A marker for auxiliary diagnosis of gastric cancer and its application

Abstract

The present invention provides a marker for auxiliary diagnosis of gastric cancer and its application, belonging to the technical field of tumor treatment. The marker provided by the present invention is the long non-coding RNA (lncRNA) RP11-153K16.2 gene in human peripheral blood exosomes. By detecting its expression level in the peripheral blood of gastric cancer patients by qRT-PCR technology, early and non-invasive diagnosis of gastric cancer can be achieved. The present invention also provides a plasmid gene preparation capable of expressing the lncRNA, which is used to inhibit the proliferation and invasion of gastric cancer cells. Through the application of this gene preparation, it is expected to develop new gastric cancer treatment strategies and improve the survival rate and quality of life of patients.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor treatment, and in particular relates to a marker for auxiliary diagnosis of gastric cancer and its application. Background Art

[0002] Gastric cancer (GC) is one of the most common malignant tumors with a high mortality rate worldwide. Although treatments such as surgery, chemotherapy, and radiotherapy have made some progress in the past few decades, most patients are already in the late stage of gastric cancer due to the lack of obvious early symptoms, resulting in a poor overall prognosis. Therefore, there is an urgent need to develop efficient and early diagnostic methods and new treatment strategies.

[0003] Exosomes are nano-sized vesicles with a diameter of 30-150 nanometers secreted by a variety of cells and present in a variety of body fluids, including blood, saliva, urine and milk. Exosomes not only play an important role in intercellular communication, but also carry a large number of bioactive molecules, such as proteins, lipids, mRNA, miRNA and lncRNA (long non-coding RNA), which are of great significance in pathological and physiological processes.

[0004] In recent years, more and more studies have shown that lncRNA in exosomes plays a key role in the occurrence and development of tumors. In particular, lncRNA in exosomes has shown great potential as a gene marker in the early diagnosis and prognosis evaluation of gastric cancer. Therefore, providing a gastric cancer diagnostic kit based on lncRNA in peripheral blood exosomes as a gene marker can not only improve the early detection rate of gastric cancer, but also help doctors develop more accurate treatment plans and improve patients' survival rate and quality of life. Summary of the invention

[0005] The purpose of the present invention is to provide a marker for auxiliary diagnosis of gastric cancer and its application, so as to improve the survival rate and quality of life of gastric cancer patients.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] First, the present invention provides a marker for auxiliary diagnosis of gastric cancer, characterized in that the marker is the lncRNA RP11-153K16.2 gene in human peripheral blood exosomes. The marker can be used to detect exosomes in the peripheral blood of gastric cancer patients, thereby achieving early and non-invasive diagnosis of gastric cancer.

[0008] Preferably, the transcript sequence of the lncRNA RP11-153K16.2 gene is shown in SEQ ID NO.1.

[0009] Secondly, the present invention provides the use of primers for detecting the expression level of lncRNA RP11-153K16.2 gene in the preparation of a qRT-PCR kit for auxiliary diagnosis of gastric cancer, wherein the qRT-PCR kit identifies gastric cancer patients by detecting the relative expression level of lncRNA RP11-153K16.2 in peripheral blood exosomes. The kit comprises specific primers, and the relative expression level of lncRNA RP11-153K16.2 in peripheral blood exosomes is detected by qRT-PCR technology, thereby identifying gastric cancer patients.

[0010] Preferably, the transcript sequence of the lncRNA RP11-153K16.2 is shown in SEQ ID NO.1.

[0011] Preferably, the sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0012] Secondly, the present invention provides a method for screening gastric cancer therapeutic drugs, the method comprising the following steps:

[0013] (1) Inoculate gastric cancer cells into a culture dish and use them as a screening model after the cells are completely attached to the wall;

[0014] (2) Add the candidate drug to the screening model and treat for 12-48 hours;

[0015] (3) qRT-PCR was used to detect the changes in the expression level of lncRNA RP11-153K16.2 in gastric cancer cells before and after drug treatment;

[0016] (4) Based on the changes in the expression level of lncRNA RP11-153K16.2, drugs that can significantly promote the expression of lncRNA RP11-153K16.2 can be screened out and used as therapeutic drugs for gastric cancer.

[0017] Secondly, the present invention provides an application of a gene preparation in the preparation of a drug for inhibiting gastric cancer, wherein the gene preparation is a plasmid capable of expressing lncRNA RP11-153K16.2, and the transcript sequence of the lncRNA RP11-153K16.2 is shown in SEQ ID NO.1.

[0018] Preferably, the drug achieves the effect of inhibiting gastric cancer by inhibiting the proliferation ability and the invasion ability of gastric cancer cells.

