Application of Citrus CsGRAS9 Gene in Improving Resistance to Citrus Canker

Abstract

The present invention discloses the application of the citrus CsGRAS9 gene in improving the disease resistance to citrus canker. The citrus CsGRAS9 gene can be specifically recognized by the TALE effector protein of citrus canker pathogen, and the promoter region of the citrus CsGRAS9 gene contains an EBE sequence bound by the pathogenic effector PthA4 of citrus canker pathogen. The present invention provides a method for enhancing the resistance to citrus canker by inducing the expression of the citrus CsGRAS9 gene. By inoculating the xanthomonas tal-free strain containing the dGRAS9 expression vector, the overexpression of the GRAS9 gene in citrus leaves can significantly reduce the incidence of citrus canker. The artificially synthesized TALE-like protein dGRAS9 of the present invention can bind to the CsGRAS9 gene promoter sequence other than EBE PthA4 and significantly reduce the bacterial growth of citrus canker pathogen in the inoculated area and improve the disease resistance to canker by overexpressing CsGRAS9 in grapefruit leaves. The function of CsGRAS9 in regulating the susceptibility to citrus canker is verified, which has great application value in the breeding of citrus canker

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of citrus CsGRAS9 gene in improving the disease resistance of citrus canker. Background Art

[0002] Citrus bacterial canker (CBC) caused by Xanthomonas citri subsp. citri (abbreviated as Xcc) is an important bacterial disease of citrus in China. The canker disease is transmitted by wind and rain and can infect all above-ground organs of citrus. The typical symptoms of the canker disease are that the growth of the pathogen compresses the intercellular spaces, resulting in hydration and swelling, forming oily yellow spots, which then expand into circles. The lesions on the leaves first bulge on both sides, forming corky protrusions and presenting a crater-like shape. The citrus canker pathogen can survive in the lesions of branches and leaves for a long time. The infected leaves are the main source of the disease. After the diseased leaves fall off, the canker pathogen still survives for 6 months. In spring, the canker pathogen diffuses through the exudation of the lesions on the branches. With the high temperature, abundant rainfall and frequent typhoons in summer, it spreads rapidly through pollen and leaf spots. In autumn, as the temperature drops, the occurrence of the disease slows down. After the citrus enters the fruiting stage, it infects the fruits, and in winter, it spreads from the fruits to the branches. Therefore, the discovery of disease-resistant genes is the most economical and effective strategy for controlling the canker disease.

[0003] Xanthomonas citri subsp. citri can be divided into three strains according to the host: A, AW, and A*. The A strain has a wide geographical distribution and can infect a variety of citrus economic varieties, including grapefruit (Citrus paradisi), sweet orange (C. sinensis), lemon (C. limon), and pomelo (C. grandis). Kumquat (Fortunella spp.) resists the infection of Xanthomonas citri subsp. citri through the early leaf abscission process and the development of a phenotype similar to the hypersensitive response (HR). It is crucial to cultivate disease-resistant citrus cultivars. During the infection stage, the bacteria compress the intercellular space, resulting in hydration and swelling. The transcriptional activator-like effector (TALE) of Xanthomonas citri subsp. citri belongs to the avrBs3 / pthA gene family, with a length generally of 4-6 Kb and typical structural characteristics. It consists of a conserved secretion and translocation signal at the N-terminus, a tandem repeat sequence (CRR) in the middle, a short nuclear localization signal sequence (NLS) and an activation domain (AD) at the C-terminus. TALE proteins usually have 12-33 leucine-rich tandem repeats containing 33-35 amino acids. The two ends are highly conserved, and the 12th and 13th amino acid residues of the central tandem repeat sequence are polymorphic, also known as repeat variable residues (RVDs). RVDs can specifically recognize one or several bases.

[0004] Xcc translocates TALE effector proteins into the citrus nucleus through the type III secretion system (T3SS). TALE effector proteins specifically recognize a promoter DNA fragment called the effector-binding element (EBE) according to the RVD sequence of the protein, regulating the transcriptional expression of target genes. Although multiple TAL effector proteins contain different numbers of tandem repeats, they can recognize and bind to the EBE region of the same host gene promoter due to their similar RVD sequences. The A-type Xanthomonas citri subsp. citri usually contains more than three avrBs3 / pthA genes, while the A* and AW types contain about 1-3 avrBs3 / pthA genes. The representative Xcc306 strain of the A-type Xanthomonas citri subsp. citri contains four avrBs3 / pthA family genes, named pthA1, pthA2, pthA3, and pthA4, respectively, which are involved in the formation of canker symptoms. Among them, PthA4 is the main virulence factor of Xanthomonas citri subsp. citri. After infection, the intercellular spaces of leaf cells increase, destroying the mesophyll tissue structure. The PthA4 protein activates transcription by binding to the EBE sequence of the promoter of the susceptible gene LOB1, promoting pustule formation and the development of canker disease symptoms.

