Preparation and use of frame nucleic acid drugs with sirt1 gene targeting activation function

By loading specific saRNAs onto framework nucleic acids to form Tsa, the problem of existing RNA therapies being unable to upregulate SIRT1 expression is solved. This enables the continuous activation of SIRT1 in a high-glucose environment, inhibiting inflammation and promoting osteogenic activity, thus effectively treating diabetic osteoporosis.

CN118879700BActive Publication Date: 2025-11-07SICHUAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410967643.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-18
Publication Date
2025-11-07
Estimated Expiration
2044-07-18

AI Technical Summary

Technical Problem

Existing RNA therapies such as siRNA and miRNA can only silence and inhibit gene expression, but cannot upregulate it. Furthermore, siRNA has poor serum stability, is easily degraded, and has low cell membrane permeability, which limits its application in the treatment of diabetic osteoporosis.

Method used

Using a specific tetrahedral framework nucleic acid (tFNA) to carry saRNA, and through specific nucleotide sequence design, a framework nucleic acid (Tsa) with SIRT1 gene targeting activation function is formed to continuously upregulate SIRT1 expression in a high-glucose environment, inhibit inflammatory factors and promote osteogenic activity.

Benefits of technology

Tsa can effectively activate SIRT1 gene expression, inhibit inflammatory response, rebuild bone immune microenvironment, significantly improve diabetic osteoporosis, and has excellent serum stability and cell membrane permeability, achieving a lasting therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879700B_ABST
    Figure CN118879700B_ABST
Patent Text Reader

Abstract

The application discloses a framework nucleic acid with SIRT1 gene targeting activation function, which is a tetrahedral framework nucleic acid carrying saRNA. The application carries specific saRNA on specific framework nucleic acid tFNAs, so that cells in a high-sugar environment can effectively and continuously up-regulate the expression of SIRT1, inhibit the expression of inflammatory factors, play a whole-body anti-inflammatory and antioxidant function, and rebuild a good bone immune microenvironment by regulating the interaction between macrophages and osteoblasts, so as to realize the prevention and treatment of common diseases, i.e. diabetic osteoporosis, in complications of diabetes.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application particularly relates to the preparation and use of a frame nucleic acid drug with SIRT1 gene targeting activation function. BACKGROUND

[0002] Diabetes mellitus (DM) patients have persistent hyperglycemia and secondary complications, such as diabetic nephropathy, diabetic retinopathy and diabetic osteoporosis. Diabetic osteoporosis (DOP) is a common complication of diabetes, which leads to bone loss, decreased bone density and increased incidence of bone fracture in patients. Epidemiological studies have shown that diabetic patients have much higher risk of osteoporosis and bone fracture compared with healthy people, which reduces the quality of life of patients and brings huge economic burden. At present, there is no effective treatment for diabetic osteoporosis, and it is even seriously neglected. Clinical management mainly focuses on blood glucose control. For more severe patients, calcium supplements or bisphosphonates and other drugs for primary osteoporosis are used for adjuvant therapy. Therefore, there is an urgent need to develop new drugs to treat diabetic osteoporosis and minimize drug side effects as much as possible.

[0003] Sirtuin-1 (SIRT1) is an NAD+-dependent deacetylase that deacetylates downstream target proteins such as NF-κB, FoxO and p53. SIRT1 plays a beneficial role in cellular metabolic processes, including anti-inflammatory, anti-oxidative stress, anti-aging, pro-insulin sensitivity and pro-osteostatic homeostasis. Studies have shown that SIRT1 plays a positive role in promoting osteoblastic activity. Therefore, promoting SIRT1 expression may be beneficial for the treatment of diabetic osteoporosis.

[0004] RNA therapy is an emerging gene therapy strategy, and various gene-inhibiting RNA nucleic acid drugs such as siRNA and miRNA drugs have been widely used in research and clinical treatment. However, since siRNA and miRNA can only silence and inhibit gene expression, but cannot up-regulate gene expression, this limits the application range of RNA therapy. The discovery of small activating RNA (saRNA) provides a new solution. This type of RNA is defined as a double-stranded RNA consisting of about 20 nucleotides. Unlike the mechanism of siRNA forming an RNA-induced silencing complex (RISC) to inhibit target gene expression, existing theories speculate that saRNA helps to continuously transcribe and up-regulate target gene expression by producing an RNA-induced transcriptional activation complex (RITA), but it should be noted that the specific mechanism of action has not been clearly defined and requires further exploration. In addition, although saRNA has the ability to activate target genes, its inherent characteristics, such as poor serum stability, easy decomposition and low cell membrane permeability, limit their role as a gene regulation tool.