[0019] Secondly, the present invention provides an application of a gene preparation in the preparation of a drug for inhibiting the proliferation and invasion of gastric cancer cells, wherein the gene preparation is a plasmid capable of expressing lncRNA RP11-153K16.2, and the transcript sequence of the lncRNA RP11-153K16.2 is shown in SEQ ID NO.1.

[0020] Preferably, the gastric cancer cell is BGC-823.

[0021] The beneficial effects of the present invention are:

[0022] 1. The present invention is based on lncRNA RP11-153K16.2 in peripheral blood exosomes as a gene marker, and by detecting its relative expression level, the early detection rate of gastric cancer can be significantly improved. The experimental results showed that the expression of lncRNA RP11-153K16.2 in peripheral blood exosomes of gastric cancer patients was significantly reduced, and the difference was statistically significant (P<0.05). Therefore, lncRNA RP11-153K16.2 has important application potential in the early diagnosis of gastric cancer.

[0023] 2. Through ROC curve analysis, the area under the curve (AUC) of lncRNA RP11-153K16.2 as a gastric cancer diagnostic marker reached 0.926, with a sensitivity of 1, a specificity of 0.8, and an accuracy of 0.9. This shows that the detection method of the present invention has a very high discriminative ability in gastric cancer diagnosis and can accurately identify gastric cancer patients and healthy individuals.

[0024] 3. The detection method of the present invention collects peripheral blood samples for exosome extraction and lncRNA analysis, avoiding the invasive operation of traditional gastric cancer detection methods. The method is simple and easy to use, with high patient acceptance, and is suitable for wide application in clinical screening and early diagnosis.

[0025] 4. The present invention also found that overexpression of lncRNA RP11-153K16.2 can significantly inhibit the proliferation and invasion of gastric cancer cells. Specific experimental results show that overexpression of lncRNA RP11-153K16.2 can significantly reduce cell proliferation rate and invasion ability in gastric cancer cell lines MKN-45, SGC-7901 and BGC-823. Therefore, lncRNA RP11-153K16.2 is expected to be a new target for gastric cancer treatment. Increasing its expression in gastric cancer cells through gene therapy or drug delivery system may effectively control tumor progression. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The morphology of exosomes extracted from peripheral blood samples of the control group and gastric cancer group is shown;

[0027] Figure 2 The relative expression levels of lncRNA RP11-153K16.2 in gastric cancer group and normal control group were shown (5 groups of samples);

[0028] Figure 3 The relative expression levels of lncRNA RP11-153K16.2 in gastric cancer group and normal control group were shown (20 groups of samples);

[0029] Figure 4 The analysis results of lncRNA RP11-153K16.2 as a diagnostic marker for gastric cancer were presented by ROC curve;

[0030] Figure 5 The expression levels of lncRNA RP11-153K16.2 after transfection of pcDNA3.1-lncRNA plasmid in gastric cancer cell lines MKN-45, SGC-7901, and BGC-823 are shown;

[0031] Figure 6 The effect of overexpression of lncRNA RP11-153K16.2 on the proliferation ability of gastric cancer cells was demonstrated;

[0032] Figure 7 The effect of overexpression of lncRNA RP11-153K16.2 on the invasion ability of gastric cancer cells was demonstrated. DETAILED DESCRIPTION

[0033] In order to deeply understand the technical features, objectives and potential positive impacts of the present invention, we will elaborate on the technical solutions of the present invention through a series of specific implementation cases. Please note that these cases are only used to illustrate the present invention and do not mean that they define all possible application scopes of the present invention.

[0034] In the examples, the original reagents and materials we used are all easily available through commercial channels. For those cases where the experimental conditions are not specifically specified, the experimental methods and conditions we adopted are the standard methods and conditions recognized in the field. In addition, if necessary, we also follow the conditions recommended by the instrument manufacturer for the experiment.

[0035] Example 1 Extraction of exosomes required for the experiment

[0036] 1) Five peripheral blood samples were collected from gastric cancer patients diagnosed with gastric cancer by pathological examination (gastric cancer group) and healthy controls (control group) in EDTA anticoagulation tubes, and the samples were centrifuged at 3000 g for 10 min at 4°C to remove cells and cell debris, and the supernatant was collected;

[0037] 2) Transfer the supernatant to a new centrifuge tube, centrifuge the supernatant at 10,000 g for 30 minutes at 4°C, and collect the supernatant;

[0038] 3) Transfer the supernatant to an ultracentrifuge tube and centrifuge at 100,000 g for 70 min at 4°C to collect the precipitate;

[0039] 4) The collected exosome precipitate was resuspended in PBS and centrifuged again at 100,000 g for 70 minutes to remove residual impurities and collect the precipitate to obtain exosomes.