[0005] The GRAS family is a plant-specific transcription factor composed of GAI (GA-INSENSITIVE), RGA (REPRESSOR OF GAI), and SCR (SCARECROW), which is involved in plant growth and development and plays a role in physiological processes (including GA and phytochrome signal transduction, abiotic and biotic stress responses, and chlorophyll biosynthesis). For example, in Arabidopsis thaliana, miR171c targets GRAS proteins to regulate various biological processes such as shoot branching and maintenance of shoot meristems. SCARECROW-LIKE (SCL) proteins have multiple effects on the growth and disease resistance of rice. After inoculation with Magnaporthe oryzae, the expression level and transcriptional activity of OsSCL7 in rice increase, leading to an increase in the expression of defense-related genes and enhancing the blast resistance of rice. hSCL13-2A enhances the resistance of cotton to Dahlia virus by regulating the jasmonic acid (JA) and salicylic acid (SA) signaling pathways and the accumulation of reactive oxygen species (ROS). MeDELLAs improve the resistance of cassava to bacterial wilt after infection with Xanthomonas axonopodis pv. manihotis (Xam). The expression of VviSHR5 in grapevine is induced by infection with Botrytis cinerea. OsGRAS8, OsGRAS39, and OsSHR1 improve the resistance of rice to bacterial blight and sheath blight. Tamarix hispida ThSCL32 coordinates the accumulation of ROS by increasing the activity of antioxidant enzymes. Although GRAS transcription factors have been partially applied in regulating plant disease resistance, there is no relevant research report on citrus canker resistance.

[0006] Based on this, the present application is specifically proposed. Summary of the Invention

[0007] The object of the present invention is to provide the application of citrus CsGRAS9 gene in improving the resistance of citrus to canker. Specifically, in the present invention, the citrus CsGRAS9 gene is the target gene of the TALE effector of citrus canker pathogen. The present invention studies the influence of the expression level of CsGRAS9 gene on the resistance of citrus to canker, which has important contribution value to the cultivation of disease-resistant citrus varieties, and proves the biological function of this gene in positively regulating the resistance of citrus to canker. Accordingly, the present invention further provides a method for improving the canker resistance of citrus.

[0008] The object of the present invention is achieved by the following technical solutions:

[0009] In a first aspect, the present application provides the use of the citrus CsGRAS9 gene in enhancing the disease resistance of citrus to citrus canker. The citrus CsGRAS9 gene can be specifically recognized by the TALE effector protein of Xanthomonas citri subsp. citri. The promoter region of the citrus CsGRAS9 gene contains an EBE sequence that binds to the pathogenic effector factor PthA4 of Xanthomonas citri subsp. citri. The nucleotide sequences of the promoter and EBE region of the citrus CsGRAS9 gene are shown in SEQ ID No.1 and SEQ ID No.3, respectively.

[0010] Among them, the EBE sequence that binds to the pathogenic effector factor PthA4 of Xanthomonas citri subsp. citri is also called the EBE PthA4 sequence, the sequence is shown in SEQ ID No.3, and the sequence length is 19bp.

[0011] The expression level of the citrus CsGRAS9 gene is detected by a primer pair. The forward primer sequence is shown in SEQ IDNo.4, and the reverse primer sequence is shown in SEQ ID No.5.

[0012] In one embodiment of the present invention, the use of the citrus CsGRAS9 gene in preparing citrus varieties resistant to citrus canker is provided.

[0013] In a second aspect, the present application provides the Fortunella hindsii FhGRAS9 gene, whose promoter region does not contain an EBE sequence that binds to the pathogenic effector factor PthA4 of Xanthomonas citri subsp. citri. The nucleotide sequence of the promoter of the Fortunella hindsii FhGRAS9 gene is shown in SEQ ID No.2.

[0014] In a third aspect, the present application provides a method for enhancing the resistance of citrus to citrus canker by increasing the transcriptional level of the GRAS9 gene in citrus. The nucleotide sequence of the citrus GRAS9 gene is shown in SEQ IDNo.6.

[0015] The nucleotide sequence of the citrus GRAS9 gene is specifically as follows:

[0016]

[0017] Furthermore, the present application provides a biological material for inducing the citrus CsGRAS9 gene.

[0018] Furthermore, the biological material includes an artificially designed dGRAS9 recombinant expression vector for inducing the citrus CsGRAS9 gene and a recombinant bacterium containing the recombinant expression vector.

[0019] Furthermore, a method for enhancing the resistance of citrus to citrus canker by the CsGRAS9 gene includes the following steps:

[0020] Step 1: Design dGRAS9 to specifically recognize the EBEdGRAS9 sequence. The EBEdGRAS9 sequence is as shown in SEQ ID No. 7, with a sequence length of 17 bp. The nucleotide sequence of the designed dGRAS9 fragment is as shown in SEQ ID No. 8, and the amino acid sequence of the designed dGRAS9 fragment is as shown in SEQ ID No. 9;

[0021] Step 2: Construct a dGRAS9 expression vector;

[0022] Step 3: Inoculate the citrus leaves with the Xanthomonas axonopodis pv. citri tal-free strain containing the dGRAS9 expression vector to overexpress the GRAS9 gene in the citrus leaves.

[0023] Among them, dGRAS9 is similar to the TALE protein, and dGRAS9 can bind to the CsGRAS9 gene promoter sequence other than EBE PthA4 to express the CsGRAS9 protein and improve the resistance of citrus to citrus canker.

[0024] Furthermore, in Step 2, the method for constructing the dGRAS9 expression vector is as follows:

[0025] Digest the dGRAS9 fragment obtained in Step 1 with SphI, recover it, link it with the pZY vector digested with the same enzyme, and transform Escherichia coli competent EH5α cells. Extract the plasmid to obtain an intermediate vector;

[0026] Digest the obtained intermediate vector with HindIII, recover it, link it with the pHM1 vector digested with the same enzyme, and transform Escherichia coli competent EH5α cells. Extract the plasmid to obtain the dGRAS9 expression vector.