[0005] DNA tetrahedral framework nucleic acid (tFNAs) is a nucleic acid molecule synthesized by several DNA single strands (usually 4) through base complementary pairing, which has good stability in vivo, can be used as a small molecule drug / RNA / DNA carrier, and can also be used as the skeleton structure of some detection probes; at the same time, TFNAs have good biological effects.

[0006] At present, there is no report on the application of DNA tetrahedral nucleic acid structure combined with saRNA to target activate SIRT1 to achieve effective treatment of diabetic osteoporosis. SUMMARY

[0007] To solve the above problems, the application provides a framework nucleic acid with SIRT1 gene target activation function, which is a tetrahedral framework nucleic acid carrying saRNA.

[0008] The nucleotide sequence of the saRNA is as shown in SEQ ID NO. 5-6, SEQ ID NO. 7-8, SEQ ID NO. 9-10, SEQ ID NO. 11-12 or SEQ ID NO. 13-14.

[0009] Further, the nucleotide sequence of the four DNA single strands of the tetrahedral framework nucleic acid is as shown in SEQ ID NO. 1-4.

[0010] Further, the molar ratio of the tetrahedral framework nucleic acid to saRNA is 1:1.

[0011] The application also provides a preparation method of the aforementioned framework nucleic acid, which comprises the following steps:

[0012] Four DNA single strands are taken and added to TM buffer, maintained at 95 DEG C for 10 min, rapidly cooled to 4 DEG C for more than 20 min, then saRNA is added, and incubated at 37 DEG C for more than 30 min, to obtain the product.

[0013] Further, the final concentration of the four DNA single strands and saRNA is the same.

[0014] Further, the final concentration of the four DNA single strands and saRNA is 1000nM.

[0015] Further, the pH value of the TM buffer is 8.0; and the incubation time is 60 min.

[0016] Finally, the application provides a use of the aforementioned tetrahedral framework nucleic acid in the preparation of a drug for preventing and / or treating diabetic inflammatory complications.

[0017] Further, the drug is a drug for preventing and / or treating diabetic osteoporosis.

[0018] Still further, the drug has the action of targeting activation of SIRT1 gene expression, reduction of inflammatory response, regulation of bone immune microenvironment, and promotion of osteogenesis activity.

[0019] The framework nucleic acid with the SIRT1 gene targeting activation function of the present application can effectively and continuously up-regulate the expression of SIRT1 in cells in a high-sugar environment by loading a specific saRNA on a specific framework nucleic acid tFNAs, and can inhibit the expression of inflammatory factors by deacetylating downstream substrates, including inhibiting the Acetyl-NF-κB p65 (Acetyl-NF-κB) pathway, thereby playing a whole-body anti-inflammatory and antioxidant function. The in vivo and in vitro tests prove that the SIRT1 gene activation type framework nucleic acid of the present application can also reconstruct a good bone immune microenvironment by regulating the interaction between macrophages and osteoblasts, and achieve the prevention and treatment of diabetic osteoporosis, a common disease in diabetic complications. It has practical popularization and application value.

[0020] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and conventional means in the art, other various forms of modifications, substitutions or changes can be made without departing from the above basic technical idea of the present application.

[0021] The above content of the present application will be further described in detail through the specific embodiments in the form of examples. However, this should not be understood as limiting the scope of the above subject matter of the present application to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 : Synthesis and characterization of Tsa system; A) Schematic diagram of Tsa assembled by DNA and RNA chains; B) PAGE gel electrophoresis test proves the successful synthesis of tFNA and Tsa (from left to right, S1, S2, S3, sS4, tFNA, Tsa, saRNA); C) HPCE high performance liquid chromatography verifies the successful synthesis of Tsa system; D) Dynamic light scattering detects the potential and particle size of Tsa system; E, F) Atomic force microscope (AFM) and transmission electron microscope (TEM) characterize the Tsa system; G) Stability of saRNA and Tsa in 10% concentration fetal bovine serum for 0, 4, 8, 12 and 24 h; h) CCK-8 method is used to detect the biocompatibility of Tsa and the influence on the cell activity of RAW264.7 and MC3T3-E1; I-K) Cell membrane penetration performance identification of Tsa and saRNA (RAW264.7 and MC3T3-E1 cell lines).