[0040] 5) Take a portion of the obtained exosomes and resuspend them in an appropriate amount of PBS, drop the exosome samples on a copper grid, and observe the morphology of the exosomes using a transmission electron microscope after drying.

[0041] from Figure 1 It can be seen from the results that obvious exosome morphology was observed in both the control group and the gastric cancer group, indicating that the exosome extraction of the present invention was successful.

[0042] Example 2 The expression of lncRNA RP11-153K16.2 in peripheral blood exosomes of gastric cancer patients is significantly reduced

[0043] 1) Extract RNA from the obtained exosomes according to the method described in the Invitrogen Total Exosome RNA & Protein Isolation Kit instructions;

[0044] 2) After testing the RNA quality and concentration, take 1 μg of total RNA, add 4 μL 5X SuperScript IV VILOMaster Mix, 1 μL SuperScript IV Enzyme Mix, and add RNase-free water to a total reaction volume of 20 μL;

[0045] 3) Gently mix the reaction mixture and perform reverse transcription reaction under the following conditions: 25°C, 10 minutes; 50°C, 10 minutes; 85°C, 5 minutes to obtain cDNA;

[0046] 4) Prepare the following qPCR reaction mixture in a 96-well PCR plate: 10 μL 2×SYBR Green qPCR MasterMix, 0.8 μL forward primer (10 μM), 0.8 μL reverse primer (10 μM), 1 μL cDNA, 7.4 μL RNase-free water;

[0047] The transcript sequence of lncRNA RP11-153K16.2 is shown in SEQ ID NO.1, and the primer sequences designed according to SEQ ID NO.1 are as follows:

[0048] Upstream primer: CGATGTGGAACTGCTGGAGT, SEQ ID NO. 2;

[0049] Downstream primer: TCCCAGCTACTCAAGAGGCT, SEQ ID NO. 3;

[0050] 5) The following cycling conditions were set on an Applied Biosystems 7500Fast Real-Time PCR System: 95°C for 2 min; 95°C for 15 sec, 60°C for 1 min, for a total of 40 cycles;

[0051] 6) The relative expression of the target gene was calculated using the 2^(-ΔΔCt) method, ΔCt = target gene Ct value - reference gene Ct value (GAPDH), ΔΔCt = experimental group ΔCt - control group ΔCt.

[0052] from Figure 2 The results shown show that the relative expression level of lncRNA RP11-153K16.2 in peripheral blood exosomes of gastric cancer patients was significantly lower than that of the normal control group (relative expression 0.308±0.076). Specific analysis showed that the difference between the gastric cancer group and the normal control group was statistically significant (P<0.05). This finding suggests that the expression of lncRNA RP11-153K16.2 in gastric cancer patients is significantly lower than that in healthy people, and therefore, it may have important diagnostic potential.

[0053] Example 2

[0054] In order to further verify whether lncRNA RP11-153K16.2 can be used as an auxiliary diagnostic marker for gastric cancer patients, the present invention expanded the sample size for differential detection and performed ROC analysis.

[0055] 1) Peripheral blood samples were collected from 20 patients with pathological diagnosis of gastric cancer and 20 healthy controls with healthy physical examination results. There was no statistical difference in gender and age between the two groups.

[0056] 2) The exosome extraction, RNA extraction, reverse transcription, and qPCR processes were the same as in Example 1;

[0057] 3) The relative expression level of lncRNA RP11-153K16.2 was calculated using the 2^(-ΔΔCt) method.

[0058] According to the results shown in Table 2, the relative expression of lncRNA RP11-153K16.2 in the gastric cancer group was 0.384±0.162, which is consistent with the results obtained in Example 1, further verifying that lncRNA RP11-153K16.2 has significant expression differences in peripheral blood exosomes between healthy individuals and gastric cancer patients. Specifically, the expression of lncRNA RP11-153K16.2 in peripheral blood exosomes of gastric cancer patients was significantly decreased, and this finding supports the possibility of this lncRNA as a potential biomarker for gastric cancer.

[0059] Further analysis Figure 3 The ROC curve shown in the figure gives the following key indicators:

[0060] The area under the curve (AUC) was 0.926, the confidence interval (CI) was 0.847-1.000, the cut-off value was 0.645, the sensitivity was 1, the specificity was 0.8, and the accuracy was 0.9.