[0027] Further, in step 3, the method for preparing the Xanthomonas citri tal-free strain containing the dGRAS9 expression vector is as follows: Transform the dGRAS9 expression vector into the tal-free strain of Xanthomonas citri subsp. citri, and overexpress the GRAS9 gene in the tal-free strain to obtain the tal-free strain of Xanthomonas citri subsp. citri containing the dGRAS9 expression vector. After verification by western blotting, it can be used to infect citrus leaves.

[0028] In one embodiment of the present invention, the citrus is selected as grapefruit.

[0029] Further, in step 3, after inoculation, the induced expression of the GRAS9 gene is verified by qRT-PCR, and the citrus canker resistance of citrus plants is evaluated to determine that overexpression of the citrus GRAS9 gene can enhance citrus canker resistance.

[0030] The full-length open reading frame nucleotide sequence of this gene is provided, which is 1350 bp and encodes 449 amino acids. The CsGRAS9 gene belongs to the plant-specific GRAS protein family and encodes a homologous protein of Arabidopsis AtSCL32. There is an EBE sequence in the promoter region of the CsGRAS9 gene that binds to the TALE effector protein PthA4 of Xanthomonas citri subsp. citri, and the TALE directly binds to the promoter EBE PthA4 Inhibition of CsGRAS9 gene expression in grapefruit leaves, while after inoculation of Fortunella hindsii leaves, the inhibitory effect of the TALE effector on the expression of the CsGRAS9 homologous gene FhGRAS9 is relieved.

[0031] Compared with the prior art, the present invention has the following advantages:

[0032] (1) The present invention provides the citrus GRAS9 gene, obtaining a gene that is down-regulated in susceptible varieties after being infected by Xanthomonas citri subsp. citri and up-regulated in resistant varieties after being infected by Xanthomonas citri subsp. citri from the genes with differential expression before and after citrus infection with citrus canker, and it is speculated that the GRAS9 gene is a disease-resistant gene for citrus canker.

[0033] (2) The present invention provides a method for enhancing citrus canker resistance by inducing the expression of the citrus CsGRAS9 gene. By inoculating the Xanthomonas citri tal-free strain containing the dGRAS9 expression vector, overexpression of the GRAS9 gene in citrus leaves can significantly reduce the incidence of citrus canker.

[0034] (3) The present invention provides a method for enhancing the resistance of citrus to citrus canker by inducing the expression of the citrus GRAS9 gene. The citrus GRAS9 gene can also be used as a candidate gene for the TALE effector of citrus canker pathogen. Editing the EBE region of the citrus GRAS9 gene promoter by gene editing technology provides a theoretical basis and genetic resources for citrus canker resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Identification of the GRAS9 gene related to citrus canker resistance. (A) In grapefruit leaves, the changes in the expression levels of CsGRAS9 at 24 h and 48 h after induction by tal-free citrus canker pathogen containing the effector PthA4 were analyzed by quantitative PCR (qRT-PCR). (B) In kumquat leaves, the changes in the expression levels of FhGRAS9 induced by tal-free citrus canker pathogen containing the effector PthA4 were analyzed by real-time fluorescence quantitative PCR (qRT-PCR). (C) Sequencing results of the cloned product amplified from the promoter of the kumquat FhGRAS9 gene. (D) Sequence alignment results of the GRAS9 gene promoters of resistant and susceptible varieties.

[0036] Figure 2 Analysis of the structural characteristics of the GRAS9 gene. (A) Phylogenetic tree analysis of the amino acid sequences of GRAS9 homologous genes in different plants. (B) Structural analysis of GRAS9 homologous genes in different plants.

[0037] Figure 3 Identification of the target gene of the citrus canker pathogen effector. (A) Schematic diagram of the structure of the citrus canker pathogen PthA4 effector and the promoter of the target gene citrus CsGRAS9 gene. (B) EMAS experiment to detect the interaction between the citrus canker pathogen PthA4 effector and the EBE region sequence of the target gene citrus GRAS9 gene promoter. The purified PthA4-His protein with a His tag was incubated with the cy5-labeled probe or the unlabeled (cold) probe ProCsGRAS9. The cold probe was used as a competitor, and its contents were 1, 100, 400, and 800 times (1×, 100×, 400×, and 800×) the content of the cy5-labeled probe, respectively. The symbols "+" or "-" indicate the presence or absence of protein and specific probe.

[0038] Figure 4 Construction of tal-free citrus canker pathogen expressing GRAS9. (A) Artificially synthesized dGRAS9 can specifically recognize the EBEdGRAS9 sequence. (B) Western blotting was used to verify the expression level of the dGRAS9 protein in tal-free citrus canker pathogen. (C) qRT-PCR was used to verify the expression of the GRAS9 gene induced by tal-free citrus canker pathogen.

[0039] Figure 5 For the correlation analysis of the expression level of citrus GRAS9 and the disease resistance to citrus canker. (A) Xcc003 and Xcc086 are wild-type citrus canker strains. The OD 600 of the citrus canker bacteria suspension was adjusted to 1.0. The suspensions of Xcc003+Xcc049E / EV, Xcc003+Xcc049E / dGRAS9, Xcc086+Xcc049E / EV, and Xcc086+Xcc049E / dGRAS9 were mixed at a ratio of 1:1 and inoculated onto grapefruit leaves using the injection method. The suspensions of Xcc003+Xcc049E / EV and Xcc086+Xcc049E / EV were used as positive controls to determine the severity of citrus canker. The symptoms of canker disease were observed 12 days after bacterial inoculation. (B) The OD600 of the citrus canker bacteria suspension was adjusted to 1.0. The suspensions of Xcc003+Xcc049E / EV, Xcc003+Xcc049E / dGRAS9, Xcc086+Xcc049E / EV, and Xcc086+Xcc049E / dGRAS9 were mixed at a ratio of 1:1 and inoculated onto grapefruit leaves using the needle-pricking method. The suspensions of Xcc003+Xcc049E / EV and Xcc086+Xcc049E / EV were used as positive controls to determine the severity of citrus canker. The symptoms of canker disease were observed 8 days after bacterial inoculation. (C) 1, 4, 7, and 10 days after bacterial inoculation, the growth amount of citrus canker bacteria in grapefruit leaves was measured. Detailed implementation mode