[0023] Figure 2 mRNA transcription level.

[0024] Figure 3 SIRT1 protein expression level.

[0025] Figure 4 : Construction of diabetic mouse model. A) Schematic diagram of construction of diabetic mouse model. B) Blood glucose and body weight record analysis of control group (Ctrl) and diabetic group (DM). C) Insulin tolerance test (IPITT) and glucose tolerance test (IPGTT) results of control group and DM group. D) Pancreas H&E staining. Scale bar: 200 pm. E) Tibia H&E, Masson and Goldner staining. Scale bar: 200 pm. F) Bone tissue (longitudinal section, transverse section) Micro-CT three-dimensional image and parameter analysis (BV / TV, tbn). Scale bar: 500 pm.

[0026] Figure 5 : Tsa can alleviate diabetic osteoporosis in mice; A) Schematic diagram of treatment strategy of diabetic mice. B) Blood glucose and body weight record of control group, DM group, DM+saR group, DM+tFNA group and DM+Tsa group; C) Micro-CT three-dimensional image (longitudinal section, transverse section) and thermal imaging of bone tissue samples. Scale bar: 500 pm; D) Trabecular parameter analysis (BV / TV, Tb.N, Tb.Th, and Tb.Sp). E) Bone tissue H&E, Masson and Goldner staining, scale bar: 200 pm; F) Quantitative analysis of bone tissue trabecular volume fraction, collagen volume fraction, and new bone formation volume fraction; G) Immunohistochemical staining and analysis of bone tissue OPN and RUNX2 indicators.

[0027] Figure 6 : Tsa treats diabetic osteoporosis by regulating bone immune homeostasis. A) Immunofluorescence staining of CD206 and iNOS in tissue sections, green: CD206; red: iNOS; blue: nucleus, scale bar: 40 pm; B) Semi-quantitative analysis of CD206 and iNOS; C) Immunohistochemical staining and semi-quantitative analysis of IL-1β, scale bar: 200 pm; D) Immunofluorescence staining of CD206 and RUNX2. (Green: CD206; red: RUNX2; blue: nucleus, scale bar: 40 pm; E) Semi-quantitative analysis of CD206 and RUNX2.

[0028] Figure 7: Tsa reestablishes bone immune microenvironment in diabetic mice by targeting SIRT1 / Ac-p65 pathway; A) Immunofluorescence staining of SIRT1 and acetylation Acetyl-NF-κB p65 (Ac-p65); Red: SIRT1; Green: Ac-p65; Blue: Nucleus. Scale bar: 40 μm; B) Semi-quantitative analysis of SIRT1 and Ac-p65; C) SIRT1 staining and semi-quantitative analysis; D) Ac-p65 immunohistochemical staining and semi-quantitative analysis, scale bar: 200 μm.

[0029] Figure 8 : Tsa regulates M1 / M2 macrophage polarization under high glucose microenvironment; A) Schematic diagram of the role of Tsa in regulating macrophage polarization; B, C) Protein expression levels and semi-quantitative analysis of TNF-α, IL-1β, IL-10, Arg-1; D, E) Immunofluorescence staining and semi-quantitative analysis of IL-1β, TNF-α, Arg-1 and IL-10.

[0030] Figure 9 : Tsa promotes M2 polarization of macrophages by regulating SIRT1 / Acetyl-NF-κB pathway; A) Schematic diagram of Tsa activating SIRT1 expression regulating Acetyl-NF-κB pathway; B) Protein expression level and semi-quantitative analysis of SIRT1; C) Protein expression level and semi-quantitative analysis of Ac-p65; D) Immunofluorescence staining and semi-quantitative analysis of SIRT1 and Ac-p65; Red: SIRT1 / Ac-p65; Green: cytoskeleton; Blue: nucleus. Scale bar: 20 μm; E, F) Protein expression levels and semi-quantitative analysis of p65, p-p65, Iκb-α, p-Iκb-α; G, H) Immunofluorescence staining and semi-quantitative analysis of p65, p-p65, Iκb-α, p-Iκb-α.