[0061] The AUC value was 0.926, which is close to 1, indicating that the diagnostic test has a very high discriminatory ability. In addition, the sensitivity was 1, the specificity was 0.8, and the accuracy was 0.9, further emphasizing the excellent performance of the test. The high sensitivity means that the test can accurately detect all gastric cancer cases, while the high specificity indicates that the test is also highly accurate in identifying non-gastric cancer cases.

[0062] In summary, by detecting the expression of lncRNA RP11-153K16.2 in peripheral blood exosomes, it can play an important auxiliary diagnostic value in the early detection and diagnosis of gastric cancer. This method not only provides a non-invasive, simple and efficient detection method, but also can significantly improve the early detection rate of gastric cancer, help doctors develop more accurate treatment plans, and thus improve the prognosis of patients.

[0063] Example 3

[0064] Construction of overexpression plasmid of lncRNA RP11-153K16.2 and detection of expression level

[0065] 1) The present invention selects pcDNA3.1 for plasmid construction, and selects XbaI and EcoRI as restriction sites. The primer sequences of the full-length amplification plasmid pcDNA3.1-lncRNA RP11-153K16.2 (hereinafter referred to as pcDNA3.1-lncRNA) designed according to SEQ ID NO.1 are as follows:

[0066] Upstream primer: TCTAGACCCGCCATGATCGTGAGGCC, SEQ ID NO.4;

[0067] Downstream primer: GAATTC TAACCATTAAAATTTTTTAT, SEQ ID NO. 5;

[0068] 2) Gastric cancer cell lines MKN-45, SGC-7901, and BGC-823 were selected for the experiment, and the pcDNA3.1 plasmid and pcDNA3.1-lncRNA plasmid were transfected into the above three cells using transfection reagents respectively;

[0069] 3) 48 hours after plasmid transfection, the culture medium was removed, the cells were washed with PBS, RNA was extracted using Trizol reagent, and reverse transcribed into cDNA;

[0070] 4) After PCR amplification using the primers in Example 2, electrophoresis was performed using 1% agarose gel. After completion, a gel imaging instrument was used to take photos.

[0071] from Figure 4 It can be seen that after transfection of pcDNA3.1-lncRNA plasmid, the expression levels of lncRNA RP11-153K16.2 in MKN-45 cells, SGC-7901 cells and BGC-823 cells were significantly increased. This result shows that the plasmid constructed by the present invention can effectively promote the expression of lncRNA RP11-153K16.2 in gastric cancer cells.

[0072] Specifically, the expression enhancement effect of lncRNA RP11-153K16.2 in BGC-823 cells was the most significant. Therefore, in the subsequent functional detection experiments, the present invention selected BGC-823 cells as the experimental model.

[0073] Example 4

[0074] Overexpression of lncRNA RP11-153K16.2 can effectively reduce the proliferation ability of gastric cancer cells

[0075] 1) BGC-823 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin and maintained in an incubator at 37° C. and 5% CO 2 ;

[0076] 2) When the cells reached about 70-80% confluence, trypsin was used to digest the cells, the cells were collected by centrifugation and resuspended in an appropriate amount of culture medium, and the cell concentration was adjusted to 5×10 4 cells / ml;

[0077] 3) 100 μl of cell suspension was added to a 96-well plate. After culturing for 24 hours, pcDNA3.1 plasmid and pcDNA3.1-lncRNA plasmid were transfected respectively, and the 96-well plate was placed in a cell culture incubator at 37°C and 5% CO2 for further culturing;

[0078] 4) After 48 hours of culture, add 10 μl of CCK-8 detection solution to each experimental well, shake gently to mix, and then continue to incubate the 96-well plate in a cell culture incubator for 3.5 hours;

[0079] 5) After the incubation, the cell culture plate was taken out of the incubator, and the absorbance value (OD value) of each well was detected at a wavelength of 450 nm using an ELISA reader. The absorbance value of each well was recorded, and the average value and standard deviation of each replicate well were calculated.

[0080] from Figure 5 It can be seen that the absorbance of the control group cells transfected with pcDNA3.1 plasmid was 0.875±0.055, while the absorbance of the experimental group cells transfected with pcDNA3.1-lncRNA plasmid was 0.472±0.071. This data shows that increasing the expression of lncRNA RP11-153K16.2 significantly inhibited the proliferation of gastric cancer cells.

[0081] Therefore, based on the above findings, lncRNA RP11-153K16.2 can be further developed as a new target for gastric cancer treatment. Increasing the expression of lncRNA RP11-153K16.2 in gastric cancer cells through gene therapy or drug delivery system is expected to effectively control tumor progression.