[0040] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0041] Embodiment

[0042] The present specification will be described in detail below with reference to the accompanying drawings and specific implementation methods, which are only used to explain the present invention and are not used to limit the present invention.

[0043] Unless otherwise specified, the reagents and methods used in the following embodiments are all conventional methods and can be obtained from commercial channels.

[0044] Any modifications, equivalent substitutions, improvements, etc. made without departing from the principles or scope of the present invention are all included in the scope of protection of the present invention.

[0045] The pZY and pHZY vectors, wild-type Xanthomonas citri subsp. citri Xcc003 and Xcc086, tal-free Xanthomonas citri subsp. citri Xcc049E, Xanthomonas citri subsp. citri Xcc049E / pthA4 with the pthA4 gene complemented, Xanthomonas citri subsp. citri Xcc049E / dGRAS9 expressing the GRAS9 gene, as well as the citrus canker-susceptible cultivar "grapefruit" and the citrus canker-resistant cultivar "kumquat" involved in the following examples are all preserved and provided by the research team where the applicant is located, and are known biological materials.

[0046] Example 1

[0047] (1) Analysis of the expression pattern and structure of the GRAS9 gene induced by Xanthomonas citri subsp. citri

[0048] To explore genes related to citrus canker resistance in citrus, the expression pattern of the GRAS9 gene induced by Xanthomonas citri subsp. citri was analyzed using real-time fluorescence quantitative PCR (qRT-PCR). The OD of the Xanthomonas citri subsp. citri suspension was adjusted to 1.0. Healthy leaves of several grapefruit plants with consistent size and growth were selected and inoculated onto the abaxial leaf blades using the injection method. 600 The leaves were taken 48 hours after being infected with Xanthomonas citri subsp. citri, and RNA was extracted and reverse transcribed for qRT-PCR quantitative analysis. The results are shown in Figures A - B. The expression was inhibited in the susceptible cultivar grapefruit and significantly up-regulated in the resistant cultivar kumquat (Figures A - B). A 20 μL reaction system was prepared, which included 10 μL of 2X SYBR buffer, 0.25 μL of 10 μM forward primer qCsGRAS9-F (shown in SEQ ID No. 4, ACTTTCCTGCCCAAAGAAAGTCG), 0.25 μL of 10 μM reverse primer qCsGRAS9-R (shown in SEQ ID No. 5, TCTTGTGACCGACATCGGCTTC), 1.5 μL of cDNA template, and 8 μL of double-distilled water.

[0049] The amino acid sequence and structure analysis showed that CsGRAS9 (Cs2g22130) is a homologous protein of Arabidopsis AtSCL32, belonging to the GRAS family, and there are homologous proteins in many plants with relatively high homology (Figures A - B). Figure 1 In the susceptible cultivar grapefruit, the expression was inhibited, and in the resistant cultivar kumquat, it was significantly up-regulated (Figures A - B). Figure 1 A 20 μL reaction system was prepared, which included 10 μL of 2X SYBR buffer, 0.25 μL of 10 μM forward primer qCsGRAS9-F (shown in SEQ ID No. 4,

[0050] ACTTTCCTGCCCAAAGAAAGTCG), 0.25 μL of 10 μM reverse primer qCsGRAS9-R (shown in SEQ ID No. 5, TCTTGTGACCGACATCGGCTTC), 1.5 μL of cDNA template, and 8 μL of double-distilled water.

[0051] The amino acid sequence and structure analysis showed that CsGRAS9 (Cs2g22130) is a homologous protein of Arabidopsis AtSCL32, belonging to the GRAS family, and there are homologous proteins in many plants with relatively high homology (Figures A - B). Figure 2 Figures A - B.

[0052] Example 2

[0053] (2) Bioinformatics analysis of the promoter of the citrus canker resistance-related gene GRAS9 Grapefruit DNA was extracted by the CTAB method, and the promoter fragment of the grapefruit CsGRAS9 gene was obtained by PCR amplification using the primers pGRAS9-F (SEQ ID NO.10, GTGTGTGTGTGTTCCAGTCA) and pGRAS9-R (SEQ ID NO.11, ACGTTTGGTGGCTTTAGGATG). The nucleotide sequence of the CsGRAS9 gene promoter is shown in SEQ ID No.1.