[0031] Figure 10: Tsa reestablishes bone immunohomeostasis through the interaction of macrophages and osteoblasts; A) Alkaline phosphatase (ALP) staining shows the inhibitory effect of high glucose environment and different concentrations of advanced glycation end products (AGEs) on osteogenic activity; B) Schematic diagram of high glucose environment culture model of osteoblasts (without macrophages); ALP staining and quantitative analysis of MC3T3-E1 osteoblasts; C) Schematic diagram of co-culture model of osteoblasts and macrophages (high glucose environment); D) Detection of reactive oxygen species level of MC3T3-E1; (Green: ROS. Blue: nucleus. Scale bar: 100 μm); E) ALP staining and quantitative analysis of MC3T3-E1 under co-culture model conditions; F) Alizarin red staining and quantitative analysis of MC3T3-E1 under co-culture model conditions; G) Schematic diagram of Tsa reestablishing bone immunohomeostasis through the interaction of macrophages and osteoblasts and promoting osteogenesis; H) Expression levels of osteogenic proteins ALP, RUNX2, OSX, OPN, and β-catenin. DETAILED DESCRIPTION

[0032] Example 1 Preparation and characterization of SIRT1 gene-activated tetrahedral framework nucleic acid (Tsa) of the present application

[0033] 1. Synthesis method

[0034] Four DNA single strands (S1, S2, S3, sS4) were dissolved in TM Buffer (10 mM Tris-HCl, 50 mM MgCl2, pH = 8.0) to a final concentration of 1000 nM, and then mixed thoroughly and rapidly heated to 95°C for 10 minutes, followed by rapid cooling to 4°C and maintaining for 20 minutes or more, to obtain tFNA. Then, equal concentration of saRNA was incubated with the above DNA tetrahedron at 37°C for 60 minutes to complete the synthesis of Tsa. The synthesis schematic diagram is shown in Figure 1 A.

[0035] The sequences of the four single strands (5'→3') are as follows:

[0036] S1:

[0037] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)

[0038] S2:

[0039] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2)

[0040] S3:

[0041] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQID NO.3)

[0042] sS4:

[0043] GACCTGTGAATTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO.4)

[0044] SaRNA-SIRT1 (sense):

[0045] UUCACAGGUCUCUUUCCAGGAGGGCAACA (SEQ ID NO.5)

[0046] SaRNA-SIRT1 (antisense):

[0047] UGUUGCCCUCCUGGAAAGA (SEQ ID NO.6)

[0048] 2. Identification

[0049] PAGE and capillary electrophoresis results showed that Tsa was synthesized from four single-stranded DNA molecules into a tetrahedral framework nucleic acid (tFNA) structure, carrying double-stranded saRNA, thus completing the synthesis of the final Tsa product. The molecular weight of Tsa is approximately 280 bp. Figure 1 B, C); Particle size analysis results show that the Tsa nanostructure size is approximately 15 nm, and potential analysis shows that the Tsa charge is approximately -5.95 mV (B, C). Figure 1 D); Transmission electron microscopy and atomic force microscopy results show that Tsa is a roughly triangular object with a diameter of approximately 20 nm. Figure 1 E, F). Serum stability experiments demonstrated that Tsa exhibits superior structural stability and resistance to enzymatic degradation compared to simple saRNA. Figure 1 G). Fluorescence microscopy results showed that Tsa carrying Cy5 fluorescent labeling could penetrate the cell membrane in large quantities and enter macrophages and osteoblasts within a short period of time. Figure 1 I, J, K). The above results indicate the successful synthesis of Tsa, which exhibits good serum stability, excellent cell membrane penetration, and saRNA delivery function.

[0050] 3. Preliminary verification of the effect on SIRT1 gene expression

[0051] After successful synthesis of Tsa, macrophage RAW264.7 cells were cultured in a high-sugar medium model, and treated with 200 nmol / L of Tsa, tFNA and saRNA respectively for 72 h, then samples were collected, mRNA transcription level in the cells was detected by qPCR, and SIRT1 expression level in the cells was detected by western blot, and the results are shown in Figures 2-3 .

[0052] From Figure 2 it can be seen that the mRNA transcription level in the cells treated with Tsa is significantly higher than that in the cells treated with tFNA and saRNA, and Tsa has stronger SIRT1 gene activation and up-regulation function.