[0082] Example 5

[0083] Overexpression of lncRNA RP11-153K16.2 can effectively reduce the invasive ability of gastric cancer cells

[0084] 1) BGC-823 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin and maintained in an incubator at 37° C. and 5% CO 2 ;

[0085] 2) When the cells reached about 70-80% confluence, trypsin was used to digest the cells, the cells were collected by centrifugation and resuspended in an appropriate amount of culture medium, and the cell concentration was adjusted to 5×10 4 cells / ml;

[0086] 3) 2 ml of the cell suspension was inoculated into a 6-well culture plate. After culturing for 24 h, the pcDNA3.1 plasmid and pcDNA3.1-lncRNA plasmid were transfected respectively, and the 6-well plate was placed in a cell culture incubator at 37°C and 5% CO2 for further culturing;

[0087] 4) After 48 hours of culture, cells were digested with trypsin, collected by centrifugation and resuspended in an appropriate amount of serum-free medium to adjust the cell concentration to 1×10 6 cells / ml;

[0088] 5) Add 60 μl of diluted Matrigel to the prepared Transwell chamber, add 200 μl of cell suspension after solidification, and add 600 μl of RPMI-1640 medium containing 10% FBS to the lower chamber of the Transwell chamber;

[0089] 6) Place the culture plate with the Transwell chamber in a cell culture incubator and continue culturing for 24 hours;

[0090] 7) Take out the Transwell chamber, gently scrub the upper chamber with a cotton swab dipped in PBS, fix it with fixative for 20 minutes, wash it with PBS, add 5% crystal violet staining solution, and stain it for 20 minutes;

[0091] 8) After staining, the chamber was washed with PBS to remove excess staining solution, and the chamber was observed and photographed under a microscope. Five fields of view were randomly selected to calculate the average number of invading cells.

[0092] from Figure 6 The results show that compared with the average number of invasive cells in the control group transfected with pcDNA3.1 plasmid, which was 197, the average number of invasive cells in the experimental group transfected with pcDNA3.1-lncRNA plasmid was 113. This data shows that increasing the expression of lncRNA RP11-153K16.2 significantly inhibited the invasive ability of gastric cancer cells.

[0093] Based on this finding, lncRNA RP11-153K16.2 is expected to be a potential therapeutic target for inhibiting gastric cancer cell invasion. Increasing the expression of lncRNA RP11-153K16.2 through gene therapy or drug delivery system may effectively inhibit the invasion and metastasis of gastric cancer.

[0094] In summary, the present invention explores the important role of lncRNA RP11-153K16.2 in the diagnosis and treatment of gastric cancer. The present invention found that detecting the expression level of lncRNA RP11-153K16.2 in peripheral blood exosomes provides a non-invasive, simple and efficient means for early diagnosis of gastric cancer. In addition, overexpression of lncRNA RP11-153K16.2 significantly inhibited the proliferation and invasion of gastric cancer cells, indicating its potential in the treatment of gastric cancer. Therefore, in the future, increasing the expression of lncRNA RP11-153K16.2 in gastric cancer cells through gene therapy or drug delivery system is expected to effectively control tumor progression and improve patient prognosis.

Claims

1. Use of primers for detecting the expression level of lncRNA RP11-153K16.2 gene in peripheral blood exosomes in the preparation of a qRT-PCR kit for auxiliary diagnosis of gastric cancer, characterized in that: The qRT-PCR kit identifies gastric cancer patients by detecting the relative expression level of lncRNA RP11-153K16.2 in peripheral blood exosomes; The transcript sequence of the lncRNA RP11-153K16.2 is shown in SEQ ID NO.

1.

2. Use of the primers for detecting the expression level of lncRNA RP11-153K16.2 gene in peripheral blood exosomes according to claim 1 in preparing a qRT-PCR kit for auxiliary diagnosis of gastric cancer, characterized in that: The sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. Use of a gene preparation in the preparation of a drug for inhibiting gastric cancer, characterized in that: The gene preparation is a plasmid capable of expressing lncRNA RP11-153K16.2, and the transcript sequence of the lncRNA RP11-153K16.2 is shown in SEQ ID NO.

1.

4. Use of a gene preparation in the preparation of a drug for inhibiting the proliferation and invasion of gastric cancer cells, characterized in that: The gene preparation is a plasmid capable of expressing lncRNA RP11-153K16.2, and the transcript sequence of the lncRNA RP11-153K16.2 is shown in SEQ ID NO.

1.

5. Use of a gene preparation according to claim 4 in the preparation of a drug for inhibiting the proliferation and invasion of gastric cancer cells, characterized in that: The gastric cancer cell line is BGC-823.

Images