[0054] SEQ ID No.1:

[0055] TTTCCGGACTTTCCCGCACTTTAAAATCCCTGACAAAAAAACTACTCATATAT ATATATATAATTAACTTCAATTCTTGTCATAACATTTATACTTACATACAAACAGATGTATAAAATTATATATGTA TATATATGTAGATAGATAGATAGATAAATTAAAGTCCTATGATCTGAGTTATACAAAATTTTTCCATGTCTCATGC TCTGTCTGTAAATATAGTAGTATATATGTATAATTCTTAATTTTATATTTTCATGTTATAACCATGCCCGAATTAT AACCTTGTAATAATTTTGGGAAAGCTGAGAGGTGGGAAGGATTTTTTTCATACATACACATCTATGAAGATGAATC TAAGTGGCACATCTAATTCCTAAATGAACTCTAATTGAAATGGTTGCATGTGCTACCTCAACCTCATGAAGGATTG TCATCATATTGCAAATCTAGGGTTCATTTATGTATAATTTTGGCTTCATTCTATGTGGATAATTCGTTCAACAAGG ACCTTTCGCCTCTATATATATACATACACACACACACACACACACATAT ATATGGTTCAAGTAATAGATAAACTAACTCTCAACTCTCCATATGTCTCTTCCTCCACAAACAAATTCAACACATTTAAAACACAGCCAACGTCAAGATAAGTAAATAATTTCCATCTCTAAACACCTCATATTAACTTCTTAAGTTTGAGGAACTTGTATATGTAAACATCTAAAACAAGATAAAAACCCTAGGTTTTCAATCCCATCCACCAATACCAACCACACGCGTGCAAAACAGTATAACACAATCACCTTTTAATTCTCTGAATATCATTTTCTCTCATTTCTTCATCCTAAAGCCACCAAACGTTACATGCACGTTAATTAAAGACAACAATATCCTAACCTTTCATATGTCGCC. Among them, the underlined part is the deletion fragment of the FhGRAS9 promoter of Fortunella hindsii ( Figure 1 C-D).

[0056] Extract the DNA of Fortunella hindsii by the CTAB method, use primers pGRAS9-F (SEQ ID NO.10, GTGTGTGTGTGTTCCAGTCA) and pGRAS9-R (SEQ ID NO.11, ACGTTTGGTGGCTTTAGGATG) for PCR amplification to obtain the promoter fragment of the FhGRAS9 gene of Fortunella hindsii. Recover the PCR product, and ligate it to the pCE3Blunt vector (Novizan, product number C603-01) by the method of TOPO cloning to form a circular recombinant. Subsequently, transform it into the competent Escherichia coli DH5α, pick monoclonal colonies for sequencing, and obtain the nucleotide sequence of the FhGRAS9 gene promoter SEQ ID No.2 as shown below:

[0057]

[0058] Monoclonal sequencing and sequence alignment revealed that a 558-nucleotide deletion mutation occurred in the promoter of FhGRAS9 in Fortunella hindsii ( Figure 1 C-D).

[0059] Example 3

[0060] Verification of the interaction between the effector PthA4 of Xanthomonas citri subsp. citri and the promoter of CsGRAS9 by competitive electrophoretic mobility shift assay (EMSA)

[0061] Using the AnnoTALE software, it was predicted that the promoter of the CsGRAS9 gene contains a potential EBEPthA4 sequence recognized by the effector PthA4 of Xanthomonas citri subsp. citri. The EBEPthA4 sequence contains a TATA-box motif, and its sequence is shown as SEQ ID No.3, with a sequence length of 19 bp ( Figure 3 A).

[0062] SEQ ID No.3:

[0063] ACATACACACACACACACA

[0064] EMSA was used to verify the interaction between PthA4 and the predicted EBEPthA4 sequence in the promoter of CsGRAS9 as follows:

[0065] 1. Clone the pthA4 fragment into the pET-30a vector with a His tag, transform Escherichia coli competent EH5α cells, and extract the plasmid to obtain the PthA4 protein expression vector.

[0066] 2. Heat-transform the PthA4 protein expression vector into Escherichia coli expression strain BL21 competent cells to obtain the PthA4 protein prokaryotic expression BL21 strain.

[0067] 3. After inducing the cultured PthA4 protein prokaryotic expression strain with IPTG, a fusion protein His-PthA4 with a fused His tag was produced, and the fusion protein His-PthA4 was further purified using Ni-NTA HisBind resin (Novagen, USA).

[0068] 4. Design a 33-bp fragment of the promoter of the CsGRAS9 gene containing the EBEPthA4 sequence (ProCsGRAS9: 5'-TATAT ACATACACACACACACACA CACACATAT-3', the underlined part is the EBEPthA4 fragment) as a probe, which was synthesized by Shanghai Sangon Biotech Co., Ltd. and labeled with Cy5.

[0069] 5. Incubate the purified fusion protein His-PthA4 with the Cy5-labeled CsGRAS9 gene promoter fragment ProCsGRAS9 at room temperature for 20 min, then load the sample onto a 4.5% polyacrylamide gel and perform electrophoresis separation at low temperature. Set the voltage to 100 - 110 V and the gel running time to 1 - 1.5 h.

[0070] 6. After electrophoresis, use an RGB laser imager to scan and image the results in the Cy5 detection mode.

[0071] As Figure 3 shown in

[0072] Example 4

[0073] Disease resistance of plants after overexpression of GRAS9 in grapefruit

[0074] To analyze the potential effect of CsGRAS9 on resistance to citrus canker, a synthetic TALE-like protein dGRAS9 was used to bind to the CsGRAS9 gene promoter sequence to regulate the expression of the CsGRAS9 gene, as follows:

[0075] 1. A segment of the CsGRAS9 promoter near ATG was selected as the target EBE dGRAS9 in the present invention. The target sequence is 17 bp in length, as shown in SEQ ID No.7 ( Figure 4 A).

[0076] SEQ ID No.7:

[0077] AACTTCTTAAGTTTGAG

[0078] According to the way that TALE proteins bind to induce gene expression, a synthetic dGRAS9 fragment similar to the TALE effector was designed, and its nucleotide sequence is as shown in SEQ ID No.8.