[0053] From Figure 3 it can be seen that under the same concentration and time effect, Tsa has more obvious up-regulation effect on target gene SIRT1 than saRNA and tFNA, and Tsa belongs to the activated framework nucleic acid with better activation effect.

[0054] In the preliminary effect verification, four other saRNAs were also synthesized at the same time, and were carried on tFNA according to the foregoing synthesis method, new structures were synthesized, and SIRT1 gene activation verification was performed, and the results showed that the activation effects of different RNA sequences on SIRT1 gene were different. The mRNA transcription level and SIRT1 protein expression level of the tetrahedral framework nucleic acid carrying the other four saRNA double-stranded sequences (saRNA-SIRT1-2 to saRNA-SIRT1-5) were not as good as the foregoing Tsa. The Tsa synthesized by SEQ ID NO.5~6 sequence+tFNA had the best activation effect on SIRT1 gene, and the other four saRNAs involved were:

[0055] SaRNA-SIRT1-2 (sense) :

[0056] UUCACAGGUCACGUGACCCGGCGUGUUGU (SEQ ID NO.7)

[0057] SaRNA-SIRT1-2 (antisense) :

[0058] ACAACACGCCGGGUCACGU (SEQ ID NO.8)

[0059] SaRNA-SIRT1-3 (sense) :

[0060] UUCACAGGUCCACGUGACGGGGUUUAAAU (SEQ ID NO.9)

[0061] SaRNA-SIRT1-3 (antisense) :

[0062] AUUUAAACCCCGUCACGUG (SEQ ID NO. 10)

[0063] SaRNA-SIRT1-4 (sense) :

[0064] UUCACAGGUCUUAAAUCUCCCGCAGCCGA (SEQ ID NO. 11)

[0065] SaRNA-SIRT1-4 (antisense) :

[0066] UCGGCUGCGGGAGAUUUAA (SEQ ID NO. 12)

[0067] SaRNA-SIRT1-5 (sense) :

[0068] UUCACAGGUCUCUUCCCAGGAGGACAUAU (SEQ ID NO. 13)

[0069] SaRNA-SIRT1-5 (antisense) :

[0070] AUAUGUCCUCCUGGGAAGA (SEQ ID NO. 14)

[0071] The beneficial effects of the Tsa synthesized from the saRNA+tFNA of the nucleotide sequence shown in SEQ ID NO. 5~6 in Example 1 are further illustrated by way of experimental examples below.

[0072] Experimental Example 1 In vivo experiment of Tsa nanodrug for preventing and treating diabetic inflammatory complications - diabetic osteoporosis

[0073] A high-fat high-sugar diet and injection of streptozotocin (STZ) were used to construct an animal model of diabetic mice for in vivo experiments. After the modeling was completed, the diabetic mice were treated with Tsa and other nucleic acid drugs, and the effects of Tsa on preventing and inhibiting diabetic inflammatory complications and diabetic osteoporosis were evaluated.

[0074] 1. Methods

[0075] (1) 4-week-old male C57BL / 6J mice were purchased and acclimated for one week.

[0076] (2) After 1 month of high-fat high-sugar diet, the mice were injected with STZ for 5 consecutive days to construct a diabetic mouse model at 9 weeks of age. The normal control group (Control) was fed with ordinary feed at the same period, and injected with normal saline.

[0077] (3) Experimental group: including diabetic group (DM), diabetic + simple saRNA group (DM+saRNA), diabetic + tetrahedral tFNA group (DM+tFNA), diabetic + Tsa group (DM+Tsa), respectively injected with normal saline or nucleic acid drugs of the same concentration and volume (100 μL of 1000M): saRNA, tFNA or Tsa; the normal control group was injected with the same volume of normal saline, and each group was injected twice a week for 8 consecutive weeks. After the drug treatment ended (i.e. at 18 weeks of age), blood and bone tissue were collected for detection and analysis. During the entire drug administration and observation process, the blood glucose level, body weight change, water intake and urine output of the mice were monitored.

[0078] (4) The parameters of femur and tibia were analyzed by micro-CT, and the bone tissue and analysis indicators were observed by tissue section staining. The collected blood was separated to obtain serum for ELISA detection of inflammatory indicators IL-1β and TNF-α. The target gene SIRT1 protein and osteogenesis-related protein immunofluorescence levels were detected. All data were expressed as mean ± standard deviation (n = 6), and one-way ANOVA and Tukey correction were used for multiple comparisons.

