm, and then the bacteria were collected by centrifugation at 8000 rpm for 5 min. The cells were then resuspended in 15 mL of lysis buffer (20 mM Tris-HCl buffer, pH 7.4), lysozyme was added to give a final concentration of 1 mg / mL, and the cells were allowed to stand on ice for 30 min. Ultrasonic disruption was performed at a power of 120 W and a working / interval time of 4 s / 4 s for 15 min. The cells were centrifuged at 6000 rpm at 4°C for 5 min, and the supernatant was collected to obtain the crude enzyme solution.

[0044] S4, enzyme purification;

[0045] Add the prepared crude enzyme solution to the pre-equilibrated His tag (BeyoGold™ His-tag Purification Resin purchased from Shanghai Beyotime), mix at 4°C for 2h and discard the waste liquid. Wash three times with 10mL washing buffer (20mMTris-HCl buffer, 500mM NaCl, 2mM imidazole, pH7.4), elute four times with elution buffer (20mMTris-HCl buffer, 500mM NaCl, 50mM imidazole, pH7.4) after washing, the elution volume is 5mL, collect the eluate in batches, and perform SDS-PAGE electrophoresis on the eluate to detect protein purity. The results are as follows Figure 1 As shown, purified alginate lyase Aly6 was obtained.

[0046] Example 2. Enzymatic properties of alginate lyase Aly6

[0047] 1. Method for determining the activity of alginate lyase Aly6

[0048] The reducing sugar content was determined by the DNS method. 100 μL of diluted enzyme solution and 900 μL of 1% sodium alginate (Shanghai Sinopharm Group) substrate were mixed and reacted at 40°C for 20 min. After the reaction was completed, 1000 μL of DNS reagent (3,5-dinitrosalicylic acid, Shanghai Shenggong Company) was added, boiled for 5 min, and immediately placed in running water to cool, and the OD540 value was determined (with the inactivated enzyme solution as a control), and the reducing sugar amount and enzyme activity were calculated according to the standard curve. Enzyme activity unit definition: Under the above determination conditions, the amount of enzyme required to cleave sodium alginate per minute to produce 1 μg of reducing sugar is defined as one enzyme activity unit (U).

[0049] 2. Determination of the optimal reaction temperature of alginate lyase Aly6

[0050] The enzyme activity was measured at 20℃~65℃ with 1% sodium alginate prepared in 50mM Tris-HCl buffer (pH8.0) as substrate, and the relative enzyme activity at different temperatures was calculated with the maximum enzyme activity as 100%. Figure 2 As shown, the optimum reaction temperature of the enzyme is 45°C. The enzyme activity is higher in the range of 40°C to 55°C, and its relative enzyme activity remains above 80%; in the range of 20°C to 65°C, its relative enzyme activity remains above 50%.

[0051] 2. Determination of temperature stability of alginate lyase Aly6

[0052] The enzyme solution was placed at 4°C, 40°C, 45°C and 50°C, and the activity of the residual enzyme was measured at different time intervals. 1% sodium alginate prepared with 50mM Tris-HCl buffer (pH8.0) was used as the substrate for enzyme activity determination. The maximum enzyme activity at the same temperature was taken as 100%, and the relative enzyme activity at different temperatures was calculated. The results are shown in Figure 3 As shown, the residual enzyme activity of the enzyme remained above 90% within 210 min at 4°C, the residual enzyme activity remained above 50% within 210 min at 40°C, the residual enzyme activity was 58% within 60 min at 45°C, and almost all enzyme activity was lost after 60 min at 50°C.

[0053] 3. Determination of the appropriate reaction pH of alginate lyase Aly6

[0054] The enzyme activity was measured at 45°C using 1% sodium alginate prepared in different buffers (50mM citric acid buffer, pH 3.0-6.0; 50mM phosphate buffer, pH 6.0-8.0; 50mM glycine buffer, pH 8.0-10.0; 50mM Tris-HCl buffer, pH 8.0) as the substrate. The maximum enzyme activity of 50mM Tris-HCl buffer, pH 8.0 was taken as 100%, and the relative activity of the enzyme at different pH was calculated. The results are shown in Figure 4 As shown in the figure, the optimum pH of the enzyme is 9.0, and the enzyme activity is higher in the pH range of 8.0-10.0, and its enzyme activity is kept above 100%. Also at pH 8.0, glycine buffer is better than Tris-HCl buffer and phosphate buffer.

[0055] 4. Effects of chemical reagents on the activity of alginate lyase Aly6

[0056] At 45°C and pH 9.0, different chemical reagents with a final concentration of 1mM / 0.1% (v / v) were added to the reaction system, and then the enzyme activity was measured. The relative enzyme activity under the condition of no addition of any chemical reagents was taken as 100%, and the relative activity of the enzyme under the influence of different chemical reagents was calculated. The results are as follows Figure 5 As shown, Ca 2+ , Fe 2+ and Cu 2+ It has a promoting effect on the activity of the enzyme, K + Mg 2+ , Fe 3+ , Ba 2+ 、Ni + , Sr + NH4 + 、Al 3+ , glycine, Tween-80 and Triton-100 had little effect on enzyme activity, Mn 2+ The activity of the enzyme was partially inhibited, with the enzyme activity remaining at only 33.18%; EDTA and SDS significantly inhibited the enzyme activity, with the residual enzyme activity being less than 5%.