[0079] The fragment of the synthetic TALE-like protein dGRAS9 has an amino acid sequence as shown in SEQ ID No.9.

[0080] SEQ ID No.8:

[0081] GCATGCATGGCGCAATGCACTGACGGGTGCCCCCCTGAAC CTGACCCCAGCGCAAGTTGTAGCGATTG CTAGTAATATTGGTGGCAAACAGGCACTTGAGACGGTTCAGCGCCTCCTTCCAGTTCTTTGTCAAGCTCACGGACT CACCCCAGATCAAGTTGTAGCGATTGCTAGTAATATTGGTGGCAAACAGGCACTTGAGACGGTTCAGCGCCTCCTT CCAGTTCTTTGTCAAGCTCACGGACTCACCCCAGATCAAGTTGTAGCGATTGCTAGTCATGACGGTGGCAAACAGG CTCTTGAGACCGTCCAACGCCTTCTACCAGTTCTCTGTCAAGCCCACGGACTAACCCCAGCGCAAGTTGTAGCGAT TGCTAGTAATGGGGGTGGCAAACAGGCTCTTGAAACCGTGCAACGACTGCTCCCAGTTCTCTGTCAAGCCCACGGC CTCACCCCGGCGCAAGTTGTAGCGATTGCTAGTAATGGGGGTGGCAAACAGGCTCTTGAAACCGTGCAACGACTGC TCCCAGTTCTCTGTCAAGCCCACGGCCTCACCCCGGCGCAAGTTGTAGCGATTGCTAGTCATGACGGTGGCAAACA GGCTCTTGAGACCGTCCAACGCCTTCTACCAGTTCTCTGTCAAGCCCACGGACTAACTCCTGATCAAGTTGTAGCGATTGCTAGTAATGGGGGTGGCAAACAGGCTCTTGAAACCGTGCAACGACTGCTCCCAGTTCTCTGTCAAGCCCACG GCCTCACCCCGGCGCAAGTTGTAGCGATTGCTAGTAATGGGGGTGGCAAACAGGCTCTTGAAACCGTGCAACGACT GCTCCCAGTTCTCTGTCAAGCTCACGGACTCACCCCAGATCAAGTTGTAGCGATTGCTAGTAATATTGGTGGCAAA CAGGCACTTGAGACGGTTCAGCGCCTCCTTCCAGTTCTTTGTCAAGCTCACGGACTCACCCCAGATCAAGTTGTAG CGATTGCTAGTAATATTGGTGGCAAACAGGCACTTGAGACGGTTCAGCGCCTCCTTCCAGTTCTTTGTCAAGCTCA CGGACTCACCCCAGATCAAGTTGTAGCGATTGCTAGTAACAATGGTGGCAAACAGGCTCTCGAAACCGTACAACGA CTCCTCCCAGTTCTCTGTCAAGCCCACGGACTAACTCCTGATCAAGTTGTAGCGATTGCTAGTAATGGGGGTGGCA AACAGGCTCTTGAAACCGTGCAACGACTGCTTCCAGTTCTCTGTCAAGCCCACGGACTAACTCCTGATCAAGTTGT AGCGATTGCTAGTAATGGGGGTGGCAAACAGGCTCTTGAAACCGTGCAACGACTGCTCCCAGTTCTCTGTCAAGCC CACGGCCTCACCCCGGCGCAAGTTGTAGCGATTGCTAGTAATGGGGGTGGCAAACAGGCTCTTGAAACCGTGCAGC GACTCCTCCCAGTTCTCTGTCAAGCCCACGGACTAACTCCTGATCAAGTTGTAGCGATTGCTAGTAACAATGGTGG CAAACAGGCTCTCGAAACCGTACAACGACTCCTCCCAGTTCTCTGTCAAGCCCACGGACTAACTCCTGATCAAGTT GTAGCGATTGCTAGTAATATTGGTGGCAAACAGGCACTTGAGACGGTTCAGCGCCTCCTTCCAGTTCTTTGTCAAG CTCACGGACTCACCCCAGATCAAGTTGTAGCGATTGCTAGTAACAAT GGCGGCAAGCAGGCGCTGGAGAGCATTGTTGCCCAGTTATCTCGCCCTGATCCGGCGTTGGCCGCGTTGACCAACGACCACCTCGTCGCCTTGGCCTGCCTCGGCGGACGTCCTGCCCTGGATGCAGTGAAAAAGGGATTGCCGCACGCACCGGAATTGATCAGAAGAATCAATCGCCGTATTCCCGAACGCACGTCCCATCGCGTTGCCGACCTCGCGCACGTGGTGCGCGTGCTTGGTTTTTTCCAGAGCCACTCCCACCCAGCGCAAGCATTCGATGACGCCATGACGCAGTTCGGGATGAGCAGGCACGGGTTGGCACAGCTCTTTCGCAGAGTGGGCGTCACCGAACTCGAAGCCCGCTACGGAACGCTCCCCCCAGCCTCGCAGCGTTGGGACCGTATCCTCCAGGCATCAGGGATGAAAAGGGCCAAACCGTCCCCTACTTCAGCTCAAACGCCGGATCAGGCGTCTTTGCATGC, where the underlined part is the central repeat region sequence of dGRAS9, and the italic part is the SphI restriction site.