[0079] 2. Results

[0080] The specific results are shown in Figures 4-7 , Figure 4 It is shown that compared with the normal control group, the blood glucose of the diabetic mouse model established by 1 month of high-fat high-sugar diet and then continuous injection of STZ for one week was significantly increased, the body weight was decreased, the islet tissue was severely damaged, the insulin and glucose tolerance were decreased, indicating that the diabetic mouse model was successfully constructed; at the same time, the trabecular bone density was significantly reduced, indicating that the diabetic osteoporosis was complicated.

[0081] Figure 5 It is shown that the Tsa drug has the effect of relieving diabetic osteoporosis and promoting osteogenesis gene expression. Figure 5 A and B are schematic diagrams of diabetic osteoporosis mouse modeling and drug treatment strategy and body weight and blood glucose monitoring records. From the records, it can be seen that the injection of saRNA / tFNA / Tsa nucleic acid drugs into the diabetic mouse model based on the successful construction of the diabetic mouse model has no significant effect on the blood glucose and body weight change of the diabetic mouse model; Figure 5 C and D are schematic diagrams of micro-CT scanning 3D reconstruction of bone samples and parameter analysis. From the parameter analysis statistics, it can be seen that Tsa can increase the trabecular bone density and related parameters, and saRNA and tFNA have a certain effect on inhibiting bone loss, but not as good as Tsa.Figure 5 E, F are HE / Masson / Goldener staining of bone tissue sections and statistical analysis; from the parameter analysis statistics, it can be seen that Tsa can promote the activity of osteoblasts, promote the secretion of type I collagen, and promote the production of new bone, while the effects of saRNA and tFNA are weak, and Tsa produces a synergistic effect in bone regeneration and repair. Figure 5 G is the immunohistochemical staining of bone tissue sections for osteogenic marker protein OPN / RUNX2, and from the staining results, it can be seen that Tsa can better promote the expression of osteogenic proteins OPN and RUNX2 compared to saRNA and tFNA.

[0082] Figure 6 Tsa drug regulates the level of macrophage M1 / M2 polarization in bone tissue, and promotes M2 type polarization to regulate the osteogenic activity of bone cells. Figure 6 A, B are CD206 and iNOS immunofluorescence staining and analysis, showing that Tsa promotes the anti-inflammatory M2 polarization of macrophages in bone tissue and inhibits the pro-inflammatory M1 polarization. Figure 6 C is the immunohistochemical staining analysis of inflammatory factor IL-1β. Figure 6 D, E are CD206 and RUNX2 immunofluorescence staining and analysis, indicating that Tsa promotes M2 macrophage polarization and RUNX2 expression level in bone tissue, and promotes osteogenesis. The effect of Tsa drug is better than that of simple saRNA or tFNA.

[0083] Figure 7 Bone tissue immunofluorescence and immunohistochemical results show that Tsa drug can up-regulate SIRT1 protein expression level and inhibit Acetyl-NF-κB p65 expression level.

[0084] The above results show that Tsa synthesized by saRNA+tFNA with nucleotide sequences as shown in SEQ ID NO. 5~6 can better improve the bone microenvironment compared to simple saRNA or tFNA with nucleotide sequences as shown in SEQ ID NO. 5~6, and has a synergistic effect in promoting bone regeneration and repair.

[0085] Experimental Example 2: Tsa prevents and treats diabetic inflammatory complications-diabetic osteoporosis in vitro experiment

[0086] 1. Method

[0087] The in vitro diabetic high glucose environment is simulated by 35 mmol / L high glucose DMEM medium + 150 μg / mL advanced glycosylation end product AGEs, and the normal environment is simulated by standard 25 mmol / L glucose DMEM medium. The groups are as follows: control group (Control), high glucose model group (HG), high glucose + saRNA group (HG+saR), high glucose + tFNA group (HG+tFNA), and high glucose + Tsa group (HG+Tsa). In the high glucose medium model, macrophages RAW264.7 are co-cultured with preosteoblasts MC3T3-E1, and are treated with PBS, saRNA, tFNA, or Tsa (nucleic acid drug concentration is 200 nmol / L) according to the above grouping. The control group is treated with PBS to simulate the normal environment. After the treatment, the osteogenic phenotype (ALP, ARS) and the expression of related osteogenic proteins of the osteoblasts are detected, and the expression of inflammation-related indicators of the macrophages is detected.