[0057] 5. Determination of substrate specificity of alginate lyase Aly6

[0058] At 45℃ and pH9.0, 1% sodium alginate, polymannuronic acid PolyM and polyguluronic acid PolyG (Bozhihuili Company) were used as substrates for enzyme activity determination, and the relative activity of alginate lyase Aly6 in hydrolyzing different substrates was calculated with the maximum enzyme activity as 100%. The results showed that the enzyme can degrade sodium alginate well, but has poor degradation effects on polymannuronic acid PolyM and polyguluronic acid PolyG. It is an alginate lyase with substrate preference for sodium alginate.

[0059] 6. Analysis of degradation products of alginate lyase Aly6

[0060] The alginate lyase product was analyzed by thin layer chromatography (TLC). 1 mL of pure enzyme was added to 20 mL of 50 mM Tris-HCl buffer containing 1% sodium alginate, pH 9.0, mixed and reacted overnight at 45°C. The reaction mixture was heated at 100°C for 10 min to inactivate the enzyme. After rotary evaporation and concentration, ethanol was added to make the final ethanol concentration of 70%, and then incubated at 4°C overnight. Insoluble macromolecular polysaccharides and proteins were removed by centrifugation at 6000 rpm for 5 min. After rotary evaporation, an appropriate amount of oligosaccharide powder was taken for re-dissolution. The sample volume was 5 μL, the developing solvent was n-butanol: formic acid: water (4:6:1, v / v / v), and the color developer was 10% ethanolic sulfuric acid. The results are as follows. Figure 7 As shown, the final products of sodium alginate degradation by the enzyme are mainly monosaccharides, disaccharides and trisaccharides.

[0061] It is obvious to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered as exemplary and non-restrictive in all respects.

Claims

1. An alginate lyase Aly6, characterized in that Its amino acid sequence is shown in SEQ ID NO:

2.

2. The alginate lyase Aly6 according to claim 1, characterized in that The upstream primer sequence used to amplify the nucleotide sequence of alginate lyase Aly6 is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:

4.

3. A recombinant expression vector, characterized in that: A nucleic acid fragment encoding the amino acid sequence of the alginate lyase Aly6 as claimed in claim 1 is inserted into the genetic sequence of the recombinant expression vector.

4. An engineered bacterium, characterized in that: The engineered bacteria are transformed with the recombinant expression vector as claimed in claim 3.

5. A method for using the alginate lyase Aly6 as claimed in claim 1, characterized in that: The application of the alginate lyase Aly6 in the development and utilization of brown algae resources.

6. A method for using the alginate lyase Aly6 as claimed in claim 1, characterized in that: The alginate lyase Aly6 is used in degrading sodium alginate to prepare brown algae oligosaccharides.

7. A method for preparing alginate lyase Aly6 as claimed in claim 1, characterized in that: The following steps are involved: S1. Based on the nucleotide sequence of alginate lyase Aly6, primers that can specifically bind to the Aly6 nucleotide sequence are designed and synthesized, the upstream primer Aly6F sequence is shown in SEQ ID NO: 3, and the downstream primer Aly6R sequence is shown in SEQ ID NO: 4; S2. PCR amplification was performed using the genomic DNA of the Mesonia sp. strain as a template; the PCR product was digested with restriction endonucleases HindIII and XhoI, and then ligated to a vector with the same restriction sites using a ligase, and then transferred into competent E. coli DH5α and coated on LB medium containing 50 μg / mL kanamycin sulfate for screening, thereby obtaining a recombinant expression vector containing the alginate lyase gene Aly6; S3. The recombinant expression vector was extracted from E. coli DH5α and transformed into E. coli BL21 (DE3) to obtain a recombinant strain containing alginate lyase Aly6. The recombinant strain was inoculated into 20 mL of LB medium containing 50 μg / mL kanamycin sulfate for stable subculture, and IPTG with a final concentration of 0.1 mM was added to induce expression. The cells were collected by centrifugation, resuspended in lysis buffer, and lysozyme with a final concentration of 1 mg / mL was added, and ultrasonically disrupted. The centrifuged supernatant was collected to obtain a crude enzyme solution; S4. Add the prepared crude enzyme solution to the pre-equilibrated His tag, wash 3 times with 10 mL of washing buffer, elute 4 times with elution buffer after washing, the elution volume is 5 mL, collect the eluate in batches, and perform SDS-PAGE electrophoresis on the eluate to detect the protein purity, and obtain the purified alginate lyase Aly6.

8. The method for preparing alginate lyase Aly6 according to claim 7, characterized in that: The lysis buffer is: 20 mM Tris-HCl buffer, pH 7.4; the washing buffer is: 20 mM Tris-HCl buffer, 500 mM NaCl, 2 mM imidazole, pH 7.4; the elution buffer is 20 mM Tris-HCl buffer, 500 mM NaCl, 50 mM imidazole, pH 7.4.

Images