[0082] SEQ ID No.9:

[0083] RRPVHAWRNALTGAPLN

[0084] LTPAQVVAIAS NI GGKQALETVQRLLPVLCQAHG

[0085] LTPDQVVAIAS NI GGKQALETVQRLLPVLCQAHG

[0086] LTPDQVVAIAS HD GGKQALETVQRLLPVLCQAHG

[0087] LTPAQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0088] LTPAQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0089] LTPAQVVAIAS HD GGKQALETVQRLLPVLCQAHG

[0090] LTPDQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0091] LTPAQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0092] LTPDQVVAIAS NI GGKQALETVQRLLPVLCQAHG

[0093] LTPDQVVAIAS NI GGKQALETVQRLLPVLCQAHG

[0094] LTPDQVVAIAS NN GGKQALETVQRLLPVLCQAHG

[0095] LTPDQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0096] LTPDQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0097] LTPAQVVAIAS NG GGKQALETVQRLLPVLCQAHG

[0098] LTPDQVVAIAS NN GGKQALETVQRLLPVLCQAHG

[0099] LTPDQVVAIAS NI GGKQALETVQRLLPVLCQAHG

[0100] LTPDQVVAIAS NNGGKQALESIVAQLSRPDPAWPRDHDSR, where the underlined part is the RVD sequence of the dGRAS9 protein.

[0101] 2. Construction of the dGRAS9 expression vector. The synthetic dGRAS9 fragment was digested with SphI, and after recovery, it was ligated to the pZY vector digested with the same enzyme and transformed into competent E. coli EH5α cells. The plasmid was extracted to obtain the intermediate vector.

[0102] Furthermore, the obtained intermediate vector was digested with HindIII, and after recovery, it was ligated to the pHM1 vector digested with the same enzyme and transformed into competent E. coli EH5α cells. The plasmid was extracted to obtain the dGRAS9 expression vector.

[0103] 3. Construction of the CsGRAS9-expressing Xanthomonas citri subsp. citri strain

[0104] By electroporation, the dGRAS9 expression vector was transformed into the tal-free Xanthomonas citri subsp. citri Xcc049E to prepare the Xanthomonas citri subsp. citri containing the dGRAS9 expression vector.

[0105] The expression level of the TALE-like protein dGRAS9 in Xanthomonas citri subsp. citri Xcc049E was detected by Western blotting. As Figure 4 shown in B, the dGRAS9 protein could be normally expressed in Xanthomonas citri subsp. citri Xcc049E. The clones expressing the dGRAS9 protein were preserved for subsequent experiments.

[0106] 4. Detection of CsGRAS9 overexpression

[0107] Pick Xanthomonas citri subsp. citri and inoculate it into liquid NA medium (containing ampicillin and spectinomycin), and culture it at 28 °C and 200 r·min -1 until OD 600 = 2.0. Collect the bacterial cells, resuspend them with sterilized ultrapure water, and adjust OD600 = 1.0.

[0108] Use the injection inoculation method to inoculate Xanthomonas citri subsp. citri into grapefruit leaves. Use Xanthomonas citri subsp. citri Xcc049E / EV containing the empty vector as the negative control, and use the wild-type Xanthomonas citri subsp. citri Xcc003 and Xcc086 as the positive controls. Determine the change in the expression level of the CsGRAS9 gene after inoculating Xanthomonas citri subsp. citri Xcc049E / dGRAS9 containing the dGRAS9 expression vector. The primers used are:

[0109] Forward primer qCsGRAS9-F (ACTTTCCTGCCCAAAGAAAGTCG);

[0110] Reverse primer qCsGRAS9-R (TCTTGTGACCGACATCGGCTTC).

[0111] qRT-PCR results showed that inoculation with Xanthomonas citri subsp. citri Xcc049E / dGRAS9 induced the expression of the CsGRAS9 gene ( Figure 4 C).

[0112] 5. Infection of Xanthomonas citri subsp. citri

[0113] The resistance of CsGRAS9-overexpressing leaves to citrus canker was evaluated by in vitro injection and acupuncture methods. The specific operations were as follows:

[0114] Xcc003 and Xcc086 are wild-type strains of Xanthomonas citri subsp. citri. Pick Xanthomonas citri subsp. citri and transfer it to liquid NA culture medium (containing ampicillin and spectinomycin). Incubate at 28 °C and 200 r·min -1 Cultivate until OD 600 = 2.0, collect the bacterial cells, resuspend them with sterilized ultrapure water, and adjust OD600 = 1.0. Mix the suspensions of Xcc003+Xcc049E / EV, Xcc003+Xcc049E / dGRAS9, Xcc086+Xcc049E / EV, and Xcc086+Xcc049E / dGRAS9 at a ratio of 1:1. Among them, the suspensions of Xcc003+Xcc049E / EV and Xcc086+Xcc049E / EV mixed were used as positive controls to determine the severity of citrus canker.

[0115] After inoculating Xanthomonas citri subsp. citri into grapefruit leaves by the in vitro injection method, incubate them in a constant temperature light incubator at 28 °C (16 h light / 8 h dark). Observe the symptoms of citrus canker 12 days after inoculation.

[0116] As Figure 5 shown in A, 12 days after inoculating Xanthomonas citri subsp. citri, the symptoms of citrus canker in the CsGRAS9-overexpressing leaf area were significantly alleviated.

[0117] After inoculating Xanthomonas citri subsp. citri into grapefruit leaves by the in vitro acupuncture method, incubate them in a constant temperature light incubator at 28 °C (16 h light / 8 h dark). Observe the symptoms of citrus canker 8 days after inoculation.