[0088] 2. Results

[0089] The specific results are shown in Figures 8-10 , Figure 8 It is shown that Tsa can regulate the M1 / M2 macrophage polarization ratio in a high glucose microenvironment, and Tsa can significantly inhibit the expression levels of inflammatory factors TNF-α and IL-1β, while promoting the expression of anti-inflammatory factors IL-10 and Arg-1. Figure 9 It is shown that under a high glucose environment, Tsa promotes M2 polarization of macrophages by regulating the SIRT1 / Acetyl-NF-κB pathway. The SIRT1 protein expression levels on the 3rd day and the 7th day after Tsa drug action are higher than those of the high glucose HG model group, and the effect is better than that of the saRNA treatment group. Figure 10 It is shown that Tsa can regulate the interaction between macrophages and osteoblasts to reconstruct the bone immune homeostasis. Under the treatment of Tsa nucleic acid, the osteogenic activity of osteoblasts is significantly up-regulated, the alkaline phosphatase (ALP) staining activity is up-regulated, and the number of alizarin red staining calcified nodules is increased. The expression levels of osteogenic related proteins ALP, RUNX2, OSX, OPN, and β-catenin are significantly up-regulated.

[0090] The above results show that Tsa can target and activate the SIRT1 gene, up-regulate the expression level, deacetylate the downstream Acetyl-NF-κB p65, regulate the M1 / M2 type polarization function of macrophages, promote the reconstruction of the bone immune microenvironment, and promote the osteogenic activity of osteoblasts. The experimental results prove that Tsa has stronger, more stable, and more durable functions than the existing simple saRNA. Tsa is a high-efficiency nucleic acid targeted drug, which can effectively deliver saRNA and achieve a long-lasting target gene activation effect to regulate the bone immune microenvironment and prevent and treat diabetic osteoporosis.

[0091] In summary, the framework nucleic acid Tsa with SIRT1 gene targeting activation function of the present application can inhibit the expression of inflammatory factors in a high glucose environment, play an anti-inflammatory and antioxidant function, and at the same time, through regulation of the interaction between macrophages and osteoblasts, reconstruct a good bone microenvironment, thereby achieving an excellent effect of preventing and treating diabetic osteoporosis.

Claims

1. A frame nucleic acid for preventing and treating diabetic osteoporosis having a SIRT1 gene targeting activation function, characterized by: It is a tetrahedral framework nucleic acid loaded with saRNA; ​ The nucleotide sequence of the saRNA is shown as SEQ ID NO. 5~6; The nucleotide sequence of the four DNA single strands of the tetrahedral framework nucleic acid is shown as SEQ ID NO. 1~4.

2. The framework nucleic acid of claim 1, wherein: The molar ratio of the tetrahedral framework nucleic acid to the saRNA is 1:

1.

3. A method for preparing the framework nucleic acid of claim 1 or 2, characterized by: It comprises the following steps: Take the four DNA single strands and add them to the TM buffer, maintain 95℃ for 10 min, quickly cool to 4℃ for more than 20 min, then add the saRNA, and incubate at 37℃ for more than 30 min, and it is obtained.

4. The method of claim 3, wherein: The final concentration of the four DNA single strands and the saRNA is the same.

5. The method of claim 4, wherein: The final concentration of the four DNA single strands and the saRNA is 1000 nM.

6. The method of claim 3, wherein: The pH value of the TM buffer is 8.0; the incubation time is 60 min.

7. The use of the tetrahedral framework nucleic acid of claim 1 or 2 in the preparation of a drug for preventing and / or treating diabetic osteoporosis.

8. Use according to claim 7, characterized in that: The drug has the effects of targeting the activation of SIRT1 gene expression, reducing inflammatory response, regulating bone immune microenvironment, and promoting osteogenic activity.

Citation Information

Patent Citations

  • Application of DNA tetrahedron in preparation of medicine for treating diabetes

    CN112843082A

  • Tetrahedral framework nucleic acid targeting RAGE and application of tetrahedral framework nucleic acid

    CN117106775A

  • SIRT1-sarna compositions and methods of use

    US20210102204A1