[0118] As Figure 5 shown in B, 8 days after inoculating Xanthomonas citri subsp. citri, the symptoms of citrus canker in the CsGRAS9-overexpressing leaf area were significantly alleviated.

[0119] After inoculating Xanthomonas citri subsp. citri into grapefruit leaves by the in vitro injection method, incubate them in a constant temperature light incubator at 28 °C (16 h light / 8 h dark). Analyze the bacterial growth at 1, 4, 7, and 10 days after inoculation.

[0120] As Figure 5 shown in C, the analysis of bacterial growth showed that overexpression of CsGRAS9 had a lower bacterial density compared with the control group.

[0121] This indicates that overexpression of CsGRAS9 reduces the growth of Xanthomonas citri subsp. citri in grapefruit leaves, thereby enhancing the disease resistance of grapefruit to citrus canker.

[0122] The above description of the embodiments is to enable those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments, and all improvements and modifications made by those skilled in the art without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. Application of citrus CsGRAS9 gene in improving resistance to citrus canker, characterized in that: The citrus CsGRAS9 gene can be specifically recognized by the TALE effector protein of citrus canker fungus. The promoter region of the citrus CsGRAS9 gene contains an EBE sequence to which the pathogenic effector factor PthA4 of citrus canker fungus binds. The nucleotide sequence of the citrus CsGRAS9 gene is shown in SEQ ID No.

6.

2. The use of the citrus CsGRAS9 gene in improving the resistance to citrus canker according to claim 1, characterized in that: The nucleotide sequences of the promoter and EBE region of the citrus CsGRAS9 gene are shown in SEQ ID No. 1 and SEQ ID No. 3, respectively.

3. The use of the citrus CsGRAS9 gene in improving the resistance to citrus canker according to claim 1, characterized in that: The expression level of the citrus CsGRAS9 gene is detected by a primer pair, the forward primer sequence is shown in SEQ ID No.4, and the reverse primer sequence is shown in SEQ ID No.

5.

4. Application of the citrus CsGRAS9 gene in the preparation of citrus varieties resistant to citrus canker, characterized in that: The citrus CsGRAS9 gene can be specifically recognized by the TALE effector protein of citrus canker fungus. The promoter region of the citrus CsGRAS9 gene contains an EBE sequence to which the pathogenic effector factor PthA4 of citrus canker fungus binds. The nucleotide sequence of the citrus CsGRAS9 gene is shown in SEQ ID No.

6.

5. A method for enhancing resistance to citrus canker using the citrus CsGRAS9 gene, characterized in that: Improving the transcription level of CsGRAS9 gene in citrus, wherein the nucleotide sequence of the citrus CsGRAS9 gene is shown in SEQ ID No.6; A method for enhancing resistance to citrus canker disease by using the citrus CsGRAS9 gene comprises the following steps: Step 1: Designing dGRAS9 to specifically recognize the EBEdGRAS9 sequence, the EBEdGRAS9 sequence is shown in SEQ ID No. 7, and the nucleotide sequence of the designed dGRAS9 fragment is shown in SEQ ID No. 8; Step 2: construct dGRAS9 expression vector; Step 3: Inoculate citrus leaves with the Xanthomonas tal-free strain containing the dGRAS9 expression vector to overexpress the CsGRAS9 gene in the citrus leaves.

6. The method for enhancing resistance to citrus canker using the citrus CsGRAS9 gene according to claim 5, characterized in that: In step 2, the dGRAS9 expression vector is constructed as follows: The dGRAS9 fragment obtained in step 1 was digested with SphI, recovered, linked with the pZY vector digested with the same enzyme, and transformed into the competent E. coli EH5α cells, and the plasmid was extracted to obtain the transition vector; the obtained transition vector was digested with HindIII, recovered, linked with the pHM1 vector digested with the same enzyme, and transformed into the competent E. coli EH5α cells, and the plasmid was extracted to obtain the dGRAS9 expression vector.

7. The method for enhancing resistance to citrus canker using the citrus CsGRAS9 gene according to claim 5, characterized in that: In step 3, the method for preparing the tal-free strain of Xanthomonas containing the dGRAS9 expression vector is: transforming the dGRAS9 expression vector into the tal-free Xanthomonas citri ulcerans to obtain the tal-free Xanthomonas citri ulcerans containing the dGRAS9 expression vector.

8. The method for enhancing resistance to citrus canker using the citrus CsGRAS9 gene according to claim 5, characterized in that: In step 3, the dGRAS9 expression vector is transformed into tal-free X. citri ulcerans Xcc049E by electroporation to prepare X. citri ulcerans containing the dGRAS9 expression vector. Western blotting was used to detect the expression level of TALE-like protein dGRAS9 in citrus canker pathogen Xcc049E. The dGRAS9 protein can be normally expressed in citrus canker pathogen Xcc049E. The citrus canker bacteria containing the dGRAS9 expression vector were inoculated into citrus leaves using the injection inoculation method.

9. The method for enhancing resistance to citrus canker using the citrus CsGRAS9 gene according to claim 5, characterized in that: In step 3, the citrus fruit is selected as grapefruit.

10. The method for enhancing resistance to citrus canker using the citrus CsGRAS9 gene according to claim 5, characterized in that: In step 3, the induced expression of the CsGRAS9 gene was verified by qRT-PCR after inoculation, and the resistance of citrus plants to citrus canker was evaluated to determine that overexpression of the citrus CsGRAS9 gene could enhance resistance to citrus canker.

Images